Infection

Cat. No.	Product Name	CAS No.	Purity	Chemical Structure

• HY-Y0320

  Dimethyl sulfoxide, meets analytical specification of Ch.P.	67-68-5
  Dimethyl sulfoxide (DMSO), meets analytical specification of Ch.P. is an aprotic solvent that dissolves polar and non-polar compounds, including water-insoluble therapeutic and toxic agents. Dimethyl sulfoxide (DMSO) has a strong affinity for water and can rapidly penetrate or enhance the penetration of other substances into biological membranes. Dimethyl sulfoxide also has potential free radical scavenging and anticholinesterase effects and may affect coagulation activity. Dimethyl sulfoxide also induces histamine release from mast cells but is thought to have low systemic toxicity. Dimethyl sulfoxide also exhibits antifreeze and antibacterial properties[1][2][3]. MCE provides Dimethyl sulfoxide that complies with the inspection standards (Ch.P) of Part 4 of the Chinese Pharmacopoeia (2020 Edition). Amicrobic, low endotoxin, can be used in various biochemical experiments such as drug dissolution.

  

• HY-17589A

  Chloroquine	54-05-7	99.50%
  Chloroquine is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].

  

• HY-15142

  Doxorubicin hydrochloride	25316-40-9
  Doxorubicin hydrochloride (Hydroxydaunorubicin hydrochloride; ADR), a cytotoxic anthracycline antibiotic, is an anti-cancer chemotherapy agent. Doxorubicin hydrochloride is a potent human DNA topoisomerase I and topoisomerase II inhibitor with IC50s of 0.8 μM and 2.67 μM, respectively. Doxorubicin hydrochloride reduces basal phosphorylation of AMPK and its downstream target acetyl-CoA carboxylase. Doxorubicin hydrochloride induces apoptosis and autophagy[1][2][3].

  

• HY-100558

  Bafilomycin A1	88899-55-2
  Bafilomycin A1 (BafA1) is a specific and reversible inhibitor of vacuolar H+-ATPase (V-ATPase) with IC50 values of 4-400 nmol/mg. Bafilomycin A1, a macrolide antibiotic, is also used as an autophagy inhibitor at the late stage. Bafilomycin A1 blocks autophagosome-lysosome fusion and inhibits acidification and protein degradation in lysosomes of cultured cells. Bafilomycin A1 induces apoptosis[1][2][3].

  

• HY-14648

  Dexamethasone	50-02-2
  Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist, apoptosis inducer, and common disease inducer in experimental animals, constructing models of muscle atrophy, hypertension, and depression. Dexamethasone can inhibit the production of inflammatory miRNA-155 exosomes in macrophages and significantly reduce the expression of inflammatory factors in neutrophils and monocytes. Dexamethasone also has potential for use in COVID-19 research[1][2][3][4].

  

• HY-B0215

  Acetylcysteine	616-91-1
  Acetylcysteine (N-Acetylcysteine) is a mucolytic agent which reduces the thickness of the mucus. Acetylcysteine is a ROS inhibitor. Acetylcysteine is a cysteine precursor, prevents hemin-induced ferroptosis by neutralizing toxic lipids generated by arachidonate-dependent activity of 5-lipoxygenases. Acetylcysteine induces cell apoptosis. Acetylcysteine also has anti-influenza virus activities. In addition, Acetylcysteine ​​is the most stable form of cysteine ​​during drug delivery and can be used in disulfidptosis studies[1][2][3][4][5][6][7][8].

  

• HY-10108

  LY294002	154447-36-6
  LY294002 is a broad-spectrum inhibitor of PI3K with IC50s of 0.5, 0.57, and 0.97 μM for PI3Kα, PI3Kδ and PI3Kβ, respectively[1]. LY294002 also inhibits CK2 with an IC50 of 98 nM[2]. LY294002 is a competitive DNA-PK inhibitor that binds reversibly to the kinase domain of DNA-PK with an IC50 of 1.4 μM. LY294002 is an apoptosis activator[3].

  

• HY-15141

  Staurosporine	62996-74-1
  Staurosporine is a potent, ATP-competitive and non-selective inhibitor of protein kinases with IC50s of 6 nM, 15 nM, 2 nM, and 3 nM for PKC, PKA, c-Fgr, and Phosphorylase kinase respectively. Staurosporine also inhibits TAOK2 with an IC50 of 3 μM. Staurosporine is an apoptosis inducer[1][2][3][4][5].

  

• HY-B1743A

  Puromycin dihydrochloride	58-58-2
  Puromycin dihydrochloride (CL13900 dihydrochloride), an aminonucleoside antibiotic, inhibits protein synthesis[1].

  

• HY-13629

  Etoposide	33419-42-0
  Etoposide (VP-16; VP-16-213) is an anti-cancer chemotherapy agent. Etoposide inhibits topoisomerase II, thus stopping DNA replication. Etoposide induces cell cycle arrest, apoptosis and autophagy[1].

  

• HY-16592

  Brefeldin A	20350-15-6
  Brefeldin A (BFA) is a lactone antibiotic and a specific inhibitor of protein trafficking. Brefeldin A blocks the transport of secreted and membrane proteins from endoplasmic reticulum to Golgi apparatus[1][2]. Brefeldin A is also an autophagy and mitophagy inhibitor[3]. Brefeldin A inhibits HSV-1 and has anti-cancer activity[5].

  

• HY-B0988

  Deferoxamine mesylate	138-14-7
  Deferoxamine mesylate (Deferoxamine B mesylate) is an iron chelator (binds to Fe(III) and many other metal cations), is widely used to reduce iron accumulation and deposition in tissues. Deferoxamine mesylate upregulates HIF-1α levels with good antioxidant activity. Deferoxamine mesylate also shows anti-proliferative activity, can induce apoptosis and autophagy in cancer cells. Deferoxamine mesylate can be used in studies of diabetes, neurodegenerative diseases as well as anti-cancer and anti-COVID-19[1][2][3][4][5].

  

• HY-17561

  G-418 disulfate	108321-42-2
  G-418 disulfate (Geneticin sulfate), is an aminoglycoside antibiotic, inhibits protein synthesis in eukaryotes and prokaryotes. G-418 disulfate is commonly used as a selective agent for eukaryotic cells[1].

  

• HY-10586

  5-Azacytidine	320-67-2
  5-Azacytidine (Azacitidine; 5-AzaC; Ladakamycin) is a nucleoside analogue of cytidine that specifically inhibits DNA methylation. 5-Azacytidine is incorporated into DNA to covalently trap DNA methyltransferases and contributes to reverse epigenetic changes[1][2]. 5-Azacytidine induces cell autophagy[4].

  

• HY-13433

  Thapsigargin	67526-95-8
  Thapsigargin, an endoplasmic reticulum (ER) stress inducer, is an inhibitor of microsomal Ca2+-ATPase. Thapsigargin efficiently inhibits coronavirus (HCoV-229E, MERS-CoV, SARS-CoV-2) replication in different cell types[1][2][3][4][5].

  

• HY-100381

  Nigericin sodium salt	28643-80-3
  Nigericin sodium salt is an antibiotic derived from Streptomyces hygroscopicus that act as a K+/H+ ionophore, promoting K+/H+ exchange across mitochondrial membranes. Nigericin sodium salt is a NLRP3 activator. Nigericin sodium salt shows promising anti-cancer activities through decreasing intracellular pH (pHi), and inactivation of Wnt/β-catenin signals. Nigericin sodium salt induces pyroptosis through caspase 1/GSDMD in TNBC[1][2][3][4][5][6][7].

  

• HY-107202

  Polyinosinic-polycytidylic acid	24939-03-5	99.40%
  Polyinosinic-polycytidylic acid (Poly(I:C)) is a synthetic analog of double-stranded RNA and an agonist of toll-like receptor 3 (TLR3) and retinoic acid inducible gene I (RIG-I)-like receptors (RIG-I and MDA5). Polyinosinic-polycytidylic acid can be used as a vaccine adjuvant to enhance innate and adaptive immune responses, and to alter the tumor microenvironment. Polyinosinic-polycytidylic acid can directly trigger cancer cells to undergo apoptosis[1][2].

  

• HY-13753

  Streptozotocin	18883-66-4
  Streptozotocin (Streptozocin; STZ) is an antibiotic widely used in experimental animal models of induced diabetes. Streptozotocin enters B cells via the glucose transporter (GLUT2) and causes the alkylation of DNA ( DNA-methylating ). Streptozotocin can induce the apoptosis of β cells[1][2][3].

  

• HY-13434

  Ionomycin	56092-81-0
  Ionomycin (SQ23377) is a potent, selective calcium ionophore and an antibiotic produced by Streptomyces conglobatus. Ionomycin (SQ23377) is highly specific for divalent cations (Ca>Mg>Sr=Ba). Ionomycin (SQ23377) promotes apoptosis. Ionomycin also induces the activation of protein kinase C (PKC)[1][2][3].

  

• HY-B0490

  Hygromycin B	31282-04-9
  Hygromycin B is an aminoglycoside antibiotic active against prokaryotic and eukaryotic cells.

  

• HY-16561

  Resveratrol	501-36-0
  Resveratrol (trans-Resveratrol; SRT501), a natural polyphenolic phytoalexin that possesses anti-oxidant, anti-inflammatory, cardioprotective, and anti-cancer properties. Resveratrol (SRT 501) has a wide spectrum of targets including mTOR, JAK, β-amyloid, Adenylyl cyclase, IKKβ, DNA polymerase. Resveratrol also is a specific SIRT1 activator[1][2][3][4]. Resveratrol is a potent pregnane X receptor (PXR) inhibitor[5]. Resveratrol is an Nrf2 activator, ameliorates aging-related progressive renal injury in mice model[6]. Resveratrol increases production of NO in endothelial cells[7].

  

• HY-N0565

  Doxycycline	564-25-0
  Doxycycline, an antibiotic, is an orally active and broad-spectrum metalloproteinase (MMP) inhibitor[1]. Doxycycline shows antibacterial activity and anti-cancer cell proliferation activity[1][2][3][4][5].

  

• HY-A0098

  Tunicamycin	11089-65-9
  Tunicamycin is a mixture of homologous nucleoside antibiotic that inhibits N-linked glycosylation and blocks GlcNAc phosphotransferase (GPT). Tunicamycin causes accumulation of unfolded proteins in cell endoplasmic reticulum (ER) and induces ER stress, and causes blocking of DNA synthesis and cell cycle arrest in G1 phase. Tunicamycin inhibits gram-positive bacteria, yeasts, fungi, and viruses and has anti-cancer activity[1][2][3].Tunicamycin increases exosome release in cervical cancer cells[4].

  

• HY-13605

  Cytarabine	147-94-4
  Cytarabine, a nucleoside analog, causes S phase cell cycle arrest and inhibits DNA polymerase. Cytarabine inhibits DNA synthesis with an IC50 of 16 nM. Cytarabine has antiviral effects against HSV. Cytarabine shows anti-orthopoxvirus activity.

  

• HY-134541

  SM-102	2089251-47-6
  SM-102 is an amino cationic lipid useful in the formation of lipid nanoparticles (LNPs). SM-102 has higher transfection efficiency. SM-102 plays an important role in the effectiveness of lipid nanoparticles (LNPs) in delivering mRNA therapeutics and vaccines[1][2].

  

• HY-A0281

  4-Phenylbutyric acid	1821-12-1
  4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.

  

• HY-N6782

  Oligomycin	1404-19-9
  Oligomycin, an antifungal antibiotic, is an inhibitor of H+-ATP-synthase. Oligomycin blocks oxidative phosphorylation and the electron transport chain. Oligomycin inhibits HIF-1alpha expression in hypoxic tumor cells[1][2][3][4].

  

• HY-13756

  Tacrolimus	104987-11-3
  Tacrolimus (FK506), a macrocyclic lactone, binds to FK506 binding protein (FKBP) to form a complex. Tacrolimus inhibits calcineurin phosphatase, which inhibits T-lymphocyte signal transduction and IL-2 transcription. Immunosuppressive properties[1].

  

• HY-B0470

  Neomycin sulfate	1405-10-3
  Neomycin sulfate, an aminoglycoside antibiotic, exerts antibacterial activity through irreversible binding of the nuclear 30S ribosomal subunit, thereby blocking bacterial protein synthesis. Neomycin sulfate is a known phospholipase C (PLC) inhibitor. Neomycin sulfate potently inhibits both nuclear translocation of angiogenin and angiogenin-induced cell proliferation and angiogenesis[1][2].

  

• HY-10221

  Vorinostat	149647-78-9
  Vorinostat (SAHA) is a potent and orally active pan-inhibitor of HDAC1, HDAC2 and HDAC3 (Class I), HDAC6 and HDAC7 (Class II) and HDAC11 (Class IV), with ID50 values of 10 nM and 20 nM for HDAC1 and HDAC3, respectively. Vorinostat induces cell apoptosis[1][4]. Vorinostat is also an effective inhibitor of human papillomaviruse (HPV)-18 DNA amplification[7].

  

• HY-16560

  Camptothecin	7689-03-4
  Camptothecin (CPT), a kind of alkaloid, is a DNA topoisomerase I (Topo I) inhibitor with an IC50 of 679 nM[1]. Camptothecin (CPT) exhibits powerful antineoplastic activity against colorectal, breast, lung and ovarian cancers, modulates hypoxia-inducible factor-1α (HIF-1α) activity by changing microRNAs (miRNA) expression patterns in human cancer cells[2][3].

  

• HY-N0565B

  Doxycycline hyclate	24390-14-5
  Doxycycline hyclate, an antibiotic, is an orally active and broad-spectrum metalloproteinase (MMP) inhibitor. Doxycycline hyclate shows antibacterial activity and anti-cancer cell proliferation activity. Doxycycline hyclate can be used to construct gene expression regulation models[1][2][3][4][5].

  

• HY-12305

  Q-VD-OPh	1135695-98-5	99.92%
  Q-VD-OPh is an irreversible pan-caspase inhibitor with potent antiapoptotic properties; inhibits caspase 7 with an IC50 of 48 nM and 25-400 nM for other caspases including caspase 1, 3, 8, 9, 10, and 12. Q-VD-OPh can inhibits HIV infection. Q-VD-OPh is able to cross the blood-brain barrier.

  

• HY-18982

  Anisomycin	22862-76-6
  Anisomycin is a potent protein synthesis inhibitor which interferes with protein and DNA synthesis by inhibiting peptidyl transferase or the 80S ribosome system[1]. Anisomycin is a JNK activator, which increases phospho-JNK[2][3]. Anisomycin is a bacterial antibiotic[4].

  

• HY-10585

  Valproic acid	99-66-1
  Valproic acid (VPA) is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM. Valproic acid inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid is used in the epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches[1][2][3][4][5][6][7].

  

• HY-111770

  2-Bromohexadecanoic acid	18263-25-7
  2-Bromohexadecanoic acid (2-Bromopalmitate; 2-BP) is a palmitoylation inhibitor targeting DHHC (Asp-His-His-Cys) protein palmitoyltransferase. 2-Bromohexadecanoic acid inhibits palmitoylation of GSDME-C during pyroptosis and inhibits BAK/BAX-Caspase 3-GSDME pathway-mediated pyroptosis[1].

  

• HY-138170

  ALC-0315	2036272-55-4
  ALC-0315 is an ionisable aminolipid that is responsible for mRNA compaction and aids mRNA cellular delivery and its cytoplasmic release through suspected endosomal destabilization. ALC-0315 can be used to form lipid nanoparticle (LNP) delivery vehicles. Lipid-Nanoparticles have been used in the research of mRNA COVID-19 vaccine[1].

  

• HY-B0318

  Metronidazole	443-48-1	99.92%
  Metronidazole is an orally active nitroimidazole antibiotic. Metronidazole can cross blood brain barrier. Metronidazole can be used for the research of anaerobic infections[1][2][3][4].

  

• HY-B0522

  Ampicillin	69-53-4
  Ampicillin is a broad-spectrum beta-lactam antibiotic against a variety of gram-positive and gram-negative bacteria.

  

• HY-10964

  Vadimezan	117570-53-3	99.93%
  Vadimezan (DMXAA; ASA-404), the tumor vascular disrupting agent (tumor-VDA), is a murine agonist of the stimulator of interferon genes (STING) and also a potent inducer of type I IFNs and other cytokines. Vadimezan has anti-influenza virus H1N1-PR8 activities.

  

• HY-18234A

  Leupeptin hemisulfate	103476-89-7
  Leupeptin hemisulfate is a broad-spectrum, membrane-permeable protease inhibitor. Leupeptin hemisulfate potently inhibits serine, cysteine and threonine proteases. Leupeptin hemisulfate inhibits Mpro (the main protease of SARS-CoV-2) and also has anti-inflammatory activity[1][2][3].

  

• HY-17589

  Chloroquine phosphate	50-63-5	99.89%
  Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].

  

• HY-17412

  Minocycline hydrochloride	13614-98-7	99.79%
  Minocycline hydrochloride is an orally active, potent and BBB-penetrated semi-synthetic tetracycline antibiotic. Minocycline hydrochloride is a hypoxia-inducible factor (HIF)-1α inhibitor. Minocycline hydrochloride shows anti-cancer, anti-inflammatory, and glutamate antagonist effects. Minocycline hydrochloride reduces glutamate neurotransmission and shows neuroprotective properties and antidepressant effects. Minocycline hydrochloride inhibits bacterial protein synthesis through binding with the 30S subunit of the bacterial ribosome, resulting in a bacteriostatic effect[1][2][3][4][5][6][7].

  

• HY-P0018

  Pepstatin	26305-03-3
  Pepstatin (Pepstatin A) is a specific, orally active aspartic protease inhibitor produced by actinomycetes, with IC50s of 4.5 nM, 6.2 nM, 150 nM, 290 nM, 520 nM and 260 nM for hemoglobin-pepsin, hemoglobin-proctase, casein-pepsin, casein-proctase, casein-acid protease and hemoglobin-acid protease, respectively. Pepstatin also inhibits HIV protease[1][2].

  

• HY-127019

  Nigericin	28380-24-7	99.43%
  Nigericin is an antibiotic derived from Streptomyces hygroscopicus that act as a K+/H+ ionophore, promoting K+/H+ exchange across mitochondrial membranes. Nigericin is a NLRP3 activator. Nigericin shows promising anti-cancer activities through decreasing intracellular pH (pHi), and inactivation of Wnt/β-catenin signals. Nigericin induces pyroptosis through caspase 1/GSDMD in TNBC[1][2][3][4][5][6][7].

  

• HY-16589

  Oligomycin A	579-13-5
  Oligomycin A (MCH 32), created by Streptomyces, acts as a mitochondrial F0F1-ATPase inhibitor, with a Ki of 1 μM; Oligomycin A shows anti-fungal activity.

  

• HY-10046

  Plerixafor	110078-46-1
  Plerixafor (AMD 3100) is a selective CXCR4 antagonist with an IC50 of 44 nM. Plerixafor, an immunostimulant and a hematopoietic stem cell (HSC) mobilizer, is an allosteric agonist of CXCR7. Plerixafor inhibits HIV-1 and HIV-2 replication with an EC50 of 1-10 nM[1][2][3][4][7].

  

• HY-W250978

  Ovalbumins	9006-59-1
  Ovalbumins (OVA), the main protein found in egg whites, have various biological activities such as anticancer, antihypertensive, antibacterial, antioxidant and immunomodulatory activities. Ovalbumins are the most abundant proteins synthesized in progesterone- or estrogen-treated fallopian tubes and are commonly used as markers to study hormone regulation of gene expression in tissues[1].

  

• HY-13067

  Celastrol	34157-83-0	99.90%
  Celastrol (Tripterine;Tripterin) is a proteasome inhibitor which potently and preferentially inhibits the chymotrypsin-like activity of a purified 20S proteasome with IC50 of 2.5 μM. In addition, Celastrol is also an antibiotic with potent antimicrobial activity against standard and clinical methicillin-resistant Staphylococcus aureus (MRSA) strains, inducing oxidative stress and inhibiting DNA synthesis by binding to P5CDH[1][2][3].

  

• HY-10396

  Emricasan	254750-02-2	99.81%
  Emricasan (PF 03491390) is an orally active and irreversible pan-caspase inhibitor. Emricasan inhibits Zika virus (ZIKV)-induced increases in caspase-3 activity and protected human cortical neural progenitors[1].

  

• HY-14654

  Aspirin	50-78-2	99.90%
  Aspirin (Acetylsalicylic Acid) is an orally active, potent and irreversible inhibitor of cyclooxygenase COX-1 and COX-2, with IC50 values of 5 and 210 μg/mL, respectively. Aspirin induces apoptosis. Aspirin inhibits the activation of NF-κB. Aspirin also inhibits platelet prostaglandin synthetase, and can prevent coronary artery and cerebrovascular thrombosis[1][2][3][4][5][6].

  

• HY-N6682

  Cytochalasin D	22144-77-0
  Cytochalasin D (Zygosporin A) is a potent actin polymerization inhibitor, could be derived from fungus. Cytochalasin D has cell-permeable activity. Cytochalasin D inhibits the G-actin–cofilin interaction by binding to G-actin. Cytochalasin D also inhibits the binding of cofilin to F-actin and decreases the rate of both actin polymerization and depolymerization in living cells. Cytochalasin D can reduce exosome release, in turn reducing the amount of survivin present in the tumour environment. Cytochalasin D induces phosphorylation and cytoplasmic retention of Yap[1][2][3][4].

  

• HY-N6716

  Filipin complex	11078-21-0
  Filipin complex is a potent polyene macrolide antifungal antibiotic. Filipin complex inserts into membranes and sequester cholesterol into complexes and inhibits PRRSV entry. The Filipin complex consists of about 75.8% Filipin III (HY-N6718), 10.8% Filipin IV, 9.1% Filipin II, and 1.2% Filipin I[1][2][3].

  

• HY-17362

  Vancomycin hydrochloride	1404-93-9	99.43%
  Vancomycin hydrochloride is an antibiotic for the treatment of bacterial infections. It acts by inhibiting the second stage of cell wall synthesis of susceptible bacteria. Vancomycin also alters the permeability of the cell membrane and selectively inhibits ribonucleic acid synthesis.

  

• HY-Y0479

  L-Lactic acid	79-33-4
  L-Lactic acid is a buildiing block which can be used as a precursor for the production of the bioplastic polymer poly-lactic acid. L-Lactic acid has antiproliferative activity[1][2][3].

  

• HY-148905

  p-Aminophenylmercuric acetate	6283-24-5
  p-Aminophenylmercuric acetate is an organomercurial activator of matrix metalloproteinases (MMP). P-Aminophenylmercuric acetate participates in the activation and inhibition of MMP-8 by attacking protein sulfhydryl or inducing cysteine switching reaction. p-Aminophenylmercuric acetate promotes the shedding of betacellulin precursor (pro-BTC). p-Aminophenylmercuric acetate influences the binding of agonists and antagonists to the opiate receptor[1][2][3].

  

• HY-17363

  Dimethyl fumarate	624-49-7
  Dimethyl fumarate (DMF) is an orally active and brain-penetrant Nrf2 activator and induces upregulation of antioxidant gene expression. Dimethyl fumarate induces necroptosis in colon cancer cells through GSH depletion/ROS increase/MAPKs activation pathway, and also induces cell autophagy. Dimethyl fumarate can be used for multiple sclerosis research[1][2].

  

• HY-10211

  Tanespimycin	75747-14-7
  Tanespimycin (17-AAG) is a potent HSP90 inhibitor with an IC50 of 5 nM, having a 100-fold higher binding affinity for tumour cell derived HSP90 than normal cell derived HSP90[1][5]. Tanespimycin depletes cellular STK38/NDR1 and reduces STK38 kinase activity. Tanespimycin also downregulates the stk38 gene expression[3].

  

• HY-14655

  Sulfasalazine	599-79-1	99.04%
  Sulfasalazine (NSC 667219) is an anti-rheumatic agent for the research of rheumatoid arthritis and ulcerative colitis. Sulfasalazine can suppress NF-κB activity. Sulfasalazine is a type 1 ferroptosis inducer[1][2][3][4].

  

• HY-W031727

  Hydroxychloroquine	118-42-3
  Hydroxychloroquine (HCQ) is a synthetic oral antimalarial drug that can be used in the study of malaria and autoimmune diseases such as systemic lupus erythematosus and rheumatoid arthritis. Hydroxychloroquine is a potent autophagic flux inhibitor with antiviral activity (such as SARS-CoV-2 virus) that inhibits Toll-like receptor 7/9 (TLR7/9) signaling[1][2][3][4][5][6][7][8].

  

• HY-B0671

  Vancomycin	1404-90-6	99.39%
  Vancomycin is an antibiotic for the treatment of bacterial infections.

  

• HY-B0221

  Amphotericin B	1397-89-3
  Amphotericin B is a polyene antifungal agent against a wide variety of fungal pathogens. It binds irreversibly to ergosterol, resulting in disruption of membrane integrity and ultimately cell death.

  

• HY-A0276

  Gentamicin sulfate	1405-41-0
  Gentamicin sulfate, an orally active aminoglycoside antibiotic, inhibits the growth of both gram-positive and gram-negative bacteria and to inhibit several strains of mycoplasma in tissue culture. Gentamicin sulfate inhibits DNase I with an IC50 of 0.57 mM[1][2][3][4].

  

• HY-B0272

  Rifampicin	13292-46-1	98.15%
  Rifampicin is a potent and broad spectrum antibiotic against bacterial pathogens. Rifampicin has anti-influenza virus activities. Rifampicin shows anti-orthopoxvirus activity.

  

• HY-13062

  Daunorubicin hydrochloride	23541-50-6	99.67%
  Daunorubicin (Daunomycin) hydrochloride is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin hydrochloride inhibits DNA and RNA synthesis. Daunorubicin hydrochloride is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin hydrochloride is also an anthracycline antibiotic. Daunorubicin hydrochloride can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor[1][2][4][5].

  

• HY-N6687

  Calcimycin	52665-69-7
  Calcimycin (A-23187) is an antibiotic and a unique divalent cation ionophore (like calcium and magnesium). Calcimycin induces Ca2+-dependent cell death by increasing intracellular calcium concentration. Calcimycin inhibits the growth of Gram-positive bacteria and some fungi. Calcimycin also inhibits the activity of ATPase and uncouples oxidative phosphorylation (OXPHOS) of mammalian cells. Calcimycin induces apoptosis[1][2][3][4].

  

• HY-B0180

  Imiquimod	99011-02-6	99.96%
  Imiquimod (R 837), an immune response modifier, is a selective toll like receptor 7 (TLR7) agonist. Imiquimod exhibits antiviral and antitumor effects in vivo. Imiquimod can be used for the research of external genital, perianal warts, cancer and COVID-19[1][2].

  

• HY-B1123

  Auranofin	34031-32-8
  Auranofin (SKF-39162) is a thioredoxin reductase (TrxR) inhibitor with an IC50 of 0.2 μM. Auranofin exhibits antiviral activity against SARS-CoV21, with a CC50 of 4.2 μM for monkey kidney Vero E6 cells.

  

• HY-B0522A

  Ampicillin sodium	69-52-3
  Ampicillin sodium (D-(-)-α-Aminobenzylpenicillin sodium salt) is a broad-spectrum beta-lactam antibiotic against a variety of gram-positive and gram-negative bacteria[1].

  

• HY-138687

  Nirmatrelvir	2628280-40-8	99.83%
  Nirmatrelvir (PF-07321332) is a potent and orally active SARS-CoV 3C-like protease (3CLPRO) inhibitor. Nirmatrelvir (PF-07321332) targets to the SARS-CoV-2 virus and can be used for COVID-19 research[1].

  

• HY-N0176

  Dihydroartemisinin	71939-50-9
  Dihydroartemisinin is a potent anti-malaria agent.

  

• HY-B1777

  Spermine	71-44-3
  Spermine (NSC 268508) functions directly as a free radical scabenger to protect DNA from free radical attack. Spermine has antiviral effects.

  

• HY-13502

  Mitoxantrone	65271-80-9
  Mitoxantrone is a potent topoisomerase II inhibitor. Mitoxantrone also inhibits protein kinase C (PKC) activity with an IC50 of 8.5 μM. Mitoxantrone induces apoptosis of B-CLL (B-chronic lymphocytic leukaemia) cells. Mitoxantrone shows antitumor activity[1][2][3][4]. Mitoxantrone also has anti-orthopoxvirus activity with EC50s of 0.25 μM and and 0.8 μM for cowpox and monkeypox, respectively[5].

  

• HY-17409

  Nystatin	1400-61-9
  Nystatin is an orally active polyene antifungal antibiotic effective against yeast and mycoplasma. Nystatin increases the permeability of plasma membranes to small monovalent ions, including chloridion[1][2]. Nystatin is a cholesterol-sequestering agent[3], partially prevents Oxaliplatin-induced lipid raft aggregation, DR4 and DR5 clustering, and thereby reduces apoptosis[5].

  

• HY-N0150

  Monensin sodium	22373-78-0
  Monensin (Monensin A) sodium, an orally active antibiotic, is an ionophore that mediates Na+/H+ exchange. Monensin sodium is a potent Wnt signaling inhibitor. Monensin sodium causes a marked enlargement of the multivesicular bodies (MVBs) and regulates exosome secretion. Monensin sodium can be used for bacterial, fungal, and parasitic infections research, and shows anticancer effects[1][2][3][4].

  

• HY-B0239

  Chloramphenicol	56-75-7	99.93%
  Chloramphenicol is an orally active, potent and broad-spectrum antibiotic. Chloramphenicol shows antibacterial activity. Chloramphenicol represses the oxygen-labile transcription factor and hypoxia inducible factor-1 alpha (HIF-1α) in hypoxic A549 and H1299 cells. Chloramphenicol suppresses the mRNA levels of vascular endothelial growth factor (VEGF) and glucose transporter 1, eventually decreasing VEGF release. Chloramphenicol can be used for anaerobic infections and lung cancer research[1][2][3].

  

• HY-14879A

  Avibactam sodium	1192491-61-4
  Avibactam sodium (NXL-104) is a covalent and reversible non-β-lactam β-lactamase inhibitor which inhibits β-lactamase TEM-1 and CTX-M-15 with IC50s of 8 nM and 5 nM, respectively[1].

  

• HY-13771

  Ursodeoxycholic acid	128-13-2
  Ursodeoxycholic acid (Ursodeoxycholate) is a secondary bile acid issued from the transformation of (cheno)deoxycholic acid by intestinal bacteria, acting as a key regulator of the intestinal barrier integrity and essential for lipid metabolism. Ursodeoxycholic acid acts as signaling molecule, exerting its effects by interacting with bile acid activated receptors, including G-protein coupled bile acid receptor 5 (TGR5, GPCR19) and the farnesoid X receptor (FXR). Ursodeoxycholic acid can be used for the research of a variety of hepatic and gastrointestinal diseases. Ursodeoxycholic acid also reduces ACE2 expression and is beneficial for reducing SARS-CoV-2 infection. Orally active[1][2][3][4].

  

• HY-B0434

  Ribavirin	36791-04-5
  Ribavirin (ICN-1229) is an antiviral agent against a broad spectrum of viruses including HCV, HIVl, and RSV. Ribavirin also has anti-orthopoxvirus and anti-variola activities.

  

• HY-107433

  U18666A	3039-71-2
  U18666A, an intra-cellular cholesterol transport inhibitor, inhibits replication of Ebola virus, dengue virus, and human hepatitis C virus[1].

  

• HY-104077

  Remdesivir	1809249-37-3	99.95%
  Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 3.3 μM, 4.7 μM, 32 μM, 3.7 μM and 9.2 μM for SARS-CoV-2 and its variants alpha, beta, gamma and delta, respectively. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2][3].

  

• HY-101563

  GSK3326595	1616392-22-3
  GSK3326595 is a protein arginine methyltransferase 5 (PRMT5) inhibitor. GSK3326595 decreases SARS-CoV-2 infection, inhibits cancer cell proliferation and induces pro-inflammatory macrophage polarization and increases hepatic triglyceride levels without affecting atherosclerosis. GSK3326595 can be used for research of relapsed/refractory mantle cell lymphoma[1][2][3][4][5].

  

• HY-10585A

  Valproic acid sodium	1069-66-5
  Valproic acid (Sodium Valproate) sodium is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid sodium activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid sodium is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches[1][2][3][4][5][6][7].

  

• HY-B0497

  Niclosamide	50-65-7
  Niclosamide (BAY2353) is an orally active antihelminthic agent used in parasitic infection research[1]. Niclosamide is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells[4]. Niclosamide has biological activities against cancer, inhibits DNA replication in Vero E6 cells[2][3][5].

  

• HY-P1180A

  Pam3CSK4 TFA	112208-01-2
  Pam3CSK4 TFA is a toll-like receptor 1/2 (TLR1/2) agonist with an EC50 of 0.47 ng/mL for human TLR1/2[1].

  

• HY-N0683

  α-Vitamin E	59-02-9
  α-Vitamin E ((+)-α-Tocopherol), a naturally occurring vitamin E form, is a potent antioxidant[1][2].

  

• HY-P2149

  Concanavalin A	11028-71-0
  Concanavalin A is a Ca2+/Mn2+-dependent and mannose/glucose-binding plant lectin that can be found in jack bean. Concanavalin A can induce programmed cell death. Concanavalin A can be used to induce acute hepatic injury[1][3].

  

• HY-N0055

  Chlorogenic acid	327-97-9	99.55%
  Chlorogenic acid is a major phenolic compound in Lonicera japonica Thunb. It is an orally active antioxidant activity, antibacterial, hepatoprotective, cardioprotective, anti-inflammatory, antipyretic, neuroprotective, anti-obesity, antiviral, anti-microbial, anti-hypertension compound[1][2][3].

  

• HY-A0181

  Adenosine monophosphate	61-19-8
  Adenosine monophosphate is an adenosine A1 receptor agonist. Adenosine monophosphate has significant antiviral activity against HSV-1 and HSV-2. Adenosine monophosphate is a key cellular metabolite regulating energy homeostasis and signal transduction[1][2][3].

  

• HY-108325

  Brequinar	96187-53-0	99.89%
  Brequinar (DUP785) is a potent inhibitor of dihydroorotate dehydrogenase (DHODH) with an IC50 of 5.2 nM for human DHODH. Brequinar has potent activities against a broad spectrum of viruses. Brequinar also has an anti-SARS2 activity.

  

• HY-14881

  Bedaquiline	843663-66-1	99.98%
  Bedaquiline (TMC207) is a diarylquinoline agent and inhibits Mycobacterium tuberculosis (Mtb) F1FO-ATP synthase through targeting of both the c- and the ε-subunit[1]. Bedaquiline has uncoupler activity. Bedaquiline is used for the multi-agent resistant tuberculosis[2].

  

• HY-N0293

  Paeoniflorin	23180-57-6
  Paeoniflorin is a heat shock protein-inducing compound and commonly exists in the plants of Paeoniaceae family, with various biological activities, including anticancer activity, anti-inflammatory activity, enhancing cognition and attenuating learning impairment, anti-oxidative stress, antiplatelet aggregation, expansion of blood vessels, and reducing blood viscosity[1][2][3].

  

• HY-10394

  Linezolid	165800-03-3
  Linezolid (PNU-100766) is the first member of the class of oxazolidinone synthetic antibiotic. Linezolid acts by inhibiting the initiation of bacterial protein synthesis. Linezolid is used for the treatment of serious infections caused by Gram-positive bacteria that are resistant to several other antibiotics[1][2][3].

  

• HY-14768

  Favipiravir	259793-96-9
  Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC50 of 341 nM.

  

• HY-N6733

  Aphidicolin	38966-21-1
  Aphidicolin is an inhibitor of DNA polymerase α and δ, prevents mitotic cell division by interfering DNA polymerase activity. Aphidicolin is an antibiotic produced by mold Cephalosporium aphidicola, inhibits cellular deoxyribonucleic acid synthesis and the growth of herpes simplex virus. Aphidicolin exhibits anti-orthopoxvirus activity and potentiates apoptosis induced by arabinosyl nucleosides in a human promyelocytic leukemia cell line[1][2][3].

  

• HY-B0568

  Deferiprone	30652-11-0
  Deferiprone is a potent, orally active, brain-penetrant, cell-penetrant, skin-permeable, free iron chelating agent. Deferiprone inhibits the proliferation and migration, and stimulates apoptosis in tumor cell. Deferiprone has antianemic, neuroprotective, anti-inflammatory, antioxidant, and antidotal activity. Deferiprone can be used in cancer, cardiovascular disease, infection, inflammation, and neurological disease study[1][2][3][4][5][6][7][8].

  

• HY-B0260

  Methylprednisolone	83-43-2	99.75%
  Methylprednisolone (U 7532) is a synthetic corticosteroid with anti-inflammatory and immunomodulating properties. Methylprednisolone improve severe or critical COVID-19 by activating ACE2 and reducing IL-6 levels[3].

  

• HY-15310

  Ivermectin	70288-86-7
  Ivermectin (MK-933) is a broad-spectrum anti-parasite agent. Ivermectin (MK-933) is a specific inhibitor of Impα/β1-mediated nuclear import and has potent antiviral activity towards both HIV-1 and dengue virus. It is a positive allosteric effector of P2X4 and the α7 neuronal nicotinic acetylcholine receptor (nAChRs). Ivermectin also inhibits bovine herpesvirus1 (BoHV-1) replication and inhibits BoHV-1 DNA polymerase nuclear import[1][2][3][4]. Ivermectin is a candidate therapeutic against SARS-CoV-2/COVID-19[5].

  

• HY-17628

  Cefiderocol	1225208-94-5
  Cefiderocol (S-649266) is a siderophore cephalosporin which has a potent activity against a broad range of aerobic Gram-negative bacterial species with MIC50s of 2 μg/mL or less.

  

• HY-108357

  6-Diazo-5-oxo-L-nor-Leucine	157-03-9
  6-Diazo-5-oxo-L-nor-Leucine (L-6-Diazo-5-oxonorleucine; DON) is a glutamine antagonist that irreversibly inhibits the catabolic effect of glutamine. 6-Diazo-5-oxo-L-nor-Leucine shows good anticancer activity (especially in pancreatic cancer) and reduces the self-renewal potential and metastatic capacity of tumour cells. 6-Diazo-5-oxo-L-nor-Leucine also possesses antibacterial and antiviral activity[1][2][3].

  

• HY-B1370

  Hydroxychloroquine sulfate	747-36-4	99.99%
  Hydroxychloroquine sulfate (HCQ sulfate) is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine sulfate is efficiently inhibits SARS-CoV-2 infection in vitro[1][2][3].

  

• HY-B0330

  Levofloxacin	100986-85-4	99.92%
  Levofloxacin ((-)-Ofloxacin) is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin inhibits the DNA gyrase and topoisomerase IV. Levofloxacin can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin shows anti-orthopoxvirus activity[1][2][3][4][5].

  

• HY-N0862

  Harringtonine	26833-85-2
  Harringtonine is a natural Cephalotaxus alkaloid that inhibits protein synthesis. Harringtonine has anti-chikungunya virus (CHIKV) activities with an EC50 of 0.24 μM.

  

• HY-B0356

  Ciprofloxacin	85721-33-1	99.94%
  Ciprofloxacin (Bay-09867) is a potent, orally active topoisomerase IV inhibitor. Ciprofloxacin induces mitochondrial DNA and nuclear DNA damage and lead to mitochondrial dysfunction, ROS production. Ciprofloxacin has anti-proliferative activity and induces apoptosis. Ciprofloxacin is a fluoroquinolone antibiotic, exhibiting potent antibacterial activity[1][2][3][4].

  

• HY-A0107

  Tetracycline	60-54-8
  Tetracycline is a broad-spectrum antibiotic with oral activity. Tetracycline exhibits activity against a wide range of bacteria including gram-positive, gram-negative bacteria, chlamydiae, mycoplasmas and rickettsiae. Tetracycline can be used for the research of infections[1].

  

• HY-15230

  Geldanamycin	30562-34-6
  Geldanamycin is a Hsp90 inhibitor with antimicrobial activity against many Gram-positive and some Gram-negative bacteria. Geldanamycin has anti-influenza virus H5N1 activities.

  

• HY-13318

  Oseltamivir acid	187227-45-8	99.80%
  Oseltamivir acid (GS 4071), the active metabolite of Oseltamivir phosphate, is an orally bioavailable, potent and selective inhibitor of influenza virus neuraminidase (IC50=2 nM) with activity against both influenza A and B viruses[1][2].

  

• HY-12186

  3-Deazaneplanocin A hydrochloride	120964-45-6	99.98%
  3-Deazaneplanocin A hydrochloride (DZNep hydrochloride) is a potent histone methyltransferase EZH2 inhibitor[1][2]. 3-Deazaneplanocin A hydrochlorideis a potent S-adenosylhomocysteine hydrolase (AHCY) inhibitor[6]. 3-Deazaneplanocin A hydrochloride also has anti-orthopoxvirus and anti-variola activities[7].

  

• HY-15306

  Eltrombopag	496775-61-2	99.94%
  Eltrombopag (SB-497115) is an orally active thrombopoietin receptor nonpeptide agonist. Eltrombopag owns thrombopoietic activity, and has been used to research low blood platelet counts with chronic immune thrombocytopenia. Eltrombopag can be used for the research of cardiovascular. Eltrombopag also has highly inhibitory effects against multidrug resistant Staphylococcus aureus. Eltrombopag can induce apoptosis in hepatocellular carcinomab (HCC) as well[1][2][3][4][5].

  

• HY-13594

  Chlorin e6	19660-77-6
  Chlorin e6 is a photosensitizer and has strong absorption peaks at wavelength of 402 and 662 nm, as well as exhibiting intense fluorescence at 668 nm. Chlorin e6 has antimicrobial efficacy and anticancer activity. Chlorin e6 induces cell apoptosis via caspase-3 activation and can be used for the research of cancer[1][2][3].

  

• HY-A0122

  Plicamycin	18378-89-7
  Plicamycin (Mithramycin A) is a selective specificity protein 1 (Sp1) inhibitor. Plicamycin inhibits the growth of various cancers by decreasing Sp1 protein. Plicamycin inhibits GSTM2 promoter activity and protein expression[1][2].

  

• HY-13750

  Ebselen	60940-34-3
  Ebselen (SPI-1005), a glutathione peroxidase mimetic, is a potent voltage-dependent calcium channel (VDCC) blocker[1][2]. Ebselen potently inhibits Mpro (IC50=0.67 μM) and COVID-19 virus (EC50=4.67 μM)[3].Ebselen is an inhibitor of HIV-1 capsid CTD dimerization. Ebselen, an organoselenium compound, can permeate the blood-brain barrier and has anti-inflammatory, antioxidant and anticancer activity[4][5].

  

• HY-B1743

  Puromycin	53-79-2
  Puromycin dihydrochloride is the dihydrochloride salt of puromycin. Puromycin is an aminoglycoside antibiotic that inhibits protein synthesis.

  

• HY-16926

  CK-666	442633-00-3	99.95%
  CK-666 is a cell-permeable actin-related protein Arp2/3 complex inhibitor (IC50=12 μM). CK-666 binds to Arp2/3 complex, stabilizes the inactive state of the complex, blocking movement of the Arp2 and Arp3 subunits into the activated filament-like (short pitch) conformation[1][2].

  

• HY-N0004

  Oridonin	28957-04-2	99.89%
  Oridonin (NSC-250682), a diterpenoid isolated from Rabdosia rubescens, acts as an inhibitor of AKT, with IC50s of 8.4 and 8.9 μM for AKT1 and AKT2; Oridonin possesses anti-tumor, anti-bacterial and anti-inflammatory effects.

  

• HY-B0117

  Tigecycline	220620-09-7	99.95%
  Tigecycline (GAR-936) is a broad-spectrum glycylcycline antibiotic. The mean inhibitory concentration (MIC) of Tigecycline for E. coli (MG1655 strain) is approximately 125 ng/mL[1]. MIC50 and MIC90 are 1 and 2 mg/L for Acinetobacter baumannii (A. baumannii), respectively[2].

  

• HY-N0315

  Allicin	539-86-6
  Allicin (diallyl thiosulfinate) is isolated from garlic including Diallyl monosulfide, Diallyl disulfide, Diallyl trisulfide, Diallyl tetrasulfide, and Methyl allyl disulphide etc. They accounts for 98% of the extract. Allicin (diallyl thiosulfinate) has highly potent antimicrobial activity, and inhibits growth of a variety of microorganisms, among them antibiotic-resistant strains[1][2].

  

• HY-13637

  Ganciclovir	82410-32-0	99.89%
  Ganciclovir (BW 759), a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain[1][2][3].

  

• HY-90001

  Ritonavir	155213-67-5
  Ritonavir (ABT 538) is an inhibitor of HIV protease used to treat HIV infection and AIDS. Ritonavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.61 μM.

  

• HY-16566A

  Kanamycin sulfate	25389-94-0
  Kanamycin (Kanamycin A) sulfate is an orally active antibacterial (gram-negative/positive bacteria) agent, inhibits translocation and causes misencoding by binding to the 70 S ribosomal subunit. Kanamycin sulfate shows good inhibitory activity to both M. tuberculosis (sensitive and drug-resistant ) and K. pneumonia, which can be used in studies of tuberculosis and pneumonia[1][2][3][4].

  

• HY-B0101

  Fluconazole	86386-73-4
  Fluconazole (UK-49858) is a triazole antifungal agent with excellent activities against a broad range of fungi, especially against Candida albicans. Fluconazole inhibits C. albicans and Candida kefyr with IC99s range from 0.20 μg/mL to 0.39 μg/mL[1].

  

• HY-B0105

  Ketoconazole	65277-42-1	99.51%
  Ketoconazole (R-41400) is an imidazole anti-fungal agent, a CYP3A4 and CYP24A1 inhibitor.

  

• HY-B0593

  Ceftazidime	72558-82-8
  Ceftazidime (GR20263), an antibiotic, has a broad spectrum activity against Gram-positive and Gram-negative aerobic bacteria. Ceftazidime is also active against Enterobacteriaceae (including β-lactamase-positive strains) and is resistant to hydrolysis by most β-lactamases[1].

  

• HY-17006

  Caspofungin diacetate	179463-17-3
  Caspofungin (MK-0991) diacetate is a potent antifungal agent. Caspofungin diacetate inhibits the synthesis of the fungal cell wall component β-(l,3)-D-glucan[1][2].

  

• HY-15486

  Salubrinal	405060-95-9	99.58%
  Salubrinal is a cell-permeable and selective inhibitor of eIF2α dephosphorylation[1]. Salubrinal acts as a dual-specificity phosphatase 2 (Dusp2) inhibitor and suppresses inflammation in anti-collagen antibody-induced arthritis[2]. Salubrinal has antiviral activity against HSV-1 and inhibits dephosphorylation of eIF2α mediated by the HSV-1 protein ICP34.5[3].

  

• HY-13434A

  Ionomycin calcium	56092-82-1
  Ionomycin calcium (SQ23377 calcium) is a potent, selective calcium ionophore and an antibiotic produced by Streptomyces conglobatus. Ionomycin calcium (SQ23377 calcium) is highly specific for divalent cations (Ca>Mg>Sr=Ba). Ionomycin (SQ23377) promotes apoptosis. Ionomycin calcium (SQ23377 calcium) also induces the activation of protein kinase C (PKC)[1][2][3].

  

• HY-B0744

  Eflornithine	70052-12-9
  Eflornithine is a specific, irreversible inhibitor of the enzyme ornithine decarboxylase. Eflornithine is a medication for the treatment of African trypanosomiasis and excessive facial hair growth in women.

  

• HY-N1724

  Concanamycin A	80890-47-7
  Concanamycin A (Folimycin; Antibiotic X 4357B) is a macrolide antibiotic, a vacuolar type H+-ATPase (V-ATPase) inhibitor. Concanamycin A is also an inhibitor of lysosomal acidification, can be used to T cell-mediated inflammation research[1]-[5].

  

• HY-N0565A

  Doxycycline hydrochloride	10592-13-9	99.99%
  Doxycycline hydrochloride, an antibiotic, is an orally active and broad-spectrum metalloproteinase (MMP) inhibitor[1]. Doxycycline hydrochloride shows antibacterial activity and anti-cancer cell proliferation activity. Doxycycline hydrochloride can be used to construct gene expression regulation models[1][2][3][4][5].

  

• HY-B1625

  Deferoxamine	70-51-9
  Deferoxamine (Deferoxamine B) is an iron chelator (binds to Fe(III) and many other metal cations), is widely used to reduce iron accumulation and deposition in tissues. Deferoxamine upregulates HIF-1α levels with good antioxidant activity. Deferoxamine also shows anti-proliferative activity, can induce apoptosis and autophagy in cancer cells. Deferoxamine can be used in studies of diabetes, neurodegenerative diseases as well as anti-cancer and anti-COVID-19[1][2][3][4][5].

  

• HY-13678

  Meropenem	96036-03-2
  Meropenem (SM 7338) is a carbapenem antibiotic with broad-spectrum antibacterial activity. Meropenem has activity against susceptible and resistant N. gonorrhoeae (MIC value of 0.02-0.06 mg/mL), H. influenzae (MIC value of 0.03-0.12 mg/mL), and H. ducreyi (MIC value of 0.015-0.12 mg/mL)[1][2].

  

• HY-17506

  Azithromycin	83905-01-5
  Azithromycin is a macrolide antibiotic useful for the treatment of a number of bacterial infections.

  

• HY-B0474

  Tetracycline hydrochloride	64-75-5
  Tetracycline (hydrochloride) is a broad-spectrum antibiotic, exhibiting activity against a wide range of gram-positive and gram-negative bacteria.

  

• HY-B1369

  Imipenem monohydrate	74431-23-5
  Imipenem monohydrate, a stable crystalline derivative of thienamycin, is an antibiotic and has the excellent activity against a broad range of gram-positive and gram-negative aerobic and anaerobic bacteria. Imipenem monohydrate can be used for the research of carbapenem-nonsusceptible and P. aeruginosa biofilm infections[1][2][3].

  

• HY-78131

  Ibuprofen	15687-27-1	99.97%
  Ibuprofen ((±)-Ibuprofen) is a potent, orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen ((±)-Ibuprofen) can be used in the research of pain, swelling, inflammation, infection, immunology, cancers[1][2][5][8].

  

• HY-B0525A

  Carbenicillin disodium	4800-94-6
  Carbenicillin disodium (Sodium carbenicillin) is a broad-spectrum semi-synthetic penicillin antibiotic for gram-negative bacteria. Carbenicillin disodium can interfere the cell wall synthesis while displaying low toxicity to plant tissue[1].

  

• HY-N0262

  Cordycepin	73-03-0
  Cordycepin (3'-Deoxyadenosine) is a nucleoside derivative and inhibits IL-1β-induced MMP-1 and MMP-3 expression in rheumatoid arthritis synovial fibroblasts (RASFs) in a dose-dependent manner[1]. Cordycepin kills Mycobacterium tuberculosis through hijacking the bacterial adenosine kinase[2].

  

• HY-B0510

  Trimethoprim	738-70-5	99.97%
  Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim can inhibit infection of Influenza A virus in chick embryo when combinated with zinc[1][2][3][4].

  

• HY-A0089

  Colistin sulfate	1264-72-8
  Colistin sulfate is a polypeptide antibiotic which inhibits gram-negative bacteria by binding to lipopolysaccharides and phospholipids in the outer cell membrane of gram-negative bacteria.

  

• HY-N6693

  Valinomycin	2001-95-8
  Valinomycin is a potassium-specific ionophore, the valinomycin-K+ complex can be incorporated into biological bilayer membranes with the hydrophobic surface of valinomycin, destroys the normal K+ gradient across the membrane, and as a result kills the cells, incorporating into liposomes can significantly reduces the cytotoxicity and enhances the targeting effect. Valinomycin exhibits antibiotic, antifungal, antiviral, antitumor and insecticidal efficacy, thus can be used for relevant research[1][2].

  

• HY-B0094

  Artemisinin	63968-64-9
  Artemisinin (Qinghaosu), a sesquiterpene lactone, is an anti-malarial agent isolated from the aerial parts of Artemisia annua L. plants[1]. Artemisinin inhibits AKT signaling pathway by decreasing pAKT in a dose-dependent manner. Artemisinin reduces cancer cell proliferation, migration, invasion, tumorigenesis and metastasis and has neuroprotective effects[2].

  

• HY-N1584

  Halofuginone	55837-20-2	99.92%
  Halofuginone (RU-19110), a Febrifugine derivative, is a competitive prolyl-tRNA synthetase inhibitor with a Ki of 18.3 nM[1][2]. Halofuginone is a specific inhibitor of type-I collagen synthesis and attenuates osteoarthritis (OA) by inhibition of TGF-β activity[3][4]. Halofuginone is also a potent pulmonary vasodilator by activating Kv channels and blocking voltage-gated, receptor-operated and store-operated Ca2+ channels. Halofuginone has anti-malaria, anti-inflammatory, anti-cancer, anti-fibrosis effects[5].

  

• HY-17514

  Itraconazole	84625-61-6	99.59%
  Itraconazole (R51211) is a triazole antifungal agent and a potent and orally active Hedgehog (Hh) signaling pathway antagonist with an IC50 of ~800 nM. Itraconazole potently inhibits lanosterol 14α-demethylase (cytochrome P450 enzyme), thereby inhibits the oxidative conversion of lanosterol to ergosterol. Itraconazole has anticancer and antiangiogenic effects. Itraconazole is a oxysterol-binding protein (OSBP) inhibitor[1][2][3][4].

  

• HY-B2237

  Lysozyme from chicken egg white	12650-88-3
  Lysozyme from chicken egg white is a bactericidal enzyme, and it lyses gram-positive bacteria. Lysozyme from chicken egg white can also be used for the research of HIV infection and pulmonary emphysema[1][2][3].

  

• HY-116282

  Dextran sulfate sodium salt (MW 5000)	9011-18-1	99.20%
  Dextran sulfate sodium salt (DSS) (MW 5000) is a polymer of dehydrated glucose with a molecular weight of approximately 5000. Dextran sulfate sodium salt (DSS) with different molecular weights exhibits different biological activities. Dextran sulfate sodium salt (MW 5000) is an inhibitor of complement and coagulation pathways, and belongs to the glycosaminoglycans (GAG) family. Dextran sulfate sodium salt (MW 5000) acts as an anticoagulant, antiviral, and anti-lipemic agent. Dextran sulfate sodium salt (DSS) stops HIV-1 virus adsorption to host cells. Dextran sulfate sodium salt (MW 5000) prevents NK cell-mediated cytotoxicity. Dextran sulfate sodium salt (MW 5000) inhibits instant blood-mediated inflammatory reaction (IBMIR)[1][2][3][4][5].

  

• HY-135853

  Molnupiravir	2492423-29-5	99.94%
  Molnupiravir (EIDD-2801) is an orally bioavailable proagent of the ribonucleoside analog EIDD-1931. Molnupiravir has broad spectrum antiviral activity against influenza virus and multiple coronaviruses, such as SARS-CoV-2, MERS-CoV, SARS-CoV. Molnupiravir has the potential for the research of COVID-19, and seasonal and pandemic influenza[1][2].

  

• HY-17503

  Metoprolol	51384-51-1	99.97%
  Metoprolol is an orally active, selective β1-adrenoceptor antagonist. Metoprolol shows anti-inflammation, antitumor and anti-angiogenic properties[1][2][3].

  

• HY-P1222

  LL-37, human	154947-66-7	99.60%
  LL-37, human is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human could help protect the cornea from infection and modulates wound healing[1][2][3].

  

• HY-19930

  Vaborbactam	1360457-46-0
  Vaborbactam (RPX7009) is a cyclic boronic acid pharmacophore β-lactamase inhibitor.

  

• HY-B0219

  Allopurinol	315-30-0	99.97%
  Allopurinol is a potent and orally active xanthine oxidase inhibitor with an IC50 value of 0.2-50 μM. Allopurinol can be used in the research of hyperuricemia and gout. Allopurinol decreases the expression of HIF-1α and HIF-2α protein. Allopurinol shows anti-depressant and anti-nociception activity. Anti-leishmanial effect[1][2][3][4][5].

  

• HY-B0421

  Mycophenolic acid	24280-93-1	99.94%
  Mycophenolic acid is a potent uncompetitive inosine monophosphate dehydrogenase (IMPDH) inhibitor with an EC50 of 0.24 µM. Mycophenolic acid demonstrates antiviral effects against a wide range of RNA viruses including influenza. Mycophenolic acid is an immunosuppressive agent. Antiangiogenic and antitumor effects[1][2].

  

• HY-109025A

  Baloxavir	1985605-59-1	99.68%
  Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity[1][2].

  

• HY-16909

  Leptomycin B	87081-35-4
  Leptomycin B (CI 940; LMB) is a potent inhibitor of the nuclear export of proteins. Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue. Leptomycin B is a potent antifungal antibiotic blocking the eukaryotic cell cycle[1].

  

• HY-16438

  RRx-001	925206-65-1	99.79%
  RRx-001, a hypoxia-selective epigenetic agent and studied as a radio- and chem-sensitizer, triggers apoptosis and overcomes agent resistance in myeloma. RRx-001 exhibits potent anti-tumor activity with minimal toxicity[1]. RRx-001 is a dual small molecule checkpoint inhibitor by downregulating CD47 and SIRP-α[2]. RRx-001 is a potent inhibitor of G6PD and shows potent antimalarial activity[3].

  

• HY-103490

  Takinib	1111556-37-6	99.41%
  Takinib (EDHS-206) is an orally active and selective TAK1 inhibitor (IC50=9.5 nM), more than 1.5 log more potent than the second and third ranked targets, IRAK4 (120 nM) and IRAK1 (390 nM), respectively. Takinib is an inhibitor of autophosphorylated TAK1 that non-competitively binds within the ATP binding pocket. Takinib induces apoptosis following TNFα stimulation in cell models of rheumatoid arthritis and metastatic breast cancer. Takinib is also a P. falciparum protein kinase 9 (PfPK9) inhibitor (KD(app) of 0.46 μM)[1][2][3].

  

• HY-129047

  Trypsin	9002-07-7
  Trypsin is a serine protease enzyme, and hydrolyzes proteins at the carboxyl side of the Lysine or Arginine. Trypsin activates PAR2 and PAR4. Trypsin induces cell-to-cell membrane fusion in PDCoV infection by the interaction of S glycoprotein of PDCoV and pAPN. Trypsin also promotes cell proliferation and differentiation. Trypsin can be used in the research of wound healing and neurogenic inflammation[1][2][3][4][6].

  

• HY-B0220

  Erythromycin	114-07-8
  Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin binds to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin also exhibits antitumor and neuroprotective effect in different fields of research[3][4].

  

• HY-N6798

  Myriocin	35891-70-4
  Myriocin (Thermozymocidin), a fungal metabolite could be isolated from Myriococcum albomyces, Isaria sinclairi and Mycelia sterilia, is a potent inhibitor of serine-palmitoyl-transferase (SPT) and a key enzyme in de novo synthesis of sphingolipids. Myriocin suppresses replication of both the subgenomic HCV-1b replicon and the JFH-1 strain of genotype 2a infectious HCV, with an IC50 of 3.5 μg/mL for inhibiting HCV infection[1][2][3].

  

• HY-10496

  SC75741	913822-46-5	99.51%
  SC75741 is a broad and efficient NF-κB inhibitor with an IC50 of 200 nM for p65[1]. SC75741 blocks influenza viruses (IV) replication. SC75741 impairs DNA binding of the NF-κB subunit p65, resulting in reduced expression of cytokines, chemokines, and pro-apoptotic factors. SC75741 subsequently inhibits caspase activation and blocks caspase-mediated nuclear export of viral ribonucleoproteins[2].

  

• HY-17381

  Idarubicin hydrochloride	57852-57-0	99.94%
  Idarubicin hydrochloride is an anthracycline antileukemic agent. It inhibits the topoisomerase II interfering with the replication of DNA and RNA transcription. Idarubicin hydrochloride inhibits the growth of bacteria and yeasts.

  

• HY-40354A

  Tofacitinib citrate	540737-29-9	99.94%
  Tofacitinib citrate is an orally available JAK1/2/3 inhibitor with IC50s of 1, 20, and 112 nM, respectively. Tofacitinib citrate has antibacterial, antifungal and antiviral activities.

  

• HY-18980

  Rottlerin	82-08-6
  Rottlerin, a natural product purified from Mallotus Philippinensis, is a specific PKC inhibitor, with IC50 values for PKCδ of 3-6 μM, PKCα,β,γ of 30-42 μM, PKCε,η,ζ of 80-100 μM. Rottlerin acts as a direct mitochondrial uncoupler, and stimulates autophagy by targeting a signaling cascade upstream of mTORC1. Rottlerin induces apoptosis via caspase 3 activation[1][2][3]. Rottlerin inhibits HIV-1 integration and Rabies virus (RABV) infection[4][5].

  

• HY-N0191

  Andrographolide	5508-58-7	99.74%
  Andrographolide is a NF-κB inhibitor, which inhibits NF-κB activation through covalent modification of a cysteine residue on p50 in endothelial cells without affecting IκBα degradation or p50/p65 nuclear translocation. Andrographolide has antiviral effects.

  

• HY-A0248

  Polymyxin B Sulfate	1405-20-5
  Polymyxin B Sulfate is a potent antibacterial agent and a relatively toxic antibiotic. Polymyxin B Sulfate also is a antiendotoxin agent. Polymyxin B Sulfate shows endotoxin-neutralizing properties can be used as adjunctive research in gram-negative sepsis. Polymyxin B Sulfate shows antibacterial activities in vitro and in vivo[1][2][3].

  

• HY-17016

  Oseltamivir phosphate	204255-11-8
  Oseltamivir phosphate (GS 4104) is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B.

  

• HY-N0751

  Scutellarin	27740-01-8	99.04%
  Scutellarin, an active flavone isolated from Scutellaria baicalensis, can down-regulates the STAT3/Girdin/Akt signaling in HCC cells, and inhibits RANKL-mediated MAPK and NF-κB signaling pathway in osteoclasts. Scutellarin is active against HIV-1IIIB, HIV-1(74V) and HIV-1KM018 with EC50s of 26 μM, 253 μM and 136 μM, respectively.

  

• HY-17422

  Acyclovir	59277-89-3
  Acyclovir (Aciclovir) is a potent, orally active antiviral agent. Acyclovir has antiherpetic activity with IC50 values of 0.85 μM and 0.86 μM for HSV-1 and HSV-2, respectively. Acyclovir induces cell cycle perturbation and apoptosis. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia[1][2][3][4].

  

• HY-N0102

  Isoliquiritigenin	961-29-5	98.07%
  Isoliquiritigenin is an anti-tumor flavonoid from the root of Glycyrrhiza uralensis Fisch., which inhibits aldose reductase with an IC50 of 320 nM. Isoliquiritigenin is a potent inhibitor of influenza virus replication with an EC50 of 24.7 μM.

  

• HY-B0879A

  Suramin sodium salt	129-46-4
  Suramin sodium salt (Suramin hexasodium salt) is a reversible and competitive protein-tyrosine phosphatases (PTPases) inhibitor[1]. Suramin sodium salt is a potent inhibitor of sirtuins: SirT1 (IC50=297 nM), SirT2 (IC50=1.15 μM), and SirT5 (IC50=22 μM)[2]. Suramin sodium salt is a competitive inhibitor of reverse transcriptase (DNA topoisomerase II: IC50=5 μM)[3][4]. Suramin sodium salt is a potent SARS-CoV-2 RNA-dependent RNA polymerase (RdRp) inhibitor[5]. Suramin sodium salt efficiently inhibits IP5K and is an antiparasitic, anti-neoplastic and anti-angiogenic agent[6][7][8].

  

• HY-108462

  ML-SA1	332382-54-4	99.44%
  ML-SA1, as a selective TRPML agonist, inhibits Dengue virus 2 (DENV2) and Zika virus (ZIKV) by promoting lysosomal acidification and protease activity. The IC50 value of ML-SA1 against DENV2 RNA and ZIKV RNA is 8.3 μM and 52.99 μM, respectively. ML-SA1 induces autophagy. ML-SA1 can be used for the research of broad-spectrum antiviral[1].

  

• HY-N0063

  Punicalagin	65995-63-3	99.97%
  Punicalagin is a polyphenol ingredient isolated from Pomegranate (Punica granatum L.) or the leaves of Terminalia catappa L.. Punicalagin is a reversible and non-competitive 3CLpro inhibitor and inhibits SARS-CoV-2 replication in vitro. Punicalagin is an anti-hepatitis B virus (HBV) agent and has antioxidant, anti-inflammatory, and anticancer effects. Punicalagin has the potential for the research of COVID-19[1][2][3].

  

• HY-109025

  Baloxavir marboxil	1985606-14-1
  Baloxavir marboxil (S-033188) is a selective inhibitor of influenza cap-dependent endonuclease. Baloxavir marboxil, a potent antiviral agent, shows activity against influenza A and B virus[1].

  

• HY-W040233

  L-Lactic acid sodium	867-56-1
  L-lactate Sodium (Sodium (S)-2-hydroxypropanoate) is a buildiing block which can be used as a precursor for the production of the bioplastic polymer poly-lactic acid. L-Lactic acid Sodium has antiproliferative activity[1][2][3].

  

• HY-17392

  Zalcitabine	7481-89-2
  Zalcitabine is a potent nucleoside analogue reverse transcriptase inhibitor used in the treatment of HIV infection.

  

• HY-10529

  Betulinic acid	472-15-1
  Betulinic acid is a natural pentacyclic triterpenoid, acts as a eukaryotic topoisomerase I inhibitor, with an IC50 of 5 μM, and possesses anti-HIV, anti-malarial, anti-inflammatory and anti-tumor properties[1][2][3][4].

  

• HY-76200

  Voriconazole	137234-62-9	99.89%
  Voriconazole (UK-109496) is a second-generation, broad-spectrum triazole antifungal agent that inhibits fungal ergosterol biosynthesis. Voriconazole exerts its antifungal activity by inhibition of 14-α-lanosterol demethylation, which is mediated by fungal cytochrome P450 enzymes[1][2].

  

• HY-10502

  Tipifarnib	192185-72-1	99.89%
  Tipifarnib (IND 58359) binds to and inhibits farnesyltransferase (FTase) with an IC50 of 0.86 nM. Antineoplastic activity and antiparasitic activity[1].

  

• HY-N2329

  Piperlongumine	20069-09-4
  Piperlongumine is a alkaloid[1], possesses ant-inflammatory, antibacterial, antiangiogenic, antioxidant, antitumor, and antidiabetic activities[2]. Piperlongumine induces ROS, and induces apoptosis in cancer cell lines[1]. Piperlongumine shows anti-cardiac fibrosis activity, suppresses myofibroblast transformation via suppression of the ERK1/2 signaling pathway. Piperlongumin could be used in the study of migrasome[2][3].

  

• HY-13832

  Atovaquone	95233-18-4	99.75%
  Atovaquone (Atavaquone) is a potent, selective and orally active inhibitor of the parasite’s mitochondrial cytochrome bc1 complex. Atovaquone is against human and  P. falciparum cytochrome bc1 activity with IC50 values of 460 nM and 2.0 nM, respectively. Atovaquone is an antimalarial agent and has the potential for the investigation of neumocystis pneumonia, toxoplasmosis, malaria, and babesia[1][2].

  

• HY-B0324A

  Crystal Violet	548-62-9
  Crystal Violet, also known as Gentian violet, methyl violet 10B, is a triphenyl-methane, an alkaline dye that binds to DNA in the nucleus of a cell, staining it a deep purple. It is often used for Gram staining to classify bacteria, or for cell or histological staining[1].

  

• HY-N0100

  Naringenin	480-41-1	99.27%
  Naringenin is the predominant flavanone in Citrus reticulata Blanco; displays strong anti-inflammatory and antioxidant activities. Naringenin has anti-dengue virus (DENV) activity.

  

• HY-B0990

  Thiostrepton	1393-48-2
  Thiostrepton is a thiazole antibiotic which selectively inhibits FOXM1. FOXM1 binds to YAP/TEAD complex. YAP/TEAD/FOXM1 complex binding at regulatory regions of genes governing cell cycle may impact cell proliferation[1].

  

• HY-13210

  Zanamivir	139110-80-8
  Zanamivir is an influenza viral neuraminidase inhibitor with IC50 values of 0.95 nM and 2.7 nM for influenza A and B, respectively.

  

• HY-112163

  Zotatifin	2098191-53-6	99.69%
  Zotatifin (eFT226) is a potent, selective, and well-tolerated eIF4A inhibitor. Zotatifin promotes eIF4A binding to specific mRNA sequences with recognition motifs in the 5’-UTRs (IC50=2 nM) and interferes with the assembly of the eIF4F initiation complex[1]. Zotatifin shows robust antiviral effects, it effectively reduces viral infectivity by inhibiting SARS-CoV-2 NP protein biogenesis (IC90=37 nM)[2]. Zotatifin induces cell apoptosis[1].

  

• HY-17508

  Clarithromycin	81103-11-9	99.90%
  Clarithromycin has a broad spectrum of antimicrobial activity. Clarithromycin inhibits the CYP3A4-catalyzed triazolam alpha-hydroxylation with the IC50 (Ki) value of 56 (43) μM[2]. Clarithromycin significantly inhibits the HERG potassium current[3].Clarithromycin affects the autophagic flux by impairing the signaling pathway linking hERG1 and PI3K[4].

  

• HY-B0097

  Floxuridine	50-91-9
  Floxuridine (5-Fluorouracil 2'-deoxyriboside) is a pyrimidine analog and known as an oncology antimetabolite. Floxuridine inhibits Poly(ADP-Ribose) polymerase and induces DNA damage by activating the ATM and ATR checkpoint signaling pathways in vitro. Floxuridine is a extreamly potent inhibitor for S. aureus infection and induces cell apoptosis[1][2]. Floxuridine has antiviral effects against HSV and CMV[3].

  

• HY-B0425A

  Novobiocin sodium	1476-53-5
  Novobiocin (Albamycin) sodium is a potent and orally active antibiotic. Novobiocin sodium also is a DNA gyrase inhibitor and a heat shock protein 90 (Hsp90) antagonist. Novobiocin sodium has the potential for the research of highly beta-lactam-resistant pneumococcal infections. Novobiocin sodium shows anti-orthopoxvirus activity[1][2][3][4].

  

• HY-N2019

  Chaetocin	28097-03-2
  Chaetocin is a specific inhibitor of the histone methyltransferase (HMT) SU(VAR)3-9 with an IC50 of 0.6 μM for SU(VAR)3-9. It also inhibits thioredoxin reductase (TrxR) with an IC50 of 4 μM.

  

• HY-13524

  AG-1478	153436-53-4	99.57%
  AG-1478 (Tyrphostin AG-1478) is a selective EGFR tyrosine kinase inhibitor with IC50 of 3 nM. AG-1478 has antiviral effects against HCV and encephalomyocarditis virus (EMCV).

  

• HY-B0250

  Lamivudine	134678-17-4
  Lamivudine (BCH-189) is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Lamivudine can inhibit HIV reverse transcriptase 1/2 and also the reverse transcriptase of hepatitis B virus. Lamivudine salicylate can penetrate the CNS[1][2].

  

• HY-N6972

  Cepharanthine	481-49-2
  Cepharanthine is a natural product that can be isolated from the plant Stephania cephalantha Hayata. Cepharanthine has anti-severe acute respiratory syndrome coronavirus 2 (anti-SARS-CoV-2) activities. Cepharanthine has good effective in suppressing viral proliferation (half maximal (50%) inhibitory concentration (IC50) and 90% inhibitory concentration (IC90) values of 1.90 and 4.46 μM[1]. Cepharanthine can also effectively reverses P-gp-mediated multidrug resistance in K562 cells and increase enhances the sensitivity of anticancer agents in xenograft mice model[2][3]. Cepharanthine shows inhibitory effects of human liver cytochrome P450 enzymes CYP3A4, CYP2E1 and CYP2C9. Cepharanthine has antitumor, anti-inflammatory and antinociceptive effects[4][5][6][7][8].

  

• HY-B0113

  Omeprazole	73590-58-6
  Omeprazole (H 16868), a proton pump inhibitor (PPI), is available for treatment of acid-related gastrointestinal disorders. Omeprazole shows competitive inhibition of CYP2C19 activity with a Ki of 2 to 6 μM[1]. Omeprazole also inhibits growth of Gram-positive and Gram-negative bacteria[2].Omeprazole is a potent brain penetrant neutral sphingomyelinase (N-SMase) inhibitor (exosome inhibitor)[3].

  

• HY-12686

  5Z-7-Oxozeaenol	253863-19-3
  5Z-7-Oxozeaenol is a natural anti-protozoan compound from fungal origin, acting as a potent irreversible and selective inhibitor of TAK1 and VEGF-R2, with IC50s of 8 nM and 52 nM, respectively.

  

• HY-N1428

  Citric acid	77-92-9
  Citric acid is a natural preservative and food tartness enhancer. Citric acid induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-B1367

  Carbenoxolone disodium	7421-40-1	99.94%
  Carbenoxolone disodium is the active metabolite of Glycyrrhizic acid (HY-N0184) and the inhibitor of human 11β-HSD and bacterial 3α, 20β-HSD[1]. Carbenoxolone disodium is an uncoupling agent for gap junctions and a potent inhibitor of Vaccinia virus replication[2]. Carbenoxolone disodium is used for the study of peptic, esophageal and oral ulceration and inflammation. Carbenoxolone disodium inhibits Vaccinia virus replication.

  

• HY-P2962

  Transglutaminase, Streptoverticillium mobaraense	80146-85-6
  Transglutaminase, Streptoverticillium mobaraense (TG) is an enzyme that forms cross-links between protein molecules. Transglutaminase, Streptoverticillium mobaraense attaches proteins and peptides to small molecules, polymers, surfaces, DNA and other proteins. Transglutaminase, Streptoverticillium mobaraense is widely used in food applications in the meat, fish, dairy and baking industries[1][2][3].

  

• HY-17395A

  Terbinafine	91161-71-6	99.87%
  Terbinafine (TDT 067) is an orally active and potent antifungal agent. Terbinafine is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria[1][2][3]. Terbinafine is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-B0134

  Bestatin	58970-76-6
  Bestatin is a natural, broad-spectrum, and competitive CD13 (Aminopeptidase N)/APN and leukotriene A4 hydrolase inhibitor. Bestatin has anticancer effects[1][2].

  

• HY-B1906

  Streptomycin	57-92-1
  Streptomycin (Agrept) is an effective antibiotic against M. tuberculosis, is used for the research of tuberculosis (TB). Streptomycin also is a bacteriocidal agent that can be used for the research of a number of bacterial infections. Streptomycin can bind strongly to nucleic acids, interferes and blocks protein synthesis while permitting continued RNA and DNA synthesis. Streptomycin, as a common antibiotic used in culture media, also is a blocker of stretch-activated and mechanosensitive ion channels in neurons and cardiac myocytes [1][2][3].

  

• HY-107454

  OSS_128167	887686-02-4	98.63%
  OSS_128167 is a potent selective sirtuin 6 (SIRT6) inhibitor with IC50s of 89 μM, 1578 μM and 751 μM for SIRT6, SIRT1 and SIRT2, respectively. OSS_128167 has anti-HBV activity that inhibits HBV transcription and replication. OSS_128167 has anti-cancer, anti-inflammation and anti-viral effects[1][2].

  

• HY-122122

  ML-60218	577784-91-9	99.85%
  ML-60218 is a broad-spectrum RNA pol III inhibitor, with IC50s of 32 and 27 μM for Saccharomyces cerevisiae and human. ML-60218 disrupts already assembled viroplasms and to hamper the formation of new ones without the need for de novo transcription of cellular RNAs[1][2].

  

• HY-13207

  ONX-0914	960374-59-8	99.72%
  ONX-0914 (PR-957) is a selective inhibitor of low-molecular mass polypeptide-7 (LMP7), the chymotrypsin-like subunit of the immunoproteasome. ONX-0914 blocks cytokine production and attenuates progression of experimental arthritis. ONX-0914 is a noncompetitive irreversible inhibitor of the mycobacterial proteasome (Ki=5.2 μM). ONX-0914 reactivates latent HIV-1 through p-TEFb activation mediated by HSF-1[1][2][3].

  

• HY-103586

  GS-441524	1191237-69-0	99.89%
  GS-441524, predominant metabolite of Remdesivir and superior to Remdesivir against Covid-19 , shows comparable efficacy in cell-based models of primary human lung and cat cells infected with coronavirus. GS-441524 could strongly inhibits feline infectious peritonitis virus (FIPV), with an EC50 of 0.78 μM[1][2][3].

  

• HY-14434

  Asunaprevir	630420-16-5	99.84%
  Asunaprevir (BMS-650032) is a potent and orally bioavailable hepatitis C virus (HCV) NS3 protease inhibitor, with IC50 of 0.2 nM-3.5 nM[1]. Asunaprevir inhibits SARS-CoV-2 3CLpro activity[5].

  

• HY-B0108

  Daptomycin	103060-53-3	99.90%
  Daptomycin is a lipopeptide antibiotic with rapid in vitro bactericidal activity against gram-positive organisms.

  

• HY-15298

  Grazoprevir	1350514-68-9	99.99%
  Grazoprevir (MK-5172) is a selective inhibitor of Hepatitis C virus NS3/4a protease with broad activity across genotypes and resistant variants, with Kis of 0.01 nM (gt1b), 0.01 nM (gt1a), 0.08 nM (gt2a), 0.15 nM (gt2b), 0.90 nM (gt3a), respectively[1][2]. Grazoprevir inhibits SARS-CoV-2 3CLpro activity[3].

  

• HY-103248

  Toyocamycin	606-58-6
  Toyocamycin (Vengicide) is an adenosine analog produced by Streptomyces diastatochromogenes, acts as an XBP1 inhibitor. Toyocamycin blocks RNA synthesis and ribosome function, and induces apoptosis. Toyocamycin affects IRE1α-XBP1 pathway, and inhibits XBP1 mRNA cleavage with an IC50 value of 80 nM with affecting IRE1α auto-phosphorylation. Toyocamycin specifically inhibits CDK9 with an IC50 value of 79 nM[1][2][3].

  

• HY-P4108

  TAT-HA2 Fusion Peptide	923954-79-4	99.69%
  TAT-HA2 Fusion Peptide is a peptide-based delivery agent that combines the pH-sensitive HA2 fusion peptide from Influenza and the cell-penetrating peptide TAT from HIV. TAT-HA2 Fusion Peptide is a transactivator of transcription and hemaglutanin for endosomal release. TAT-HA2 Fusion Peptide enhances cellular uptake of macromolecules[1].

  

• HY-13625

  Ertapenem sodium	153773-82-1	98.94%
  Ertapenem sodium (L-749345) is a broad spectrum and long acting β-lactam antibiotic. Ertapenem sodium has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem sodium can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract[1][2].

  

• HY-15005

  Sofosbuvir	1190307-88-0
  Sofosbuvir (GS-7977) is an HCV RNA replication inhibitor with an EC50 of 92 nM[1].

  

• HY-17413

  Zidovudine	30516-87-1	99.95%
  Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection.

  

• HY-116788

  Lipofermata	297180-15-5
  Lipofermata is a fatty acid transport protein 2 (FATP2) inhibitor. Lipofermata shows fatty acid transport inhibition with an IC50 of 4.84 μM in Caco-2 cells. Lipofermata, an analog of spiro-indoline-thadiazole, shows zinc-specific suppression of antibacterial activity. Lipofermata perturbs zinc homeostasis in E. coli K-12 with a MIC of 16 μM[1][2][3].

  

• HY-17408

  Mevastatin	73573-88-3	99.46%
  Mevastatin (Compactin) is a first HMG-CoA reductase inhibitor that belongs to the statins class. Mevastatin is a lipid-lowering agent, and induces apoptosis, arrests cancer cells in G0/G1 phase. Mevastatin also increases endothelial nitric oxide synthase (eNOS) mRNA and protein levels. Mevastatin has antitumor activity and has the potential for cardiovascular diseases treatment[1][2][3].

  

• HY-101444A

  PAβN dihydrochloride	100929-99-5	99.89%
  PAβN dihydrochloride (MC-207110 dihydrochloride) is an efflux pump inhibitor.

  

• HY-131045

  HADA hydrochloride	2253733-10-5	99.08%
  HADA hydrochloride (HCC-Amino-D-alanine hydrochloride) is a blue (λem~450 nm) fluorescent D-amino acid (FDAA). FDAAs are efficiently incorporated into the peptidoglycans (PGs) of diverse bacterial species at the sites of PG biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation[1].

  

• HY-14588

  Lopinavir	192725-17-0	99.71%
  Lopinavir (ABT-378) is a highly potent, selective peptidomimetic inhibitor of the HIV-1 protease, with Kis of 1.3 to 3.6 pM for wild-type and mutant HIV protease. Lopinavir acts by arresting maturation of HIV-1 thereby blocking its infectivity[1][2]. Lopinavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 14.2 μM[3].

  

• HY-15192

  GSK 650394	890842-28-1	99.76%
  GSK 650394 is a novel SGK inhibitor with IC50 of 62 nM and 103 nM for SGK1 and SGK2 in the SPA assay respectively. GSK 650394 also inhibits influenza virus replication.

  

• HY-13512

  Camostat mesylate	59721-29-8	99.94%
  Camostat mesylate (Camostat mesilate) is an orally active, synthetic serine protease inhibitor for chronic pancreatitis. Camostat mesylate, an inhibitor of TMPRSS2, shows antiviral activity against SARS-CoV-2. Camostat mesylate also inhibits the activity of prostasin, trypsin, and matriptase[1][2][3].

  

• HY-15136

  Lonafarnib	193275-84-2	99.60%
  Lonafarnib (Sch66336) is a potent and orally active farnesyl transferase (FTase) inhibitor. Lonafarnib inhibits the activities of H-ras, K-ras and N-ras with IC50 values of 1.9 nM, 5.2 nM and 2.8 nM, respectively. Lonafarnib also has anti-hepatitis delta virus (HDV) activities.

  

• HY-B0217

  Nitazoxanide	55981-09-4	99.28%
  Nitazoxanide (NTZ), an anthelmintic agent, exhibits a broad spectrum of activities against a wide variety of helminths, protozoa, and enteric bacteria infecting animals and humans. Nitazoxanide inhibits Giardia lamblia trophozoite proliferation in axenic culture with an IC50 of 2.4 μM[1]. Nitazoxanide can be used for the research of parasitic gastroenteritis. Nitazoxanide shows anti-Japanese encephalitis virus (JEV) activity in a mouse model[2].

  

• HY-19609

  Calicheamicin	108212-75-5	98.28%
  Calicheamicin, an antitumor antibiotic, is a cytotoxic agent that causes double-strand DNA breaks. Calicheamicin is a DNA synthesis inhibitor[1]. Calicheamicin is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-13317

  Oseltamivir	196618-13-0
  Oseltamivir (GS 4104) is an orally active influenza virus neuraminidase inhibitor (NAI). Oseltamivir inhibits influenza A/H3N2, A/H1N2, A/H1N1, and B viruses with mean IC50s of 0.67, 0.9, 1.34 and 13 nM, respectively[1].

  

• HY-N0086

  N6-Methyladenosine	1867-73-8
  N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

  

• HY-N0097

  Guanosine	118-00-3
  Guanosine (DL-Guanosine) is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine possesses anti-HSV activity.

  

• HY-147124

  RIG012	2642218-43-5
  RIG012 is a potent RIG-I inhibitor with an IC50 of 0.71 μM using the NADH-coupled ATPase assay. RIG012 inhibits IFN-β and ISG hRsad2 expression[1].

  

• HY-10572

  Efavirenz	154598-52-4	99.93%
  Efavirenz (DMP 266) is a potent inhibitor of the wild-type HIV-1 reverse transcriptase with a Ki of 2.93 nM and exhibits an IC95 of 1.5 nM for the inhibition of HIV-1 replicative spread in cell culture[1].

  

• HY-A0256

  Clavulanic acid	58001-44-8	99.76%
  Clavulanic acid is a naturally occurring powerful bacterial β-lactamases inhibitor for research of infections caused by bacteria, including infections of the ears. Clavulanic acid is active against a wide spectrum of gram-positive and gram-negative bacterias[1].

  

• HY-148335

  IRG1-IN-1	2407652-42-8	99.82%
  IRG1-IN-1 is an itaconic acid derivative. IRG1-IN-1 can inhibit immune-responsive gene 1 (IRG1) activity. IRG1-IN-1 can be used for the research of cancer, inflammation and autoimmune diseases[1].

  

• HY-13228

  YM-201636	371942-69-7	98.05%
  YM-201636 is a potent and selective PIKfyve inhibitor with an IC50 of 33 nM. YM-201636 also inhibits p110α with an IC50 of 3.3 μM. YM-201636 inhibits retroviral replication.

  

• HY-16752

  Relebactam	1174018-99-5	99.72%
  Relebactam is a diazabicyclooctane inhibitor with activity against a wide spectrum of β-lactamases, including class A (extended-spectrum β-lactamases and KPC) and class C (AmpC) enzymes. Relebactam shows antibacterial activity[1].

  

• HY-N0469

  L-Lysine	56-87-1
  L-lysine is an essential amino acid for humans with orally activity. L-lysine can inhibit the occurrence of HSV infections and is used in herpes research. L-lysine increases calcium absorption, reduces diabetes-related diseases, improves gut health, and alleviates pancreatic inflammation. L-lysine can be used in research on metabolism, infection, and inflammation[1][2][3][4].

  

• HY-W019823

  4-MUNANA	76204-02-9
  4-MUNANA is a substrate of influenza virus neuraminidase (NA) with high selectivity and irreversible reaction. In the enzymatic reaction, 4-MUNANA is hydrolyzed by NA to generate fluorescent 4-methylumbelliferone (4-MU). By detecting the fluorescence intensity of 4-MU, quantitative analysis of NA activity can be achieved. 4-MUNANA can be used in influenza-related research, such as screening NA inhibitors, developing new anti-influenza drugs, and studying the infection mechanism of influenza viruses[1][2].

  

• HY-13765

  6-Thioguanine	154-42-7
  6-Thioguanine (Thioguanine; 2-Amino-6-purinethiol) is an anti-leukemia and immunosuppressant agent, acts as an inhibitor of SARS and MERS coronavirus papain-like proteases (PLpros) and also potently inhibits USP2 activity, with IC50s of 25 μM and 40 μM for Plpros and recombinant human USP2, respectively.

  

• HY-10442

  3-Deazaneplanocin A	102052-95-9	99.97%
  3-Deazaneplanocin A (DZNep) is a potent histone methyltransferase EZH2 inhibitor[1][2]. 3-Deazaneplanocin A is a potent S-adenosylhomocysteine hydrolase (AHCY) inhibitor. 3-Deazaneplanocin A shows anti-orthopoxvirus activity[6][7].

  

• HY-13502A

  Mitoxantrone dihydrochloride	70476-82-3	99.55%
  Mitoxantrone dihydrochloride is a potent topoisomerase II inhibitor. Mitoxantrone dihydrochloride also inhibits protein kinase C (PKC) activity with an IC50 of 8.5 μM. Mitoxantrone dihydrochloride induces apoptosis of B-CLL (B-chronic lymphocytic leukaemia) cells. Mitoxantrone dihydrochloride shows antitumor activity[1][2][3][4]. Mitoxantrone dihydrochloride also has anti-orthopoxvirus activity with EC50s of 0.25 μM and and 0.8 μM for cowpox and monkeypox, respectively[5].

  

• HY-N0452

  Hyperoside	482-36-0	99.50%
  Hyperoside is a NF-κB inhibitor, found from Hypericum monogynum. Hyperoside shows anti-tumor, antifungal, anti-inflammatory, anti-viral, and anti-oxidative activities, and can induce apoptosis[1][2].

  

• HY-N2041

  Myristic acid	544-63-8
  Myristic acid is an orally active saturated 14-carbon fatty acid found in most animal and plant fats, especially milk fat coconut oil, palm oil and nutmeg oil. Myristic acid exerts anti-inflammatory activity through the NF-κB pathway. Myristic acid has antibacterial, anti-inflammatory and analgesic properties[1][2][3][4].

  

• HY-30008

  Cycloleucine	52-52-8
  Cycloleucine is a specific inhibitor of S-adenosyl-methionine mediated methylation. Cycloleucine is antagonist of NMDA receptor associated glycine receptor, with a Ki of 600 μM. Cycloleucine is also a competitive inhibitor of ATP: L-methionine-S-adenosyl transferase in vitro. Cycloleucine has anxiolytic and cytostatic effects[1][2][3][4].

  

• HY-B1751

  Quinidine (15% dihydroquinidine)	56-54-2
  Quinidine (15% dihydroquinidine) is an antiarrhythmic agent. Quinidine is a potent, orally active, selective cytochrome P450db inhibitor. Quinidine is also a K+ channel blocker with an IC50 of 19.9 μM, and can induce apoptosis. Quinidine can be used for malaria research[1][2][3][4].

  

• HY-125033

  EIDD-1931	3258-02-4	99.96%
  EIDD-1931 (Beta-d-N4-hydroxycytidine; NHC) is a novel nucleoside analog and behaves as a potent anti-virus agent. EIDD-1931 effectively inhibits the replication activity of venezuelan equine encephalitis virus (VEEV), Chikungunya virus (CHIKV) and hepatitis C virus (HCV)[1].

  

• HY-17373

  Posaconazole	171228-49-2
  Posaconazole is a broad-spectrum, second generation, triazole compound with antifungal activity.

  

• HY-13678A

  Meropenem trihydrate	119478-56-7
  Meropenem trihydrate (SM 7338 trihydrate) is a carbapenem antibiotic with broad-spectrum antibacterial activity. Meropenem trihydrate has activity against susceptible and resistant N. gonorrhoeae (MIC value of 0.02-0.06 mg/mL), H. influenzae (MIC value of 0.03-0.12 mg/mL), and H. ducreyi (MIC value of 0.015-0.12 mg/mL)[1][2].

  

• HY-B0180A

  Imiquimod hydrochloride	99011-78-6	99.77%
  Imiquimod hydrochloride (R 837 hydrochloride), an immune response modifier, is a selective toll like receptor 7 (TLR7) agonist. Imiquimod hydrochloride exhibits antiviral and antitumor effects in vivo. Imiquimod hydrochloride can be used for the research of external genital, perianal warts, cancer and COVID-19[1][2].

  

• HY-17007

  Saquinavir	127779-20-8	99.56%
  Saquinavir (Ro 31-8959) is an orally active HIV protease inhibitor that can be used in the research of AIDS. Saquinavir also has anti-inflammatory activity and can induce apoptosis of human red blood cells[1][2][3].

  

• HY-B0329

  Isoniazid	54-85-3
  Isoniazid (INH) is a proagent and must be activated by a bacterial catalase-peroxidase enzyme KatG. Isoniazid is bactericidal to rapidly dividing mycobacteria and has anti-tuberculostatic activity[1][2][3][4].

  

• HY-B0190A

  Nafamostat mesylate	82956-11-4	99.85%
  Nafamostat mesylate (FUT-175), an anticoagulant, is a synthetic serine protease inhibitor. Nafamostat mesylate has anticancer and antivirus effect. Nafamostat mesylate induce apoptosis by up-regulating the expression of tumor necrosis factor receptor-1 (TNFR1). Nafamostat mesylate can be used in the development of the pathological thickening of the arterial wall[1][2][3][4].

  

• HY-B0472

  Streptomycin sulfate	3810-74-0
  Streptomycin sulfate is an aminoglycoside antibiotic, that inhibits protein synthesis.

  

• HY-10844

  Pretomanid	187235-37-6	99.97%
  Pretomanid (PA-824) is an antibiotic used for the research of multi-drug-resistant tuberculosis affecting the lungs. Pretomanid exhibits a sub-micromolar MIC against M. tuberculosis (MTB). The MIC values of PA-824 against a panel of MTB pan-sensitive and Rifampin mono-resistant clinical isolates range from 0.015 to 0.25 μg/mL.

  

• HY-16321

  Micafungin sodium	208538-73-2
  Micafungin sodium (FK 463 sodium) is an antifungal agent which inhibits 1, 3-beta-D-glucan synthesis.

  

• HY-N0112

  Dihydromyricetin	27200-12-0	99.73%
  Dihydromyricetin is a potent inhibitor with an IC50 of 48 μM on dihydropyrimidinase. Dihydromyricetin can activate autophagy through inhibiting mTOR signaling. Dihydromyricetin suppresses the formation of mTOR complexes (mTORC1/2). Dihydromyricetin is also a potent influenza RNA-dependent RNA polymerase inhibitor with an IC50 of 22 μM.

  

• HY-109124A

  Taniborbactam hydrochloride	2244235-49-0	99.97%
  Taniborbactam hydrochloride (VNRX-5133 hydrochloride) is a reversible and selective boronic acid-containing pan-spectrum β-lactamase inhibitor with IC50s of 8-530 nM. Taniborbactam hydrochloride has IC50s of 30 nM, 32 nM, 42 nM, 20 nM for KPC-2, AmpC, OXA-48, and VIM-2. Taniborbactam hydrochloride is against Gram-negative bacteria[1][2].

  

• HY-104032

  Ac-CoA Synthase Inhibitor1	508186-14-9	99.70%
  Ac-CoA Synthase Inhibitor1 is a potent, reversible acetate-dependent acetyl-CoA synthetase 2 (ACSS2) inhibitor with an IC50 of 0.6 µM[1]. Ac-CoA Synthase Inhibitor1 inhibits the respiratory syncytial virus (RSV)[2].

  

• HY-19719

  Miransertib	1313881-70-7	99.32%
  Miransertib (ARQ-092) is a potent, orally active, selective and allosteric Akt inhibitor with IC50s of 2.7 nM, 14 nM and 8.1 nM for Akt1, Akt2, Akt3, respectively. Miransertib is also a potent the AKT1-E17K mutant protein inhibitor and has the potential for PI3K/AKT-driven tumors and Proteus syndrome research[1]. Miransertib is effective against Leishmania[2].

  

• HY-101938

  Sinefungin	58944-73-3
  Sinefungin is a potent inhibitor of virion mRNA(guanine-7-)-methyltransferase, mRNA(nucleoside-2'-)-methyltransferase, and viral multiplication[1]. Sinefungin, a SET7/9 inhibitor, ameliorates renal fibrosis by inhibiting H3K4 methylation[2].

  

• HY-W013523

  2-NP	65182-56-1	99.55%
  2-NP is a selective enhancer of STAT1 transcription. 2-NP can enhance the ability of IFN-γ to inhibit the proliferation of human breast cancer and fibrosarcoma cells[1].

  

• HY-B0356A

  Ciprofloxacin monohydrochloride	93107-08-5	99.90%
  Ciprofloxacin (Bay-09867) monohydrochloride is a potent, orally active topoisomerase IV inhibitor. Ciprofloxacin monohydrochloride induces mitochondrial DNA and nuclear DNA damage and lead to mitochondrial dysfunction, ROS production. Ciprofloxacin monohydrochloride has anti-proliferative activity and induces apoptosis. Ciprofloxacin monohydrochloride is a fluoroquinolone antibiotic, exhibiting potent antibacterial activity[1][2][3][4].

  

• HY-B0402

  Amantadine	768-94-5
  Amantadine (1-Adamantanamine) is an orally avtive and potent antiviral agent with activity against influenza A viruses. Amantadine inhibits several ion channels such as NMDA and M2, and also inhibits Coronavirus ion channels. Amantadine also has anti-orthopoxvirus and anticancer activity. Amantadine can be used for Parkinson's disease, postoperative cognitive dysfunction (POCD) and COVID-19 research[1][2][3][4][5][6].

  

• HY-10863

  Anandamide	94421-68-8
  Anandamide is an endocannabinoid. Anandamide modulates both neuronal and immune functions through two protein-coupled cannabinoid receptors (CB1 and CB2). Anandamide can activate numerous other receptors like PPARS, TRPV1, and GPR18/GPR55. Anandamide also has potential anti-fungal and anti-inflammatory activities. Anandamide can be used for the research of Alzheimer’s disease (AD) and ulcerative colitis[1][2][3][4][5].

  

• HY-118660

  Anhydrotetracycline hydrochloride	13803-65-1	99.68%
  Anhydrotetracycline hydrochloride, a tetracycline biosynthetic precursor, is a potent competitive broad-spectrum tetracycline destructase enzymes inhibitor. Anhydrotetracycline hydrochloride is an effector for tetracycline controlled gene expression systems in eukaryotic cells[1].

  

• HY-B0919

  Azaserine	115-02-6
  Azazerine (CI-337) is a competitive inhibitor of glutamine amidotransferase. Azaserine is an antibiotic, it shows antibacterial activities. Azazerine shows anti-tumor activities and it may also act as a tumor inducer. Azazerine can be used for the research of cancer and infection[1][2][3][4][5].

  

• HY-13910

  Tenofovir	147127-20-6	99.92%
  Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV)[1].

  

• HY-B0322

  Sulfamethoxazole	723-46-6	99.70%
  Sulfamethoxazole (Ro 4-2130) is a sulfonamide antibiotic with a widespread antibacterial activity. Sulfamethoxazole inhibits bacterial folate metabolism by competing with 4-Aminobenzoic acid (HY-B1008) (PABA) to act on dihydropteroate synthetase and dihydropteroate reductase. Sulfamethoxazole can be used for the study of urinary tract infections (UTIs), prostatitis, and bronchitis[1][2][3].

  

• HY-N0570

  Hydroxytyrosol	10597-60-1	99.60%
  Hydroxytyrosol (DOPET) is a phenolic compound with anti-oxidant, anti-atherogenic, anti-thrombotic, antimicrobial, anti-inflammatory and anti-tumour effects[1][2].

  

• HY-N0105

  Rhein	478-43-3	99.56%
  Rhein is an anthraquinone compound with anti-inflammatory, antioxidant, and anti-cancer effects[1].

  

• HY-10882

  Clotrimazole	23593-75-1	99.91%
  Clotrimazole is an imidazole derivative, an antifungal compound and is a CYP (cytochrome P450) inhibitor. Clotrimazole has antibacterial activity.

  

• HY-B0139

  Flucytosine	2022-85-7	99.99%
  Flucytosine (5-Fluorocytosine) is an antifungal compound with oral activity. Flucytosine is a widely used cytotoxic drug that, after further metabolism, produces fluorinated ribonucleotides and deoxyribonucleotides, inhibits DNA and protein synthesis, and has multiple effects such as inhibiting candida and candida neoplasm infection and producies cytotoxicity to cancer cells[1][2][3].

  

• HY-66011A

  Moxifloxacin	151096-09-2	99.47%
  Moxifloxacin is an orally active 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia[1][2].

  

• HY-Y1883A

  Polyethylene glycol mono(4-tert-octylphenyl) ether	9002-93-1
  Polyethylene glycol mono(4-tert-octylphenyl) ether is a non-denaturing detergent that solubilizes lipid membranes. Polyethylene glycol mono(4-tert-octylphenyl) ether is commonly used in laboratories and is applied to vaccines at different stages of the manufacturing process. Polyethylene glycol mono(4-tert-octylphenyl) ether is listed as an excipient in certain vaccines including split virus influenza vaccines. Polyethylene glycol mono(4-tert-octylphenyl) ether is a nonionic surfactant[1][2].

  

• HY-15287

  Nelfinavir	159989-64-7	98.83%
  Nelfinavir (AG-1341) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir is a broad-spectrum, anticancer agent[1][2][3].

  

• HY-B0467A

  Amoxicillin	26787-78-0
  Amoxicillin (Amoxycillin) is an antibiotic with good oral absorption and broad spectrum antimicrobial activity. Amoxicillin inhibits the biosynthesis of polypeptides in the cell wall, thereby inhibiting cell growth[1][2][3].

  

• HY-14536

  Methylene Blue	61-73-4
  Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation[1][2][3].

  

• HY-17438

  Cidofovir	113852-37-2
  Cidofovir (GS 0504) is an acyclic monophosphate nucleotide analogue and CMV inhibitor with antiviral activity. Cidofovir inhibits cytomegalovirus (CMV) replication by selectively inhibiting viral DNA polymerase. Cidofovir induces apoptosis and can be used in studies of AIDS cytomegalovirus retinitis, herpes, and cancer[1][3]. Cidofovir also has anti-orthopoxvirus and anti-variola activities[4].

  

• HY-B0509A

  Amikacin	37517-28-5	99.93%
  Amikacin (BAY 41-6551) is a semisynthetic kanamycin analog that is active against most Gram-negative bacteria, including gentamicin- and tobramycin-resistant strains. Significant inhibitory effect. Amikacin is ototoxic and nephrotoxic. Amikacin can be used in bacteriostatic, anti-cancer and analgesic studies[1][2][3][4][5].

  

• HY-15273

  UNC0638	1255580-76-7	99.48%
  UNC0638 selectively inhibits G9a and GLP histone methyltransferases with IC50 of 15 nM and 19 nM, respectively. UNC0638 inhibits TNBC cell invasion and migration in vitro. UNC0638 is also an inhibitor of EHMT1/2 and induces fetal hemoglobin (HbF) expression in human erythroid progenitor cell culture. In addition, UNC0638 has anti-FMDV (foot-and-mouth disease virus) and anti-VSV (vesicular stomatitis virus) activities, with excellent potency and selectivity against multiple epigenetic and non-epigenetic targets[1][2][3][4][5].

  

• HY-13756A

  Tacrolimus monohydrate	109581-93-3
  Tacrolimus monohydrate (FK506 monohydrate), a macrocyclic lactone, binds to FK506 binding protein (FKBP) to form a complex and inhibits calcineurin phosphatase, which inhibits T-lymphocyte signal transduction and IL-2 transcription. Immunosuppressive properties[1].

  

• HY-N0711

  Carvacrol	499-75-2	99.98%
  Carvacrol is an orally active monoterpenic phenol that can be extract from an abundant number of aromatic plants, including thyme and oregano, possessing antioxidant, antibacterial, antifungal, anticancer, anti-inflammatory, hepatoprotective, spasmolytic, and vasorelaxant properties. Carvacrol also causes cell cycle arrest in G0/G1, downregulates Notch-1, and Jagged-1, and induces apoptosis. Carvacrol is used in low concentrations as a food flavoring ingredient and preservative, as well as a fragrance ingredient in cosmetic formulations[1][2].

  

• HY-P1607

  Nisin	1414-45-5
  Nisin is a bacteriocin produced by a group of Gram-positive bacteria that belongs to Lactococcus and Streptococcus species. Nisin has antibacterial and anti-inflammatory activity[1][2][3].

  

• HY-B2060A

  Tiamulin fumarate	55297-96-6
  Tiamulin (Thiamutilin) fumarate is a diterpenic antibiotic that is widely used in pigs and poultry for the control of infectious diseases. Tiamulin fumarate is effectively used in the study of airsacculitis, which is primarily caused by Mycoplasma spp[1].

  

• HY-17427

  Emtricitabine	143491-57-0
  Emtricitabine is a nucleoside reverse transcriptase inhibitor (NRTI) with an EC50 of 0.01 μM in PBMC cell. It is an antiviral agent for the treatment of HIV infection.

  

• HY-10570

  Nevirapine	129618-40-2	99.93%
  Nevirapine is a non-nucleoside inhibitor of HIV-1 reverse transcriptase used to treat and prevent HIV/AIDS; with a Ki of 270 μM[1].

  

• HY-18062

  Pyrimethamine	58-14-0	99.99%
  Pyrimethamine (Pirimecidan) is a potent, orally active dihydrofolate reductase (DHFR) inhibitor. Pyrimethamine is an antimalarial agent. Pyrimethamine affects the nucleoprotein metabolism of malarial parasites by interference in the folic–folinic acid systems and affects cell division by inhibiting the conversion of dihydrofolate to tetrahydrofolate[1][2].

  

• HY-B1046

  Clofazimine	2030-63-9	99.79%
  Clofazimine is an orally-active anti-mycobacterial agent with a wide range of anti-mycobacterial activity including leprosy and tuberculosis. Clofazimine exerts anti-inflammatory activities and anti-tumor activities by interfering DNA replication and inhibiting IL2 (IC50 = 1.10 ± 0.26 μM, Jurkat T) production. Clofazimine can be used in mycobacterial and cancer research[1][2][3][4][5].

  

• HY-B0712B

  Ceftriaxone sodium salt	74578-69-1	99.90%
  Ceftriaxone sodium salt (Ro 13-9904) is a broad spectrum β-lactam third-generation cephalosporin antibiotic, which has good antibacterial activity against a variety of gram-negative and positive bacteria. Ceftriaxone sodium salt is a covalent inhibitor of GSK3β with IC50 value of 0.78 μM. Ceftriaxone sodium salt is an inhibitor of Aurora B. Ceftriaxone sodium salt has anti-inflammatory, antitumor and antioxidant activities. Ceftriaxone sodium salt can be used in the study of bacterial infections and meningitis[1][2][3][4][5][6][7].

  

• HY-N8461

  Reuterin	2134-29-4
  Reuterin is a broad-spectrum antimicrobial agent active against Gram positive and Gram negative bacteria, as well as yeasts, moulds and protozoa. Reuterin is produced by specific strains of Lactobacillus reuteri during anaerobic metabolism of glycerol. Reuterin also demonstrates potent antimicrobial activity against a broad panel of human and poultry meat campylobacter spp. Isolates[1][2].

  

• HY-B2201

  Citric acid trisodium	68-04-2
  Citric acid trisodium (Sodium citrate) is a natural preservative and food tartness enhancer. Citric acid trisodium induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid trisodium cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid trisodium is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-13553

  Anidulafungin	166663-25-8
  Anidulafungin is a new semisynthetic echinocandin with antifungal potency.

  

• HY-149179

  Polymyxin B	1404-26-8
  Polymyxin B is an antibiotic. Polymyxin B inhibits Gram-negative infections by binding to the LPS of the bacterial wall with high affinity. Polymyxin B neutralizes the effect of endotoxin. Polymyxin B induces bacterial death by increasing its permeability. Polymyxin B is used in endotoxemia research[1][3].

  

• HY-112090

  ABBV-744	2138861-99-9	99.95%
  ABBV-744 is a first-in-class, orally active and selective inhibitor of the BDII domain of BET family proteins with IC50 values ranging from 4 to 18 nM for BRD2, BRD3, BRD4 and BRDT. ABBV-744 is primarily metabolized by CYP3A4 with agent-like properties enable the investigation of its antitumor efficacy and tolerability[1].

  

• HY-13238

  Dolutegravir	1051375-16-6	99.85%
  Dolutegravir (S/GSK1349572) is a highly potent and orally bioavailable HIV integrase strand transfer inhibitor with an IC50 of 2.7 nM for HIV-1 integrase-catalyzed strand transfer. Dolutegravir (S/GSK1349572) inhibits HIV-1 viral replication with an IC50 of 0.51 nM in peripheral blood mononuclear cells. Dolutegravir retains a high potency against the HIV-1 Y143R, N155H, and G140S/Q148H mutants (EC50=3.6-5.8 nM)[1][2].

  

• HY-10241

  Simeprevir	923604-59-5	98.79%
  Simeprevir (TMC435; TMC435350) is an oral, potent and highly specific hepatitis C virus (HCV) NS3/4A protease inhibitor with a Ki of 0.36 nM. Simeprevir inhibits HCV replication with an EC50 of 7.8 nM. Simeprevir also potently suppresses SARS-CoV-2 replication and synergizes with Remdesivir. Simeprevir inhibits the main protease (Mpro) and the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2, and also modulates host immune responses[1][4].

  

• HY-14881A

  Bedaquiline fumarate	845533-86-0
  Bedaquiline fumarate, a diarylquinoline antibiotic that targets ATP synthase, is effective for the treatment of Mycobacterium tuberculosis infections.

  

• HY-N0158

  Oxymatrine	16837-52-8	99.68%
  Oxymatrine, an alkaloid from Sophora flavescens Alt. with anti-inflammatory, antifibrosis, and antitumor effects, inhibits the iNOS expression and TGF-β/Smad pathway. Oxymatrine inhibits bocavirus minute virus of canines (MVC) replication, reduces viral gene expression and decreases apoptosis induced by viral infection[1][2][3][4].

  

• HY-14781

  Levomefolic acid	31690-09-2
  Levomefolic acid (L-5-MTHF) is an orally active, brain-penetrant natural active form of folic acid and is one of the most widely used folic acid food supplements[1][2].

  

• HY-N0717

  L-Valine	72-18-4
  L-Valine (Valine) is a new nonlinear semiorganic material. L-Valine causes lipid peroxidation and accumulation of malondialdehyde (MDA), exhibits inhibitory activity against cyanobacteria. L-Valine inhibits multidrug-resistant bacteria through activation of PI3K/Akt signaling pathway and inhibition of arginase[1][2][3].

  

• HY-N0453

  Hypericin	548-04-9
  Hypericin is a naturally occurring substance found in Hyperlcurn perforatum L. Hypericin is an inhibitor of PKC (protein kinase C), MAO (monoaminoxidase), dopamine-beta-hydroxylase, reverse transcriptase, telomerase and CYP (cytochrome P450). Hypericin shows antitumor, antiviral, antidepressive activities, and can induce apoptosis[1][2][3].

  

• HY-B0441

  Tobramycin	32986-56-4	99.80%
  Tobramycin (Nebramycin Factor 6) is a parenterally administered, broad spectrum aminoglycoside antibiotic that is widely used in the treatment of moderate to severe bacterial infections due to sensitive organisms[1].Tobramycin can be used to pneumonia research caused by Pseudomonas aeruginosa[2][3].

  

• HY-B1620

  Polyvinylpyrrolidone K30	9003-39-8
  Polyvinylpyrrolidone K30 is a compound which has been widely tested and used in human and veterinary medicine as an effective wound healing accelerator and disinfectant when combined with iodine and other compounds.

  

• HY-N0540

  Cynaroside	5373-11-5	99.37%
  Cynaroside (Luteolin 7-glucoside) is a flavonoid compound that exhibits anti-oxidative capabilities. Cynaroside is also a potent influenza RNA-dependent RNA polymerase inhibitor with an IC50 of 32 nM. Cynaroside also is a promising inhibitor for H2O2-induced apoptosis, has cytoprotection against oxidative stress-induced cardiovascular diseases. Cynaroside also has antibacterial, antifungal and anticancer activities, antioxidant and anti-inflammatory activities[1][3][4][5].

  

• HY-13447A

  PF429242 dihydrochloride	2248666-66-0	99.80%
  PF429242 dihydrochloride is a reversible and competitive SREBP site 1 protease (S1P) inhibitor with an IC50 of 175 nM[1].

  

• HY-13735A

  Quinacrine dihydrochloride	69-05-6
  Quinacrine (Mepacrine) dihydrochloride is an orally bioavailable antimalarial agent, which possess anticancer effect both in vitro and vivo. Quinacrine dihydrochloride suppresses NF-κB and activate p53 signaling, which results in the induction of the apoptosis[1].

  

• HY-14136

  Rimonabant	168273-06-1	99.18%
  Rimonabant (SR141716) is a highly potent, brain penetrated and selective central cannabinoid receptor (CB1) antagonist with a Ki of 1.8 nM. Rimonabant (SR141716) also inhibits Mycobacterial membrane protein Large 3 (MMPL3).

  

• HY-N0250

  Saikosaponin D	20874-52-6	98.76%
  Saikosaponin D is a triterpene saponin isolated from Bupleurum, with anti-inflammatory, anti-bacterial, anti-tumor, and anti-allergic activities; Saikosaponin D inhibits selectin, STAT3 and NF-kB and activates estrogen receptor-β.

  

• HY-112258

  IMP-1088	2059148-82-0
  IMP-1088 is a potent human N-myristoyltransferases NMT1 and NMT2 dual inhibitor with IC50s of <1 nM for HsNMT1 and HsNMT2. IMP-1088 has a Kd of <210 pM for HsNMT1. IMP-1088 efficiently blocks rhinovirus replication by blocking rhinovirus virus-encoded protein (VP0) N-myristoylation. IMP-1088 protects host cells from the cytotoxic effects of viral infection[1].

  

• HY-13782

  Tenofovir Disoproxil fumarate	202138-50-9	99.67%
  Tenofovir Disoproxil fumarate is a nucleotide reverse transcriptase inhibitor used to treat HIV and chronic Hepatitis B.

  

• HY-N0716B

  Berberine sulfate	633-66-9
  Berberine sulfate is an alkaloid isolated from the Chinese herbal medicine Huanglian, as an antibiotic. Berberine sulfate induces reactive oxygen species (ROS) generation and inhibits DNA topoisomerase. Berberine sulfate has antineoplastic properties. The sulfate form improves bioavailability[1][2].

  

• HY-N0393

  Glabridin	59870-68-7	99.98%
  Glabridin is a natural isoflavan from Glycyrrhiza glabra L., binds to and activates PPARγ, with an EC50 of 6115 nM. Glabridin exhibits antioxidant, anti-bacterial, anti-nephritic, anti-diabetic, anti-fungal, antitumor, anti-inflammatory, antiosteoporotic, cardiovascular protective, neuroprotective and radical scavenging activities[1][2].

  

• HY-W063968

  RO8191	691868-88-9
  RO8191 (CDM-3008), an imidazonaphthyridine compound, is an orally active and potent interferon (IFN) receptor agonist. RO8191 directly binds to IFNα/β receptor 2 (IFNAR2) and activates IFN-stimulated genes (ISGs) expression and JAK/STAT phosphorylation. RO8191 shows antiviral activity against both HCV and EMCV with an IC50 of 200 nM for HCV replicon[1]. RO8191 is a cccDNA modulator (CDM) through interferon-like activity and has anti-HBV activity[2].

  

• HY-P0025

  NIM811	143205-42-9	99.77%
  NIM811 ((Melle-4)cyclosporin; SDZ NIM811) is an orally bioavailable mitochondrial permeability transition and cyclophilin dual inhibitor, which exhibits potent in vitro activity against hepatitis C virus (HCV) [1][2].

  

• HY-B1329

  Apramycin sulfate	65710-07-8
  Apramycin (EBL 1003) sulfate is an orally active, acidic pH tolerant and aminoglycoside-modifying-enzymes-tolerant aminoglycoside antibiotic which inhibits protein biosynthesis by targeting the bacterial ribosome. Apramycin sulfate is a potential anti-drug-resistance antibiotic[1][2][3].

  

• HY-W013332

  3-Deazaadenosine	6736-58-9
  3-Deazaadenosine is an inhibitor of S-adenosylhomocysteine hydrolase, with a Ki of 3.9 µM; 3-Deazaadenosine has anti-inflammatory, anti-proliferative and anti-HIV activity.

  

• HY-N2302

  Fucoxanthin	3351-86-8
  Fucoxanthin (all-trans-Fucoxanthin) is a marine carotenoid and shows anti-obesity, anti-diabetic, anti-oxidant, anti-inflammatory and anticancer activities[1][2][3][4][5][6][7][8][9].

  

• HY-10353

  Raltegravir	518048-05-0	99.93%
  Raltegravir is a potent integrase (IN) inhibitor, used to treat HIV infection.

  

• HY-P9944

  Palivizumab	188039-54-5	99.43%
  Palivizumab (MEDI 493) is a humanized monoclonal antibody against respiratory syncytial virus (RSV). Palivizumab can bind to RSV F protein with a Kd value of 1.4 nM. Palivizumab can prevent respiratory syncytial virus infection in cotton mice[1].

  

• HY-N1214

  Squalene	111-02-4
  Squalene (Super Squalene) is an intermediate product in the synthesis of cholesterol, and shows several pharmacological properties such as hypolipidemic, hepatoprotective, antiatherosclerotic, cardioprotective, antioxidant, and antitumour activity[1][2].

  

• HY-16742

  Gepotidacin	1075236-89-3	99.92%
  Gepotidacin (GSK2140944) is a novel triazaacenaphthylene bacterial type II topoisomerase inhibitor.

  

• HY-D0020

  2,2'-Bipyridine	366-18-7
  2,2'-Bipyridine is the unique molecular scaffold of the bioactive natural products. 2,2'-Bipyridine is extensively used as the core structure of many chelating ligands by acting as a bridge in the arrangement of the catalytic center. 2,2'-Bipyridine shows robust redox stability and hyperglycemic activity[1][2].

  

• HY-10969

  Obatoclax Mesylate	803712-79-0
  Obatoclax Mesylate (GX15-070 Mesylate), a BH3 mimetic, is a pan-BCL-2 family proteins inhibitor with a Ki of 220 nM for BCL-2[1][2]. Obatoclax Mesylate induces autophagy-dependent cell death and targets cyclin D1 for proteasomal degradation. Obatoclax Mesylate has anti-cancer and broad-spectrum antiparasitic activity[3][4].

  

• HY-B0572

  Zinc Pyrithione	13463-41-7	98.21%
  Zinc Pyrithione is an antifungal and antibacterial agent disrupting membrane transport by blocking the proton pump[1]. Zinc Pyrithione is also a copper ionophore that delivers copper into cells and is a useful tool for studying cuproptosis[2].

  

• HY-P2818

  Alkaline phosphatase, Bovine intestine	9001-78-9
  Alkaline phosphatase, Bovine intestine (Apase) is an orally active membrane-bound glycoprotein that catalyzes the hydrolysis of phosphate monoesters at alkaline pH. Alkaline phosphatase, Bovine intestine reduces myeloperoxidase activity and bacterial translocation. Alkaline phosphatase, Bovine intestine improves survival rate of mice infected with E. coli. Alkaline phosphatase, Bovine intestine improves TNBS-induced colon inflammation[1][2][3][4][5][6].

  

• HY-B1174

  Bekanamycin	4696-76-8
  Bekanamycin (Kanamycin B) is an aminoglycoside antibiotic produced by Streptomyces kanamyceticus, against an array of Gram-positive and Gram-negative bacterial strain[1][2].

  

• HY-N0015

  Astragalin	480-10-4	99.94%
  Astragalin (Astragaline) a flavonoid with anti-inflammatory, antioxidant, anticancer, bacteriostatic activity. Astragalin inhibits cancer cells proliferation and migration, induces apoptosis. Astragalin is orally active and provides nerve and heart protection, and resistance against and osteoporosis[1].

  

• HY-109528

  Fomivirsen sodium	160369-77-7
  Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation[1][2].

  

• HY-A0210

  Cerulenin	17397-89-6
  Cerulenin, a potent, natural inhibitor of fatty acid synthase (FASN), is an epoxide produced by the fungus Cephalosporium caeruleus. Cerulenin inhibits topoisomerase I catalytic activity and augments SN-38-induced apoptosis. Cerulenin has antifungal and antitumor activies[1][2][3][4].

  

• HY-Y0366

  Lauric acid	143-07-7	99.61%
  Lauric acid is a middle chain-free fatty acid with strong bactericidal properties. The EC50s for P. acnes, S.aureus, S. epidermidis, are 2, 6, 4 μg/mL, respectively[1].

  

• HY-106161

  Rupintrivir	223537-30-2
  Rupintrivirvr (AG7088), an antiviral agent, is a potent, selective and irreversible inhibitor of human rhinovirus (HRV) 3C protease. Rupintrivirvr inhibits replication of a panel of 48 different HRV serotypes in H1-HeLA and MRC-5 cell protection assays, with a mean EC50 of 0.023 μM. Rupintrivirvr shows immune-modulatory effect[1][2].

  

• HY-17043

  Loratadine	79794-75-5	99.98%
  Loratadine (SCH-29851) is a selective inverse peripheral histamine H1-receptor agonist with an IC50 of >32 μM. Loratadine has anti-dengue-virus (DENV) activity. Loratadine can inhibit immunologic release of inflammatory mediators.

  

• HY-B0438

  Spectinomycin dihydrochloride	21736-83-4
  Spectinomycin dihydrochloride is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin dihydrochloride acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin dihydrochloride is also a noncompetitive inhibitor of td intron RNA with an Ki value of 7.2 mM[1]-[5].

  

• HY-143216

  Ensitrelvir	2647530-73-0	99.48%
  Ensitrelvir (S-217622) is the first orally active non-covalent, non-peptidic, SARS-CoV-2 3CL protease inhibitor (IC50=13 nM)[1][2].

  

• HY-Y0248A

  Farnesol	4602-84-0	99.88%
  Farnesol is a sesquiterpene alcohol that modulates cell-to-cell communication in Candida albicans, and has the activity in inhibiting bacteria.

  

• HY-B0129

  Aztreonam	78110-38-0	99.64%
  Aztreonam (SQ-26,776) is a synthetic monocyclic beta-lactam antibiotic, which has a very high affinity for penicillin-binding protein 3 (PBP-3).

  

• HY-N0035

  Arctigenin	7770-78-7	99.69%
  Arctigenin ((-)-Arctigenin), a biologically active lignan, can be used as an antitumor agent. Arctigenin exhibits potent antioxidant, anti-inflammatory and antiviral (influenza A virus) activities. Arctigenin can be used for the research of metabolic disorders, and central nervous system dysfunctions[1][2][3].

  

• HY-13623

  Entecavir	142217-69-4	99.98%
  Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.

  

• HY-16594

  Lactacystin	133343-34-7
  Lactacystin is a potent, orally active, irreversible, cell-permeable, selective 20S proteasome inhibitor (IC50 = 4.8 μM). Lactacystin also inhibits the lysosomal enzyme cathepsin A. Lactacystin inhibits cell growth and induces apoptosisand cell cycle arrest, and has antiviral and antioxidative activity. Lactacystin induces neurite outgrowth and hypertension. Lactacystin has the potential for the research of cancer, Neurological Disease, hypertension and Malaria, and so on[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] .

  

• HY-B2230

  Hinokitiol	499-44-5
  Hinokitiol is a component of essential oils isolated from Chymacyparis obtusa, reduces Nrf2 expression, and decreases DNMT1 and UHRF1 mRNA and protein expression, with anti-infective, anti-oxidative, and anti-tumor activities.

  

• HY-113952

  Actinonin	13434-13-4
  Actinonin ((-)-Actinonin) is a naturally occurring antibacterial agent produced by Actinomyces. Actinonin inhibits aminopeptidase M, aminopeptidase N and leucine aminopeptidase. Actinonin is a potent reversible peptide deformylase (PDF) inhibitor with a Ki of 0.28 nM. Actinonin also inhibits MMP-1, MMP-3, MMP-8, MMP-9, and hmeprin α with Ki values of 300 nM, 1,700 nM, 190 nM, 330 nM, and 20 nM, respectively. Actinonin is an apoptosis inducer. Actinonin has antiproliferative and antitumor activities[1][2][3][4][5].

  

• HY-N0401A

  (Z)-Ligustilide	81944-09-4
  (Z)-Ligustilide is extracted from Ligusticum chuanxiong Hort, has antimicrobial and antifungal activity, exhibits an average antifungal score of 5.6[1]. (Z)-Ligustilide is orally active, it inhibits the expression of FATP5 and DGAT, inhibits fatty acid uptake and esterification in mice and has potential as therapeutics for nonalcoholic fatty liver disease (NAFLD) [2]. (Z)-Ligustilide is also able to reactivate ERα, has epigenetic regulation, and is used in the study of tamoxifen-resistant breast cancer[3].

  

• HY-13725

  Pirarubicin	72496-41-4
  Pirarubicin is an anthracycline antibiotics, acts as a topoisomerase II inhibitor, and is a widely used for treatment of various cancers, in particular, solid tumors.

  

• HY-D0143

  Quinine	130-95-0
  Quinine is an alkaloid derived from the bark of the cinchona tree, acts as an anti-malaria agent. Quinine is a potassium channel inhibitor that inhibits WT mouse Slo3 (KCa5.1) channel currents evoked by voltage pulses to +100 mV with an IC50 of 169 μM[1][2].

  

• HY-P3465

  Bulevirtide	2012558-47-1	99.16%
  Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research[1][2].

  

• HY-N0664

  Aucubin	479-98-1
  Aucubin, an iridoid glucoside, is isolated from Plantago asiatica, Eucommia ulmoides, the leaves of Aucuba japonica and more recently from butterfly larva. Aucubin has many biological activities, such as antioxidant, anti-aging, anti-inflammatory, antimicrobial, anti-fibrotic, anti-cancer, hepatoprotective, neuroprotective and osteoprotective effects[1][2][3].

  

• HY-116282C

  Dextran sulfate sodium salt (MW 35000-45000)	9011-18-1
  Dextran sulfate sodium salt (DSS) (MW 35000-45000) is a polymer of dehydrated glucose with a molecular weight of approximately 35000-45000. DSS with different molecular weights exhibits different biological activities. Dextran sulfate sodium salt (DSS) (MW 35000-45000) is a potent inducer of colitis. Dextran sulfate sodium salt (DSS) (MW 35000-45000) can be used to induce model acute colitis, chronic colitis, and colitis-related colon cancer. Dextran sulfate sodium salt (DSS) (MW 35000-45000) may be related to macrophage dysfunction, intestinal flora dysbiosis, and is particularly toxic to the colonic epithelium[1][2][3][4][5].

  

• HY-Y1878C

  Copper sulfate anhydrous, 99%	7758-98-7	99.65%
  Anhydrous copper sulfate, 99% (Cupric sulfate anhydrous, 99%) is an orally administerable disinfectant. Anhydrous copper sulfate, 99% can be used as a biomaterial or organic compound related to life sciences research, and it can increase the Cu content in rat organs[1][2].

  

• HY-19567

  PK 11195	85532-75-8
  PK 11195 (RP 52028) is a ligand of translocator protein (TSPO), which targets Leishmania chemotherapy, with IC50s of 14.2 μM, 8.2 μM, 3.5 μM for L. amazonensis, L. major and L. braziliensis, respectively.

  

• HY-111964

  Lenacapavir	2189684-44-2	98.44%
  Lenacapavir (GS-6207) is a HIV-1 capsid inhibitor. Lenacapavir shows anti-HIV activity with an EC50 of 100 pM in MT-4 cells. Lenacapavir displays a mean EC50 of 50 pM (20-160 pM) against 23 HIV-1 clinical isolates from different subtypes in peripheral blood mononuclear cells (PBMCs)[1]. Lenacapavir is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-B0974

  Methicillin sodium salt	132-92-3
  Methicillin sodium salt (Meticillin sodium) is a β-lactam, semi-synthetic antibiotic related to penicillin antibiotic. Methicillin sodium salt inhibits penicillin-binding proteins involved in the synthesis of peptidoglycan. Methicillin sodium salt inhibits S. aureus with a MIC value of 2.1 μg/mL. Methicillin sodium salt can be used for the research of inflammation[1][2].

  

• HY-P99955

  Rocatinlimab	2431972-52-8	98.81%
  Rocatinlimab (AMG 451) (KHK4083) is a fully human, non-fucosylated, immunoglobulin G1 (IgG1) anti-OX40 monoclonal antibody. Rocatinlimab can be used for the research of atopic dermatitis (AD)[1].

  

• HY-N6719

  Fumonisin B1	116355-83-0
  Fumonisin B1 is a mycotoxin produced from Fusarium moniliforme. Fumonisin B1 is a potent inhibitor of sphingosine N-acyltransferase (ceramide synthase) and disrupts de novo sphingolipid biosynthesis. Fumonisin B1 is the most abundant and toxic fumonisin[1][2].

  

• HY-P1975

  Aureobasidin A	127785-64-2	99.36%
  Aureobasidin A (Basifungin) is a cyclic peptide antibiotic with oral activity. Aureobasidin A is an inhibitor of inositol phosphorylated ceramide synthetase AUR1. Aureobasidin A has antifungal and antiparasitic activity[1][2][3].

  

• HY-15142R

  Doxorubicin (hydrochloride) (Standard)	25316-40-9
  Doxorubicin hydrochloride (Standard) is the analytical standard of Doxorubicin hydrochloride. This product is intended for research and analytical applications. Doxorubicin (Hydroxydaunorubicin) hydrochloride, a cytotoxic anthracycline antibiotic, is an anti-cancer chemotherapy agent. Doxorubicin hydrochloride is a potent human DNA topoisomerase I and topoisomerase II inhibitor with IC50s of 0.8 μM and 2.67 μM, respectively. Doxorubicin hydrochloride reduces basal phosphorylation of AMPK and its downstream target acetyl-CoA carboxylase. Doxorubicin hydrochloride induces apoptosis and autophagy[1][2][3].

  

• HY-N1067

  Xanthohumol	6754-58-1	99.97%
  Xanthohumol is one of the principal flavonoids isolated from hops, the inhibitor of diacylglycerol acetyltransferase (DGAT), COX-1 and COX-2, and shows anti-cancer and anti-angiogenic activities. Xanthohumol also has antiviral activity against bovine viral diarrhea virus (BVDV), rhinovirus, HSV-1, HSV-2 and cytomegalovirus (CMV).

  

• HY-P0163

  Gramicidin	1405-97-6
  Gramicidin is an antimicrobial peptide assembling as channels in membranes and increasing their permeability towards cations.

  

• HY-13630

  Etoposide phosphate	117091-64-2
  Etoposide phosphate (BMY-40481) is a potent anti-cancer chemotherapy agent and a selective topoisomerase II inhibitor to prevent re-ligation of DNA strands. Etoposide phosphate is the phosphate ester proagent of etoposide and is considered as active equivalent to Etoposide. Etoposide phosphate induces cell cycle arrest, apoptosis, and autophagy.

  

• HY-17605

  Bictegravir	1611493-60-7	99.93%
  Bictegravir (GS-9883) is a potent inhibitor of HIV-1 integrase with an IC50 of 7.5 nM.

  

• HY-B0692

  Cefepime	88040-23-7	99.86%
  Cefepime (BMY-28142) is a broad-spectrum and cross the blood-brain barrier cephalosporin. Cefepime shows antibacterial effects against both Gram-positive and Gram-negative aerobic bacteria. Cefepime induces neurotoxicity[1][2][3][4].

  

• HY-N0662

  Amentoflavone	1617-53-4	99.72%
  Amentoflavone (Didemethyl-ginkgetin) is a potent and orally active GABA(A) negative modulator. Amentoflavone also shows anti-inflammatory, antioxidative, anti-viral, anti-tumor, anti-radiation, anti-fungal, antibacterial activity. Amentoflavone induces apoptosis and cell cycle arrest at sub-G1 phase[1][2][3][4].

  

• HY-13605A

  Cytarabine hydrochloride	69-74-9
  Cytarabine hydrochloride, a nucleoside analog, causes S phase cell cycle arrest and inhibits DNA polymerase. Cytarabine inhibits DNA synthesis with an IC50 of 16 nM. Cytarabine hydrochloride has antiviral effects against HSV.

  

• HY-N0637

  Eriodictyol	552-58-9	99.55%
  Eriodictyol is a flavonoid isolated from the Chinese herb, with antioxidant and anti-inflammatory activity. Eriodictyol induces Nrf2 signaling pathway. Eriodictyol is also a potent influenza RNA-dependent RNA polymerase inhibitor with an IC50 of 18 nM.

  

• HY-114364

  UDP-Galactose disodium	137868-52-1	99.42%
  UDP-Galactose disodium is a natural agonist of the P2Y14 receptor with an EC50 of 0.67 μM for the hP2Y14 receptor. UDP-Galactose disodium is a substrate for the transferase beta-1, 4 galactosyltransferase V (B4GALT5). In addition, UDP-Galactose disodium is required for the biosynthesis of several abundant glycoconjugates that form the surface glycocalyx of Leishmania major[1][2][3].

  

• HY-16980A

  Eravacycline dihydrochloride	1334714-66-7	98.98%
  Eravacycline dihydrochloride (TP-434 dihydrochloride) is a potent and broad-spectrum antibacterial agent.

  

• HY-A0088A

  Cefotaxime	63527-52-6	98.69%
  Cefotaxime, a β-lactamase stable cephalosporin and a third-generation cephalosporin antibiotic, possesses broad-spectrum antibiotic activity against numerous Gram-positive and Gram-negative bacteria[1][2][3][4][2].

  

• HY-15789

  Elbasvir	1370468-36-2	99.97%
  Elbasvir (MK-8742) is a hepatitis C virus nonstructural protein 5A (HCV NS5A) inhibitor with EC50s of 4, 3 and 3 nM against genotype 1a, 1b, and 2a, respectively.

  

• HY-B0116

  Stavudine	3056-17-5	99.87%
  Stavudine (d4T) is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Stavudine has activity against HIV-1 and HIV-2. Stavudine also inhibits the replication of mitochondrial DNA (mtDNA). Stavudine reduces NLRP3 inflammasome activation and modulates Amyloid-β autophagy. Stavudine induces apoptosis[1][2][3][4].

  

• HY-A0062

  Telithromycin	191114-48-4	99.96%
  Telithromycin (HMR3647) is a novel ketolide antibiotic that structurally resembles macrolides. Telithromycin belongs to the ketolide family that is characterized by a keto group at position 3 of the macrolide ring and is active against bacteria causing community-acquired pneumonia, acute exacerbation of chronic bronchitis, and acute sinusitis. Telithromycin also has similar immunomodulatory effects as macrolides. Telithromycin can be used for the research of respiratory infections including bronchial asthma[1][2].

  

• HY-N0337

  Eugenol,98% (stabilized with TBC)	97-53-0	99.99%
  Eugenol is an essential oil found in cloves with antibacterial, anthelmintic and antioxidant activity. Eugenol is shown to inhibit lipid peroxidation.

  

• HY-17595

  Mebendazole	31431-39-7	99.88%
  Mebendazole is a highly effective, broad-spectrum antihelmintic against nematode infestations. Mebendazole also exhibits inhibitory effect against glioblastoma multiforme (GBM), inhibits Hedgehog pathway and tubulin polymerization. Mebendazole is orally active and can cross CNS penetration[1][2][3].

  

• HY-B0965

  Thioridazine hydrochloride	130-61-0	99.96%
  Thioridazine hydrochloride, an orally active antagonist of the dopamine receptor D2 family proteins, exhibits potent anti-psychotic and anti-anxiety activities. Thioridazine hydrochloride is also a potent inhibitor of PI3K-Akt-mTOR signaling pathways with anti-angiogenic effect. Thioridazine hydrochloride shows antiproliferative and apoptosis induction effects in various types of cancer cells, with specificity on targeting cancer stem cells (CSCs)[1][2][3][4].

  

• HY-108913

  Nitrocefin	41906-86-9
  Nitrocefin is a highly activated, chromogenic cephalosporin derivative. Nitrocefin is a chromogenic β-lactamase substrate. Nitrocefin undergoes a distinctive color change from yellow to red as the amide bond in the β-lactam ring is hydrolyzed by β-lactamase. Nitrocefin is used in competitive inhibition studies in developmental work on β-lactamase-resistant antibiotics[1][2][3][4].

  

• HY-N6732

  K-252a	99533-80-9
  K-252a, a staurosporine analog, inhibits protein kinase, with IC50 values of 470 nM, 140 nM, 270 nM, and 1.7 nM for PKC, PKA, Ca2+/calmodulin-dependent kinase type II, and phosphorylase kinase, respectively[1][2]. K-252a is a potent inhibitor (IC50 of 3 nM) of the tyrosine protein kinase (TRK) activity of the NGF receptor gp140trk, the product of the trk protooncogene[3].

  

• HY-107201

  β-Cyclodextrin	7585-39-9
  β-Cyclodextrin is a cyclic polysaccharide composed of seven units of glucose (α-D-glucopyranose) linked by α-(1,4) type bonds. β-Cyclodextrin has often been used to enhance the solubility of agents. β-Cyclodextrin has anti-influenza virus H1N1 activities.

  

• HY-P0093

  Sincalide	25126-32-3	99.51%
  Sincalide (Cholecystokinin octapeptide, CCK‐8) is a rapid-acting amino acid polypeptide hormone analogue of cholecystokinin (CCK) for intravenous use in postevacuation cholecystography. CCK‐8 is a major bioactive segment of CCK that retains most of the biological activities of CCK. CCK‐8 can promote gallbladder contraction by injection and helps diagnose gallbladder and pancreas disorders. CCK‐8 can increase bile secretion, cause the gallbladder to contract and relax the sphincter of Oddi, resulting in bile drainage into the duodenum. CCK‐8 is a major bioactive segment of CCK that retains most of the biological activities of CCK[1][2][3].

  

• HY-129065

  Nourseothricin sulfate	96736-11-7
  Nourseothricin sulfate (Streptothricin sulfate) is a broad-spectrum antibiotic that destroys the outer membrane of Gram-negative bacteria and is a dominant selective marker for Fonsecaea pedrosoi[1][2]. Nourseothricin sulfate inhibits protein biosynthesis in prokaryotic cells and strongly inhibits the growth of eukaryotes like fungi and can also be used as a elective marker for a wide range of organisms including bacteria, yeast, filamentous fungi, and plant cells[3].

  

• HY-129555

  Surfactin	252023-70-4
  Surfactin is a potent cyclic lipopeptide biosurfactants consists of four isomers (Surfactin A, B, C and D), which mediates flux of mono-and divalent cations, such as calcium, across lipid bilayer membranes. Surfactin can act as an antimicrobial adjuvant with anti-bacterial, anti-fungal, antimycoplasma and hemolytic effects[1][2]. Surfactin also has antiviral activity against a variety of enveloped viruses[3].

  

• HY-135969

  Glycol chitosan	123938-86-3
  Glycol chitosan is a chitosan derivative with ethylene glycol branches. Glycol chitosan enhances membrane permeability and leadkage in Glycine max Harosoy 63W cells. Glycol chitosan is biocompatible and biodegradable[1][2][3]. Glycol chitosan inhibits E. coli, S. aureus and S. enteritidis growths with MIC values of 4 μg/mL, 32 μg/mL and <0.5 μg/mL, respectively[4].

  

• HY-B0450

  Ciclopirox	29342-05-0	98.25%
  Ciclopirox (HOE296b) is a synthetic and orally active antifungal agent that can be used for superficial mycoses reseaech. Ciclopirox olamine has a very broad spectrum of activity and inhibits dermatophytes, yeasts, molds, and many Gram-positive and Gram-negative species pathogenic. Ciclopirox also has anticancer and anti-inflammatory effect[1][2][3].

  

• HY-14546

  Aripiprazole	129722-12-9	99.95%
  Aripiprazole (OPC-14597), an atypical antipsychotic, is a potent and high-affinity dopamine D2 receptor partial agonist. Aripiprazole is an inverse agonist at 5-HT2B and 5-HT2A receptors and displays partial agonist actions at 5-HT1A, 5-HT2C, D3, and D4 receptors. Aripiprazole can be used for the research of schizophrenia and COVID19[1][2][3][4].

  

• HY-P0027

  Jasplakinolide	102396-24-7
  Jasplakinolide is a potent actin polymerization inducer and stabilizes pre-existing actin filaments. Jasplakinolide binds to F-actin competitively with phalloidin with a Kd of 15 nM. Jasplakinolide, a naturally occurring cyclic peptide from the marine sponge, has both fungicidal and anti-cancer activity[1][2].

  

• HY-13406

  TAK-779	229005-80-5
  TAK-779 is a potent and selective nonpeptide antagonist of CCR5 and CXCR3, with a Ki of 1.1 nM for CCR5, and effectively and selectively inhibits R5 HIV-1, with EC50 and EC90 of 1.2 nM and 5.7 nM, respectively, in MAGI-CCR5 cells.

  

• HY-N1913

  Danshensu	76822-21-4	98.59%
  Danshensu (Dan shen suan A), an orally active phenolic compound, can induce Nrf2/HO-1 activation and inhibition of NF-κB pathway. Danshensu reduces reactive oxygen species (ROS) production, upregulates antioxidant defense mechanism and inhibits intrinsic apoptotic pathway. Danshensu displays a potent antiviral activity against SARS-CoV-2 with EC50 of 0.97 μM. Danshensu has anti-oxidation, anti-apoptosis, anti-lung inflammatory and has the potential for COVID-19, cardiovascular and cerebrovascular diseases research[1][2][3].

  

• HY-100540

  Golgicide A	1139889-93-2
  Golgicide A (GCA) is a potent, highly specific, and reversible inhibitor of the cis-Golgi ADP-ribosylation factor guanine nucleotide exchange factors (ArfGEF) GBF1[1]. Golgicide A drastically reduced replication of coxsackievirus B3 (CVB3) and other human enterovirus species[2].

  

• HY-12404

  Diminazene aceturate	908-54-3
  Diminazene aceturate (Diminazene diaceturate) is an anti-trypanosome agent for livestock. The main biochemical mechanism of the trypanocidal actions of Diminazene aceturate is by binding to trypanosomal kinetoplast DNA (kDNA) in a non-intercalative manner through specific interaction with sites rich in adenine-thymine base pairs. Diminazene aceturate is also an angiotensin-converting enzyme 2 (ACE2) activator and has strong and potent anti-inflammatory properties[1][2][3].

  

• HY-B0334

  Sulbactam	68373-14-8	99.75%
  Sulbactam (CP45899) is a competitive, irreversible beta-lactamase inhibitor. Sulbactam shows antimicrobial activity against multidrug-resistant (MDR) acinetobacter calcoaceticus--Acinetobacter baumannii (Acb) complex[1][2].

  

• HY-16973

  Fluralaner	864731-61-3
  Fluralaner (INN) is a systemic insecticide and acaricide Fluralaner through potent blockage of GABA and L-glutamate gated chloride channels.

  

• HY-101040

  Telacebec	1334719-95-7	99.40%
  Telacebec (Q203) is a midazopyridine amide compound. Telacebec is active against Mycobacterium tuberculosis H37Rv with an MIC50 of 2.7 nM in culture broth medium.

  

• HY-B0307

  Idoxuridine	54-42-2
  Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM[1]. Idoxuridine shows anti-orthopoxvirus activity.

  

• HY-N0462

  Corilagin	23094-69-1	99.96%
  Corilagin, a gallotannin, has anti-tumor, anti-inflammatory and hepatoprotective activities. Corilagin inhibits activity of reverse transcriptase of RNA tumor viruses. Corilagin also inhibits the growth of Staphylococcus aureus with a MIC of 25 μg/mL. Corilagin shows anti-tumor activity on hepatocellular carcinoma and ovarian cancer model. Corilagin shows low toxicity to normal cells and tissues[1][2][3].

  

• HY-111278

  Pyocyanin	85-66-5	99.23%
  Pyocyanin (Pyocyanine) is a toxic, quorum sensing (QS) controlled metabolite produced by Pseudomonas aeruginosa. Pyocyanin is a REDOX active compound that promotes the production of reactive oxygen species (ROS). Pyocyanin has antibacterial and anti-inflammatory activity[1][2][3][4].

  

• HY-D0027

  7-Amino-4-methylcoumarin	26093-31-2	99.91%
  7-Amino-4-methylcoumarin belongs to the coumarin class, can be isolated from the endophytic fungus Xylaria sp. and has a broad spectrum of antibacterial activity. 7-Amino-4-methylcoumarin is also commonly used as an important laser dye that emits in the blue region, capable of analyzing glycoprotein monosaccharides and N-linked oligosaccharides, and is also utilized in tissue pathology analysis, enzyme activity measurement, and copper ion detection. The excitation wavelength and emission wavelength are 351 nm and 430 nm, respectively.[1][2][3][4]

  

• HY-N0054

  Osthole	484-12-8	99.94%
  Osthole (Osthol) is a natural antihistamine alternative. Osthole may be a potential inhibitor of histamine H1 receptor activity. Osthole also suppresses the secretion of HBV in cells.

  

• HY-107193

  Bacitracin	1405-87-4
  Bacitracin is a polypeptide antibiotic against staphylococcal and pathogenic protozoa infections. Bacitracin inhibits cell wall biosynthesis and permeability through binding to the undecaprenyl pyrophosphate. Bacitracin inhibits macromolecular synthesis. Bacitracin is also a protein disulfide isomerase (PDI) inhibitor[1][2][3].

  

• HY-141412

  D-(-)-3-Phosphoglyceric acid disodium	80731-10-8
  D-(-)-3-Phosphoglyceric acid (3-Phospho-D-glyceric acid) disodium is an important intermediate in the enzyme-catalyzed glycolysis process. D-(-)-3-Phosphoglyceric acid disodium competitively inhibits yeast enolase (enolase). D-(-)-3-Phosphoglyceric acid disodium can regulate the activity of phosphoglycerate dehydrogenase (PHGDH) to modulate p53 protein and apoptosis[1][2][3].

  

• HY-B1369A

  Imipenem	64221-86-9	99.83%
  Imipenem (MK0787), a stable crystalline derivative of thienamycin, is an antibiotic and has the excellent activity against a broad range of gram-positive and gram-negative aerobic and anaerobic bacteria. Imipenem can be used for the research of carbapenem-nonsusceptible and P. aeruginosa biofilm infections[1][2][3].

  

• HY-P1568A

  Flagelin 22 TFA
  Flagelin 22 TFA (Flagellin 22 TFA), a fragment of bacterial flagellin, is an effective elicitor in both plants and algae[1][2][3].

  

• HY-14882

  Cenicriviroc	497223-25-3	99.51%
  Cenicriviroc (TAK-652) is an orally active, dual CCR2/CCR5 antagonist, also inhibits both HIV-1 and HIV-2, and displays potent anti-inflammatory and antiinfective activity[1].

  

• HY-17029

  Epothilone B	152044-54-7	99.91%
  Epothilone B is a microtubule stabilizer with a Ki of 0.71μM. It acts by binding to the αβ-tubulin heterodimer subunit which causes decreasing of αβ-tubulin dissociation.

  

• HY-N2143

  Fumitremorgin C	118974-02-0	99.90%
  Fumitremorgin C is a potent and selective ABCG2/BRCP inhibitor.

  

• HY-B0133

  Natamycin	7681-93-8	99.07%
  Natamycin (Pimaricin) is a macrolide antibiotic agent produced by several Streptomyces strains. Natamycin inhibits the growth of fungi via inhibition of amino acid and glucose transport across the plasma membrane. Natamycin is a food preservative, an antifungal agent in agriculture, and is widely used for fungal keratitis research[1][2].

  

• HY-13666

  Levamisole hydrochloride	16595-80-5	99.87%
  Levamisole ((-)-Tetramisole) hydrochloride is an anthelmintic and immunomodulator belonging to a class of synthetic imidazothiazole derivatives. Levamisole hydrochloride has antiviral effects against HSV.

  

• HY-N0794

  Proanthocyanidins	20347-71-1
  Proanthocyanidin (Procyanidin) are a class of polyphenolic that are widely distributed in higher plants, consisted of an electrophilic flavanyl unit. Proanthocyanidin can be used as antioxidant and anti-cancers agent. Proanthocyanidin also exhibit anti-inflammatory, cardioprotective, antibacterial and antifungal properties, which can be used in the treatment of chronic venous insufficiency, capillary fragility, sunburn and retinopathy.[1].

  

• HY-136205

  IA-Alkyne	930800-38-7
  IA-Alkyne (Iodoacetamide-alkyne; N-Hex-5-ynyl-2-iodo-acetamide) is a TRP channel (TRPC) agonist and has the potential for the study of respiratory infection[1]. IA-Alkyne can be used to develop an isotopically tagged probe for quantitative cysteine-reactivity profiling[2]. IA-Alkyne is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-B1119

  Triclosan	3380-34-5
  Triclosan is a broad-spectrum antibacterial agent that inhibits bacterial fatty acid synthesis at the enoyl-acyl carrier protein reductase (FabI) step. Triclosan inhibits E. coli enoyl-acyl carrier protein reductase (FabI) and FabI containing a glycine-to-valine substitution at position 93 (FabIG93V) with IC50s of 2 µM and 10 µM, respectively. Triclosan causes apoptotic effect in cultured rat neural stem cells (NSC). Triclosan exacerbates colitis and colitis-associated colorectal tumorigenesis in animal models[1][2][3].

  

• HY-B1218

  Sulfaphenazole	526-08-9
  Sulfaphenazole is a selective inhibitor of human cytochrome P450 (CYP) 2C9 enzyme. Sulfaphenazole is a cytoprotective agent against light-induced death of photoreceptors. Sulfaphenazole inhibits light-induced necrosis and mitochondrial stress-initiated apoptosis. Sulfaphenazole is an off patent sulfonamide antibiotic and demonstrates bactericidal activity through enhanced M1 macrophage activity. Sulfaphenazole can significantly reduce infarct size and restore post-ischemic coronary flow following ischemia and reperfusion[1][2][3].

  

• HY-N0575

  Pinocembrin	480-39-7	99.67%
  Pinocembrin ((+)-Pinocoembrin) is a flavonoid found in propolis, acts as a competitive inhibitor of histidine decarboxylase, and is an effective anti-allergic agent, with antioxidant, antimicrobial and anti-inflammatory properties[1].

  

• HY-N6707

  Triacsin C	76896-80-5
  Triacsin C (WS 1228A), is an orally active and intracellular long-chain acyl-CoA synthetases (ACSL) inhibitor, which can be isolated from Streptomyces aureofaciens. Triacsin C inhibits TAG accumulation into lipid droplets (LD) by suppressing ACSL activity[1]. Triacsin C exhibits highly inhibitory effect against rotavirus replication[2].

  

• HY-15592

  Cabotegravir	1051375-10-0	99.91%
  Cabotegravir (GSK-1265744) is a orally active and long-acting HIV integrase strand transfer inhibitor and organic anion transporter 1/3 (OAT1/OAT3) inhibitor with IC50 values of 2.5 nM, 0.41 μM and 0.81 μM for HIVADA, OAT3 and OAT1, respectively. Cabotegravir is primarily metabolized by uridine diphosphate glucuronosyltransferase (UGT) 1A1, with low potential to interact with other antiretroviral agents (ARVs). Cabotegravir can be used to research AIDS[1][2].

  

• HY-10493

  Cobicistat	1004316-88-4	99.77%
  Cobicistat is a potent and selective inhibitor of cytochrome P450 3A (CYP3A) enzymes with IC50s of 30-285 nM. Cobicistat is a pharmacokinetic enhancer which increases the overall absorption of several HIV medications.

  

• HY-120859

  Zidebactam	1436861-97-0
  Zidebactam (WCK-5107) is a potent β-lactamase inhibitor[1]. Zidebactam also is a penicillin-binding protein2 (PBP2) inhibitor with an IC50 of 0.26 μg/mL[2].

  

• HY-B0030

  D-Cycloserine	68-41-7
  D-Cycloserine is an antibiotic which targets sequential bacterial cell wall peptidoglycan biosynthesis enzymes. D-Cycloserine is a partial NMDA agonist that can improve cognitive functions. D-Cycloserine can be used for multidrug-resistant tuberculosis research[1][2].

  

• HY-N2364

  Arecoline	63-75-2	99.84%
  Arecoline, a naturally occurring psychoactive alkaloid, is a partial agonist of nicotinic and muscarinic acetylcholine receptor. Arecoline exhibits stimulation, alertness, anxiolysis and anti-parasitic effects. Arecoline also can induce oxidative stress[1][2][3][4].

  

• HY-N7073

  Silymarin	65666-07-1
  Silymarin is an extract of the milk thistle (Silybum marianum). Silymarin is an effective SARS-CoV-2 main protease (Mpro) inhibitor. Silymarin can significantly reduce tumor cell proliferation, angiogenesis as well as insulin resistance. Silymarin has the chemopreventive effect on hepatocellular carcinoma (HCC). Silymarin has the potential for COVID-19 research[1][2][4].

  

• HY-P1122

  Cyclosporin H	83602-39-5	99.43%
  Cyclosporin H is a selective and potent inhibitor of FPR-1 (formyl peptide receptor 1). Cyclosporin H, a viral transduction enhancer, increases lentiviral transduction up to 10-fold in human cord blood-derived hematopoietic stem and progenitor cells (HSPCs). Cyclosporin H displays an additive effect when combined with Rapamycin (HY-10219) or Prostaglandin E2 (HY-101952). Cyclosporin H lacks immunosuppressant activity of Cyclosporin A.

  

• HY-116961

  TH1020	1841460-82-9	99.81%
  TH1020 is a potent and selective toll-like receptor 5 (TLR5)/flagellin complex antagonist with an IC50 of 0.85 μM. TH1020 inhbits flagellin-induced TLR5 signaling. TH1020 is inactive against TLR2, TLR3, TLR4, TLR7 and TLR8[1].

  

• HY-D0190

  2-Thenoyltrifluoroacetone	326-91-0
  2-Theoyltrifluoroacetone is a chelating agent and mitochondrial electron transfer chain inhibitor, with a IC50 value of 51.5 μM. 2-Thermoyltrifluoroacetone can chelate with various metal ions and has cytotoxicity and anti-tumor activity, which is expected to play an important role in the treatment of mitochondrial dysfunction related diseases[1][2][3].

  

• HY-70072

  D609	83373-60-8
  D609, an antitumoural xanthate, is a specific and competitive phosphatidyl choline-specific phospholipase C (PC-PLC) inhibitor with a Ki of 6.4 μM. D609 is an antioxidative protector and has antiviral and anti-inflammatory activity[1][2][3].

  

• HY-B0223

  Albendazole	54965-21-8
  Albendazole (SKF-62979) is an orally active and broad-spectrum parasiticide with high effectiveness and low host toxicity, is used for the research of gastrointestinal parasites in humans and animals. Albendazole induces apoptosis and autophagy in cancer cells. Albendazole also inhibits tubulin polymerization and HIF-1α, VEGF expression, has antioxidant activity, and inhibits the glycolytic process in cancer cells[1][2][3][4][5].

  

• HY-N0492

  α-Lipoic Acid	1077-28-7
  α-Lipoic Acid (Thioctic acid) is an antioxidant, which is an essential cofactor of mitochondrial enzyme complexes. α-Lipoic Acid inhibits NF-κB-dependent HIV-1 LTR activation[1][2][3]. α-Lipoic Acid induces endoplasmic reticulum (ER) stress-mediated apoptosis in hepatoma cells[4]. α-Lipoic Acid can be used with CPUL1 (HY-151802) to construct the self-assembled nanoaggregate CPUL1-LA NA, which has improved antitumor efficacy than CPUL1[5].

  

• HY-122575

  Aurintricarboxylic acid	4431-00-9
  Aurintricarboxylic acid is a nanomolar-potency, allosteric antagonist with selectivity towards αβ-methylene-ATP-sensitive P2X1Rs and P2X3Rs, with IC50s of 8.6 nM and 72.9 nM for rP2X1R and rP2X3R, respectively[1]. Aurintricarboxylic acid is a potent anti-influenza agent by directly inhibiting the neuraminidase[2]. Aurintricarboxylic acid is an inhibitor of topoisomerase II and apoptosis[3]. Aurintricarboxylic acid is a selective inhibitor of the TWEAK-Fn14 signaling pathway[4]. Aurintricarboxylic acid also acts as a cystathionine-lyase (CSE) inhibitor with an IC50 of 0.6 μM[5]. Aurintricarboxylic acid is a modifier of miRNAs that regulate miRNA function, with an IC50 of 0.47 µM[6].

  

• HY-N0820

  Catalpol	2415-24-9
  Catalpol (Catalpinoside), an iridoid glycoside found in Rehmannia glutinosa. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects[1][2][3].

  

• HY-N0674

  Dehydrocorydaline	30045-16-0	99.77%
  Dehydrocorydaline (13-Methylpalmatine) is an alkaloid that regulates protein expression of Bax, Bcl-2; activates caspase-7, caspase-8, and inactivates PARP[1]. Dehydrocorydaline elevates p38 MAPK activation. Anti-inflammatory and anti-cancer activities[2]. Dehydrocorydaline shows strong anti-malarial effects (IC50=38 nM), and low cytotoxicity (cell viability > 90%) using P. falciparum 3D7 strain[3].

  

• HY-P1748

  Thermolysin, Bacillus thermoproteolyticus rokko	9073-78-3
  Thermolysin, Bacillus thermoproteolyticus rokko (EC 3.4.24.27) (TML) is a thermostable neutral metalloproteinase enzyme secreted by the Gram-positive bacteria Bacillus thermoproteolyticus. Thermolysin catalyzes the hydrolysis of peptide bonds containing hydrophobic residues[1]. Optimal pH: 8.0. Considerably stable from pH 5 to 9.5. Optimal temperature : 70 °C

  

• HY-W012875

  3-Nitropropanoic acid	504-88-1
  3-Nitropropanoic acid (β-Nitropropionic acid) is an irreversible and orally active inhibitor of succinate dehydrogenase. 3-Nitropropanoic acid exhibits potent antimycobacterial activity with a MIC value of 3.3 μM. 3-Nitropropanoic acid can induce cell apoptosis[1][2].

  

• HY-N0108

  Physcion	521-61-9
  Physcion (Parietin), an anthraquinone derivative derived from the traditional Chinese medicine rhubarb, is an effective oral active 6-phosphogluconate dehydrogenase inhibitor with blood-brain barrier permeability, with IC50 and Kd values of 38.5 μM and 26.0 μM, respectively. Additionally, Physcion is an inhibitor of the <>bTLR4/NF-κB signaling pathway, exhibiting anti-inflammatory, antibacterial, and anticancer effects, and can induce Apoptosis and Autophagy in cancer cells[1][2][3][4][5].

  

• HY-15232

  Tenofovir alafenamide	379270-37-8	99.92%
  Tenofovir alafenamide (GS-7340) is an investigational oral proagent of Tenofovir. Tenofovir is a HIV-1 nucleotide reverse transcriptase inhibitor.

  

• HY-B1207

  Urethane	51-79-6
  Urethane (Ethyl carbamate), the ethyl ester of carbamic acid, is a byproduct of fermentation found in various food products. Urethane has the ability to suppress bacterial, protozoal, sea urchin egg, and plant tissue growth in vitro[1].

  

• HY-B1825

  Cefoxitin	35607-66-0	99.84%
  Cefoxitin is a cephalosporin-class antibiotic. Cefoxitin is highly stable against β-Lactamase (HY-P2998). Cefoxitin has a broad spectrum of antibacterial activity, including Gram-negative and Gram-positive bacteria[1][2][3].

  

• HY-N0622

  Morusin	62596-29-6
  Morusin is a prenylated flavonoid isolated from Morus alba Linn. with various biological activities, such as antitumor, antioxidant, and anti-bacteria property. Morusin could inhibit NF-κB and STAT3 activity.

  

• HY-N6735

  Apicidin	183506-66-3
  Apicidin (OSI 2040) is a fungal metabolite, acts as an orally active histone deacetylase 7/8 (HDAC7/8) inhibitor, with antiparasitic activity and a broad spectrum antiproliferative activity. Apicidin can be used for cancer research[1][2][3][4].

  

• HY-12651A

  Primaquine	90-34-6	98.85%
  Primaquine is a potent antimalaria agent and a potent gametocytocide in falciparum malaria. Primaquine prevents relapse in vivax and ovale malaria[1][2].

  

• HY-107202A

  Poly (I:C):Kanamycin (1:1)
  Poly (I:C):Kanamycin (1:1) is a mixture of poly (I:C) and kanamycin. Poly(I:C) is a synthetic double-stranded RNA (dsRNA), which is a Toll-like receptor 3 (TLR3) agonist. Kanamycin is positively charged (poly-NH3) and can thus neutralize the negative charge of Poly I:C and thereby stabilized the molecule.

  

• HY-109142

  Ziresovir	1422500-60-4
  Ziresovir (AK0529;RO-0529) is a potent, selective, and orally bioavailable respiratory syncytial virus (RSV) fusion (F) protein (RSV F) protein inhibitor. Ziresovir shows anti-RSV activity (EC50=3 nM) and highlights pharmacokinetics in animal species[1].

  

• HY-33037

  Phenazine-1-carboxylic acid	2538-68-3
  Phenazine-1-carboxylic acid is an antifungal agent. Additionally, Phenazine-1-carboxylic acid exhibits anticancer activity by inducing apoptosis in cancer cells through the regulation of ROS generation. Phenazine-1-carboxylic acid can upregulate the expression of IL-8 and ICAM-1 while inhibiting the release of RANTES and MCP-1, demonstrating its potential immunomodulatory effects. Phenazine-1-carboxylic acid holds significant research value in the areas of anti-infection, anticancer, and immune response modulation[1][2][3][4].

  

• HY-I0660

  Picolinic acid	98-98-6
  Picolinic acid (PCL 016) is a topical antiviral agent, which inhibits adenovirus replication in rabbits.

  

• HY-N1992

  Theaflavin 3,3'-digallate	30462-35-2	99.73%
  Theaflavin 3,3'-digallate (TF-3) is a potent Zika virus (ZIKV) protease inhibitor with an IC50 of 2.3 μM. Theaflavin 3,3'-digallat directly binds to ZIKVpro (Kd=8.86 μM) and inhibits ZIKV replication. Theaflavin 3,3'-digallat inhibits the activity of gp41 and NS2B-3 protease and has antiviral activity against HSV and HIV-1[1]. Theaflavin 3,3'-digallate, the typical pigment in black tea, is a potent antitumor agent[2].

  

• HY-P0052

  Enfuvirtide	159519-65-0	99.93%
  Enfuvirtide (T20;DP178) is an anti-HIV-1 fusion inhibitor peptide.

  

• HY-103160A

  EHNA hydrochloride	58337-38-5
  EHNA hydrochloride is a potent and selective dual inhibitor of cyclic nucleotide phosphodiesterase 2 (PDE2)(IC50=4 μM) and adenosine deaminase (ADA). EHNA hydrochloride exerts a concentration inhibition of the cGMP-stimulated PDE II (cGs-PDE)(IC50:0.8 μM (human), 2 μM (porcine myocardium)), but has smaller inhibitory effect on the unstimulated PDE2 activity. EHNA hydrochloride play roles in mediating diverse pharmacological responses, including antiviral, antitumour and antiarrhythmic effects[1][2].

  

• HY-W094474

  Lithium chloride hydrate	85144-11-2	98.65%
  Lithium chloride hydrate, an orally active mood stabilizer, is a potent virus inhibitor and effective immunomodulatory agent. Lithium chloride hydrate has antidepressant activity by inhibiting GSK3β and promoting neurogenesis. Lithium chloride hydrate alleviates cognition dysfunction and the symptoms of acute mania and depression. Lithium chloride hydrate can also be used for research of virus infection and Alzheimer's disease[1][2][3].

  

• HY-10574

  Rilpivirine	500287-72-9	99.25%
  Rilpivirine (R278474) is a potent and specific diarylpyrimidine (DAPY) non-nucleoside reverse transcriptase inhibitor (NNRTI). Rilpivirine has high antiviral activity against wild-type HIV (EC50=0.4 nM) and mutant viruses (EC50=0.1-2.0 nM). Rilpivirine has a high genetic barrier to resistance development of HIV[1][2].

  

• HY-14137

  Rimonabant Hydrochloride	158681-13-1	99.79%
  Rimonabant Hydrochloride (SR 141716A Hydrochloride) is a highly potent and selective central cannabinoid receptor (CB1) antagonist with an Ki of 1.8 nM. Rimonabant Hydrochloride (SR 141716A Hydrochloride) also inhibits Mycobacterial membrane protein Large 3 (MMPL3).

  

• HY-B0502

  Enrofloxacin	93106-60-6	99.83%
  Enrofloxacin (BAY Vp 2674) is an effective antibiotic with an MIC90 of 0.312 μg/mL for Mycoplasma bovis.

  

• HY-N6810

  Thymol	89-83-8	99.97%
  Thymol is a TRPA1 agonist. Thymol induces cancer cell apoptosis. Thymol is the main monoterpene phenol occurring in essential oils isolated from plants belonging to the Lamiaceae family, and other plants such as those belonging to the Verbenaceae, Scrophulariaceae, Ranunculaceae and Apiaceae families. Thymol has antioxidant, anti-inflammatory, antibacterial and antifungal effects[1].

  

• HY-W001132

  Indole	120-72-9	99.99%
  Indole is an aromatic, heterocyclic, organic compound which widely distributed in the natural environment and can be produced by a variety of bacteria. Indole regulates various aspects of bacterial physiology, including spore formation, plasmid stability, resistance to drugs, biofilm formation, and virulence as an intercellular signal molecule[1].

  

• HY-17591

  Penicillin G potassium	113-98-4
  Penicillin G potassium is a fast-acting penicillin family antibiotic. Penicillin G potassium can be used for the research of bacterial infections that affect the blood, heart, lungs, joints, and genital areas[1][2].

  

• HY-N1415

  β-Caryophyllene	87-44-5
  β-Caryophyllene is a CB2 receptor agonist.

  

• HY-P2260

  Tat-beclin 1	1423821-88-8	99.93%
  Tat-beclin 1, a peptide derived from a region of the autophagy protein (beclin 1), is a potent inducer of autophagy and interacts with negative regulator of autophagy, GAPR-1 (GLIPR2). Tat-beclin 1 decreases the accumulation of polyglutamine expansion protein aggregates and the replication of several pathogens (including HIV-1) in vitro, and reduces mortality in mice infected with chikungunya (CHIKV) or West Nile virus (WNV)[1].

  

• HY-153810

  Mosnodenvir	2890688-86-3	99.94%
  Mosnodenvir (JNJ-1802) is an orally active pan serotype dengue virus (DENV) inhibitor, with EC50 values ranging from 0.057 to 11 nM for four dengue virus (DENV) serotypes. Mosnodenvir blocks viral replication by inhibiting the formation of complexes between two viral proteins, nonstructural protein 3 (NS3) and NS4B, thereby preventing the formation of new viral RNA. Mosnodenvir exhibits picomolar to nanomolar antiviral activity in vitro and has antiviral efficacy in mice and non-human primates[1][2].

  

• HY-17437A

  Mefloquine hydrochloride	51773-92-3	99.98%
  Mefloquine hydrochloride (Mefloquin hydrochloride), a quinoline antimalarial agent, is an anti-SARS-CoV-2 entry inhibitor. Mefloquine hydrochloride is also a K+ channel (KvQT1/minK) antagonist with an IC50 of ~1 μM. Mefloquine hydrochloride can be used for malaria, systemic lupus erythematosus and cancer research[1][2][3].

  

• HY-N1372A

  Fangchinoline	436-77-1	99.92%
  Fangchinoline is isolated from Stephania tetrandra with extensive biological activities, such as enhancing immunity, anti-inflammatory sterilization and anti-atherosclerosis. Fangchinoline, a novel HIV-1 inhibitor, inhibits HIV-1 replication by impairing gp160 proteolytic processing[1]. Fangchinoline targets Focal adhesion kinase (FAK) and suppresses FAK-mediated signaling pathway in tumor cells which highly expressed FAK[2]. Fangchinoline induces apoptosis and adaptive autophagy in bladder cancer[3].

  

• HY-W011303

  Phytosphingosine	554-62-1
  Phytosphingosine is a phospholipid with anti-inflammatory, antibacterial, and anti-cancer activities, which can induce apoptosis. Phytosphingosine is an immune regulator and can be used in the study of inflammatory skin diseases. Phytosphingosine is also an activator of GPR120 with an IC50 value of 33.4 μM and can be used in the study of type II diabetes[1][2][3][4].

  

• HY-P1222A

  LL-37, human TFA		99.78%
  LL-37, human TFA is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human TFA could help protect the cornea from infection and modulates wound healing[1][2][3].

  

• HY-17580

  Fidaxomicin	873857-62-6	99.85%
  Fidaxomicin (OPT-80), a macrocyclic antibiotic, is an orally active and potent RNA polymerase inhibitor. Fidaxomicin has a narrow spectrum of antibacterial activity and a good anti-Clostridium difficile activity (MIC90=0.12 μg/mL). Fidaxomicin can be used for Clostridium difficile infection (CDI) research[1][2][3].

  

• HY-P2329

  Lysostaphin	9011-93-2
  Lysostaphin is an antistaphylococcal agent. Lysostaphin has activities of three enzymes namely, glycylglycine endopeptidase, endo-β-N-acetyl glucosamidase and N-acteyl muramyl-L-alanine amidase[1].

  

• HY-111022

  Icerguastat	951441-04-6	99.93%
  Icerguastat (Sephin1), a derivative of Guanabenz lacking the α2-adrenergic activity, is a selective inhibitor of the phosphatase regulatory subunit PPP1R15A (R15A). Icerguastat inhibits eIF2α dephosphorylation, thereby prolonging the protective response. Anti-prion effect[1][2][3].

  

• HY-B0450A

  Ciclopirox olamine	41621-49-2	99.78%
  Ciclopirox olamine (Ciclopirox ethanolamine) is a synthetic and orally active antifungal agent that can be used for superficial mycoses reseaech. Ciclopirox olamine has a very broad spectrum of activity and inhibits dermatophytes, yeasts, molds, and many Gram-positive and Gram-negative species pathogenic. Ciclopirox olamine also has anticancer and anti-inflammatory effect[1][2][3].

  

• HY-14805

  Tecovirimat	869572-92-9	99.88%
  Tecovirimat (ST-246) is an orally bioavailable and selective compound against orthopoxviruses including vaccinia, monkeypox, camelpox, cowpox, ectromelia (mousepox), smallpox and variola viruses. Tecovirimat is evaluated against vaccinia, cowpox virus, ectromelia virus with EC50 values of 0.01 μM, 0.48 μM and 0.05 μM, respectively. Tecovirimat targets the orthopoxvirus protein VP37 which is necessary for membrane envelopment of intracellular mature virus particles to form enveloped virus. Tecovirimat exerts antiviral activity on the target of the cowpox virus V061 gene, which is homologous to vaccinia virus F13L, encoding a major envelope protein (p37) required for production of extracellular virus[1][2][3][4][5].

  

• HY-B1747

  Pyrithione	1121-30-8	99.75%
  Pyrithione, a Transition metal complexe, is a zinc ionophore that causes increased zinc levels within mammalian cells. Pyrithione has potent bactericidal and anti-fungal activity[1][2].

  

• HY-108881

  Troleandomycin	2751-09-9
  Troleandomycin (Triacetyloleandomycin), a macrolide acrolide antibiotic, is a selective CYP3A inhibitor. Troleandomycin is an oral corticosteroid for asthma study[1][2][3].

  

• HY-14654R

  Aspirin (Standard)	50-78-2	99.85%
  Aspirin (Standard) is the analytical standard of Aspirin. This product is intended for research and analytical applications. Aspirin (Acetylsalicylic Acid) is an orally active, potent and irreversible inhibitor of cyclooxygenase COX-1 and COX-2, with IC50 values of 5 and 210 μg/mL, respectively. Aspirin induces apoptosis. Aspirin inhibits the activation of NF-κB. Aspirin also inhibits platelet prostaglandin synthetase, and can prevent coronary artery and cerebrovascular thrombosis[1][2][3][4][5][6].

  

• HY-W016420

  Fosfomycin sodium	26016-99-9
  Fosfomycin (MK-0955) sodium is a blood-brain barrier penetrating, broad-spectrum antibiotic by irreversibly inhibiting an early stage in cell wall synthesis. Fosfomycin sodium shows both in vivo and in vitro activity against a wide range of bacteria, including multidrug-resistant (MDR), extensively drug-resistant (XDR), and pan-drug-resistant (PDR) bacteria[1][2].

  

• HY-15407

  Sacubitril	149709-62-6
  Sacubitril (AHU-377) is a potent and orally active NEP (neprilysin) inhibitor with an IC50 of 5 nM. Sacubitril is a component of the heart failure medicine LCZ696. Sacubitril can be used for the research of heart failure, hypertension and COVID-19[1][2][3].

  

• HY-17423

  Abacavir	136470-78-5	98.97%
  Abacavir is an orally active and competitive nucleoside reverse transcriptase inhibitor. Abacavir can inhibits the replication of HIV. Abacavir shows anticancer activity in prostate cancer cell lines. Abacavir can trespass the blood-brain-barrier and suppresses telomerase activity[1][2][3].

  

• HY-117974

  Durlobactam sodium	1467157-21-6	99.62%
  Durlobactam sodium salt (ETX2514) is a broad-spectrum β-lactamase inhibitor with IC50s of 4, 14 and 190 nM for Class A KPC-2, Class C AmpC and Class D OXA-24, respectively. For the treatment of drug-resistant Gram-negative bacteria including Acinetobacter baumannii[1].

  

• HY-14855

  Tedizolid	856866-72-3	99.03%
  Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.

  

• HY-B1418

  Tazobactam	89786-04-9
  Tazobactam (CL-298741) is a potent β-lactamases inhibitor and penicillin antibiotic. Tazobactam has antibacterial activity. Tazobactam can be used for pneumonia research[1][2].

  

• HY-D0803

  Thymoquinone	490-91-5
  Thymoquinone is an orally active natural product isolated from N. sativa Thymoquinone down-regulates the VEGFR2-PI3K-Akt pathway. Thymoquinone has antioxidant, anti-inflammatory, anticancer, antiviral, anticonvulsant, antifungal, antiviral, antiangiogenic activity and hepatoprotective effects. Thymoquinone can be used to study Alzheimer's disease, cancer, cardiovascular disease, infectious disease and inflammation [1][2][3][4][5].

  

• HY-N0110

  Palmatine chloride	10605-02-4	99.81%
  Palmatine chloride is an orally active and irreversible indoleamine 2,3-dioxygenase 1 (IDO-1) inhibitor with IC50s of 3 μM and 157μM against HEK 293-hIDO-1 and rhIDO-1, respectively. Palmatine chloride can also inhibit West Nile virus (WNV) NS2B-NS3 protease in an uncompetitive manner with an IC50 of 96 μM. Palmatine chloride shows anti-cancer, anti-oxidation, anti-inflammatory, neuroprotection, antibacterial, anti-viral activities[1][2][3][4][5].

  

• HY-N0708

  Vanillic acid	121-34-6
  Vanillic acid is a flavoring agent found in edible plants and fruits, also found in Angelica sinensis. Vanillic acid inhibits NF-κB activation. Anti-inflammatory, antibacterial, and chemopreventive effects[1].

  

• HY-N0709

  Coumarin	91-64-5	99.80%
  Coumarin is a potent and orally active anti-inflammatory agent. Coumarin shows an antinociceptive effect. Coumarin shows antibacterial, antifungal and anticancer activity[1][2].

  

• HY-P1934

  Cyclo(Phe-Pro)	14705-60-3	98.77%
  Cyclo(Phe-Pro) (Cyclo(phenylalanylprolyl)) is a quorum-sensing molecule of Vibrio vulnificus that specifically interacts with RIG-I, inhibiting RIG-I polyubiquitination, suppressing IRF-3 activation, and reducing type I interferon production. Cyclo(Phe-Pro) enhances susceptibility to HCV and influenza virus and also alleviates plant aluminum toxicity stress. The mechanism of Cyclo(Phe-Pro) involves the regulation of host immune signaling pathways, bacterial virulence gene expression, and plant antioxidant systems, making it a promising candidate for research in viral infections, bacterial virulence regulation, and agricultural stress resistance[1][2][3].

  

• HY-B0408A

  Clindamycin hydrochloride	21462-39-5	98.22%
  Clindamycin (hydrochloride) is a semisynthetic lincosamide antibiotic, which inhibits protein synthesis by acting on the 50S ribosomal.

  

• HY-151642A

  3-Azido-D-alanine hydrochloride	1379690-01-3	99.13%
  3-Azido-D-alanine hydrochloride is an azido-modified D-alanine (HY-41700) hydrochloride. 3-Azido-D-alanine hydrochloride can be used in the research of click chemistry labeling[1]. It contains an azide group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing alkyne groups. It can also undergo ring strain-promoted alkyne-azide cycloaddition (SPAAC) with molecules containing DBCO or BCN groups.

  

• HY-12957

  NITD008	1044589-82-3
  NITD008 is a potent and selective flaviviruse inhibitor which can inhibit Dengue Virus Type 2 (DENV-2) with an EC50 of 0.64 μM. NITD008 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-17634

  Glecaprevir	1365970-03-1	99.93%
  Glecaprevir is a novel HCV NS3/4A protease inhibitor, with IC50 values ranging from 3.5 to 11.3 nM. Glecaprevir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 4.09 μM[2].

  

• HY-12882A

  Ifenprodil tartrate	23210-58-4	99.95%
  Ifenprodil (NP-120) tartrate, a cerebral vasodilator, is a noncompetitive NMDA receptor antagonist. Ifenprodil tartrate exerts high affinity at NR1A/NR2B receptors (IC50=0.34 μM) over 400-fold than at NR1A/NR2A receptors (IC50=146 μM)[1]. Ifenprodil tartrate is an α1 adrenergic receptor antagonist. Ifenprodil tartrate inhibits GIRK (Kir3), reduces inward currents through the basal GIRK activity. Ifenprodil tartrate has reliable inhibitory effects against A/H1N1 strains (EC50 of 6.6 µM). Ifenprodil tartrate has neuroprotective, anticonvulsant and antinociceptive effects. Ifenprodil tartrate can be used for the study of cerebrovascular diseases and peripheral arterial obliterative disease[2][4].

  

• HY-17040

  Darunavir	206361-99-1	99.91%
  Darunavir (TMC114), an orally active next generation HIV protease inhibitor, has a similar antiviral activity against the mutant and the wild-type viruses. Darunavir (TMC114) is potent against laboratory HIV-1 strains and primary clinical isolates (IC50 = 0.003 μM; IC90 = 0.009 μM) with minimal cytotoxicity[1][2].

  

• HY-117043

  GRL0617	1093070-16-6	99.62%
  GRL0617 is a selective and competitive noncovalent inhibitor of severe acute respiratory syndrome (SARS-CoV) papain-like protease (PLpro), with an IC50 of 0.6 μM and a Ki value of 0.49 μM. GRL0617 also inhibits SARS-CoV with an EC50 of 14.5 μM. GRL0617 can be used for the research of severe acute respiratory syndrome[1].

  

• HY-B0271

  Pyrazinamide	98-96-4
  Pyrazinamide (Pyrazinecarboxamide; Pyrazinoic acid amide) is a potent and orally active antitubercular antibiotic. Pyrazinamide is a proagent that is converted to the active form pyrazinoic acid (POA) by PZase/nicotinamidase encoded by the pncA gene in M. tuberculosis.

  

• HY-N0057

  3,4-Dicaffeoylquinic acid	14534-61-3	98.64%
  3,4-Dicaffeoylquinic acid (3,4-Di-O-caffeoylquinic acid), naturally isolated from Laggera alata, has antioxidative, DNA protective, neuroprotective and hepatoprotective properties. 3,4-Dicaffeoylquinic acid exerts apoptosis-mediated cytotoxicity and α-glucosidase inhibitory effects. 3,4-Dicaffeoylquinic acid possesses a unique mechanism of anti-influenza viral activity, that is, enhancing viral clearance by increasing TRAIL[1][2][3].

  

• HY-N0402

  Artemether	71963-77-4	98.38%
  Artemether is an anti-malarial compound that targets drug-resistant strains of falciparum malaria[1].

  

• HY-100126

  Tubercidin	69-33-0
  Tubercidin (7-Deazaadenosine) is an antibiotic obtained from Streptomyces tubercidicus. Tubercidin inhibits the growth of Streptococcus faecalis (8043) with an IC50 of 0.02 μM[1]. Tubercidin inhibits polymerases by incorporating DNA or RNA, thereby inhibiting DNA replication, RNA and protein synthesis[2]. Tubercidin is a weak inhibitor of adenosine phosphorylase, and interferes with the phosphorylation of adenosine and AMP[1]. Tubercidin has antiviral activity[2].

  

• HY-106783

  Polymyxin B nonapeptide	86408-36-8	99.82%
  Polymyxin B nonapeptide is a cyclic peptide obtained from Polymyxin B by proteolytic removal of its terminal amino acyl residue. Polymyxin B nonapeptide is less toxic, lacks bactericidal activity, and retains its ability to render gram-negative bacteria susceptible to several antibiotics by permeabilizing their outer membranes[1][2][3].

  

• HY-W050154

  Kojic acid	501-30-4
  Kojic acid is a substance produced by Aspergillus oryzae that is orally effective and can also be absorbed transdermally. Kojic acid exhibits various biological activities, including anti-aging, anti-nematode, antimicrobial, antioxidant, and anti-inflammatory effects. Kojic acid is a Tyrosinase inhibitor with an Mushroom Tyrosinase IC50 of 182.7 μM. Kojic acid prevents melanin production by capturing copper ions that bind to the tyrosinase active site, thus inhibiting its activation. Kojic acid also suppresses the NF-κB and p21 signaling pathways in human keratinocytes. Kojic acid derivatives have anticancer activity[1][2][3][4][5][6][7][8].

  

• HY-B0689A

  Indinavir sulfate	157810-81-6	99.97%
  Indinavir sulfate (MK-639) is an orally active and selective HIV-1 protease inhibitor with a Ki of 0.54 nM for PR. Indinavir sulfate exhibits anticancer activity by inhibiting the activation of MMPs-2 hydrolysis, anti-angiogenesis and inducing apoptosis. Indinavir sulfate is also a SARS-CoV 3CLpro inhibitor[1][2][3][4].

  

• HY-B1455

  Clindamycin	18323-44-9	99.90%
  Clindamycin is an orally active and broad-spectrum bacteriostatic lincosamide antibiotic. Clindamycin can inhibit bacterial protein synthesis, possessing the ability to suppress the expression of virulence factors in Staphylococcus aureus at sub-inhibitory concentrations (sub-MICs). Clindamycin resistance results from enzymatic methylation of the antibiotic binding site in the 50S ribosomal subunit (23S rRNA). Clindamycin decreases the production of Panton-Valentine leucocidin (PVL), toxic-shock-staphylococcal toxin (TSST-1) or alpha-haemolysin (Hla). Clindamycin also can be used for researching malaria[1][2].

  

• HY-P1028

  Hexa-D-arginine	673202-67-0	99.85%
  Hexa-D-arginine (Furin Inhibitor II) is a stable furin inhibitor with Ki values 106 nM, 580 nM and 13.2 μM for furin, PACE4 and prohormone convertase-1 (PC1), respectively. Hexa-D-arginine blocks Pseudomonas exotoxin A and anthrax toxins toxicity in vitro and in vivo[1][2][3].

  

• HY-17411

  Limonin	1180-71-8	99.38%
  Limonin inhibits HIV-1 with an EC50 of 60.0 μM. Limonin induces human colon adenocarcinoma cells apoptosis with an IC50 of 54.74 μM. Limonin has antiviral and antitumor activities[1][2][4].

  

• HY-114268

  BRD-K98645985	1357647-78-9	98.67%
  BRD-K98645985 is a BAF (mammalian SWI/SNF) transcriptional repression inhibitor with an EC50 of ~2.37 μM. BRD-K98645985 binds ARID1A-specific BAF complexes, prevents nucleosomal positioning, and potently reverses HIV-1 latency, without T cell activation or toxicity[1].

  

• HY-B0537B

  Pentamidine isethionate	140-64-7	99.95%
  Pentamidine isethionate (MP-601205 isethionate) is an antimicrobial agent and interferes with DNA biosynthetics. Pentamidine isethionate inhibits parasite Leishmania infantum with an IC50 of 2.5 μM. Pentamidine isethionate is a potent and selective protein tyrosine phosphatases (PTPases) and phosphatase of regenerating liver (PRL) inhibitor. Pentamidine isethionate has the potential for Gambian trypanosomiasis, antimony-resistant leishmaniasis, and Pneumocystis carinii pneumonia treatment. Antitumor and antibacterial activities[1][2][3][4].

  

• HY-17402

  Nisoldipine	63675-72-9	99.56%
  Nisoldipine (BAY-k 5552; Sular) is an orally active and blood-brain barrier-penetrating dihydropyridine calcium antagonist, with greater vascular selectivity than other calcium channel antagonists. Nisoldipine inhibits calcium influx and blocks voltage-gated calcium channels. Nisoldipine dilates coronary and systemic arteries. Nisoldipine has antihypertensive and anti-anginal activity. Nisoldipine also displays neuroprotective and antiviral activity[1][2][7][11].

  

• HY-B0398

  Nalidixic acid	389-08-2
  Nalidixic acid, a quinolone antibiotic, is effective against both gram-positive and gram-negative bacteria. Nalidixic acid acts in a bacteriostatic manner in lower concentrations and is bactericidal in higher concentrations. Nalidixic acid inhibits a subunit of DNA gyrase and topoisomerase IV and reversibly blocks DNA replication in susceptible bacteria[1].

  

• HY-B1480

  Ethoxzolamide	452-35-7	99.85%
  Ethoxzolamide is a carbonic anhydrase inhibitor with Ki of 1 nM.

  

• HY-14879B

  Avibactam sodium hydrate	2938989-90-1	98.66%
  Avibactam sodium (NXL-104) hydrate is a covalent and reversible non-β-lactam β-lactamase inhibitor which inhibits β-lactamase TEM-1 and CTX-M-15 with IC50s of 8 nM and 5 nM, respectively[1].

  

• HY-Y0479S

  L-Lactic acid-13C3	87684-87-5
  L-Lactic acid-13C3 is a 13C-labeled L-Lactic acid (HY-Y0479). L-Lactic acid-13C3 can be used for lactate metabolism research[1].

  

• HY-18233

  Manogepix	936339-60-5	99.85%
  Manogepix (E1210) is a first-in-class, broad-spectrum and orally active antifungal. Manogepix has a mechanism of action-inhibition of fungal glycosylphosphatidylinositol (GPI) biosynthesis[1][2].

  

• HY-12353A

  Pimodivir	1629869-44-8	99.40%
  Pimodivir (VX-787) is an orally bioavailable inhibitor of influenza A virus polymerases through interaction with the viral PB2 subunit.

  

• HY-13685

  Miltefosine	58066-85-6
  Miltefosine is a broad spectrum antimicrobial, anti-leishmanial, phospholipid agent acting by inhibiting the PI3K/Akt activity[1][2][3][4]. Miltefosine is an inhibitor of CTP-phosphocholine cytidyltransferase (CCT)[5].

  

• HY-N0058

  4,5-Dicaffeoylquinic acid	57378-72-0	99.98%
  4,5-Dicaffeoylquinic acid (Isochlorogenic acid C) is an antioxidant, can be isolated from Gynura divaricata and Laggera alata. 4,5-Dicaffeoylquinic acid reduces islet cell apoptosis and improves pancreatic function in type 2 diabetic mice, and has obvious inhibitory activities against yeast α-glucosidase. 4,5-Dicaffeoylquinic acid inhibits prostate cancer cells through cell cycle arrest. 4,5-Dicaffeoylquinic acid also has anti-apoptotic, anti-injury and anti-hepatitis B virus effects[1][2][3].

  

• HY-N0365

  Sennoside A	81-27-6	99.71%
  Sennoside A is an anthraquinone glycoside found in senna (Cassia angustifolia). Sennoside A is an HIV-1 inhibitor (IC50=3.8 μM) that inhibits HIV-1 replication. Sennoside A also inhibits HIV-1 reverse transcriptase (RT)-related DNA polymerase (RDDP) and ribonuclease H (Ribonuclease H) with IC50s of 1.9 μM and 5.3 μM, respectively[1][2][3][4].

  

• HY-N1472

  Levistolide A	88182-33-6	99.26%
  Levistolide A is an apoptosis inducer and a PEDV virus inhibitor. Levistolide A can induce apoptosis in colon cancer cells and suppress the replication of porcine epidemic diarrhea virus (PEDV) by promoting ROS generation. Levistolide A activates peroxisome proliferator-activated receptor γ (PPARγ) in N2a/APP695swe cells and reduces excessive phosphorylation of tau through the GSK3α/β pathway, improving symptoms in Alzheimer’s mice. Levistolide A improves kidney damage in 5/6 nephrectomy (Nx) mice by inhibiting the RAS,TGF-β1/Smad, and MAPK pathways[1][2][3][4].

  

• HY-16566

  Kanamycin	59-01-8	99.97%
  Kanamycin (Kanamycin A) is an orally active antibacterial (gram-negative/positive bacteria) agent, inhibits translocation and causes misencoding by binding to the 70 S ribosomal subunit. Kanamycin shows good inhibitory activity to both M. tuberculosis (sensitive and drug-resistant ) and K. pneumonia, which can be used in studies of tuberculosis and pneumonia[1][2][3][4].

  

• HY-144433

  DNMT3A-IN-1	1403598-56-0	99.47%
  DNMT3A-IN-1 (compound 1) is an effective and selective DNMT3A inhibitor. DNMT3A-IN-1 exhibits inhibitory activity against DNMT3A, with KI values ranging from 9.16 to 18.85 μM (AdoMet) and 11.37 to 23.34 μM (poly dI-dC). DNMT3A-IN-1 can induce apoptosis in acute myeloid leukemia (AML) cell lines (Apoptosis)[1][2].

  

• HY-18627A

  PFI-2 hydrochloride	1627607-87-7
  PFI-2 ((R)-PFI-2 hydrochloride) hydrochloride is a potent and selective SET domain containing lysine methyltransferase 7 (SETD7) inhibitor. (R)-PFI-2 shows high inhibiting activity with IC50 value of 2.0  nM and (S)-PFI-2 shows inhibiting activity with IC50  value of 1.0  μM. PFI-2 hydrochloride can be used for the research of chronic kidney disease and inflammation response in the development of renal fibrosis[1][2].

  

• HY-50101A

  Mavorixafor trihydrochloride	2309699-17-8
  Mavorixafor trihydrochloride (AMD-070 trihydrochloride) is a potent, selective and orally available CXCR4 antagonist, with an IC50 value of 13 nM against CXCR4 125I-SDF binding, and also inhibits the replication of T-tropic HIV-1 (NL4.3 strain) in MT-4 cells and PBMCs with an IC50 of 1 and 9 nM, respectively.Mavorixafor trihydrochloride can be used for the study of WHIM syndrome[1].

  

• HY-B1299A

  Cephalosporin C zinc salt	59143-60-1
  Cephalosporin C zinc salt is a potent inhibitor of SAMHD1 with an IC50 of 1.1 μM[1]. Cephalosporin C zinc salt also has moderate anti-orthopoxvirus activity[2].

  

• HY-15298A

  Grazoprevir potassium salt	1206524-86-8	99.63%
  Grazoprevir potassium salt (MK-5172 potassium salt) is a selective inhibitor of Hepatitis C virus NS3/4a protease with broad activity across genotypes and resistant variants, with Kis of 0.01 nM (gt1b), 0.01 nM (gt1a), 0.08 nM (gt2a), 0.15 nM (gt2b), 0.90 nM (gt3a), respectively[1][2]. Grazoprevir potassium salt inhibits SARS-CoV-2 3CLpro activity[3].

  

• HY-14273

  Isavuconazole	241479-67-4	99.99%
  Isavuconazole (BAL-4815) is a triazole proagent with antifungal activity against yeasts, molds, and dimorphic fungi. Isavuconazole inhibits ergosterol biosynthesis and results in the disruption of fungal membrane structure and function. Isavuconazole is a moderate inhibitor of CYP3A4.

  

• HY-A0088

  Cefotaxime sodium	64485-93-4	99.25%
  Cefotaxime (Cefotaxim) sodium, a β-lactamase stable cephalosporin and a third-generation cephalosporin antibiotic, possesses broad-spectrum antibiotic activity against numerous Gram-positive and Gram-negative bacteria[1][2][3][4][5].

  

• HY-103399

  Trovafloxacin mesylate	147059-75-4
  Trovafloxacin mesylate is a broad-spectrum quinolone antibiotic with potent activity against Gram-positive, Gram-negative and anaerobic organisms. Trovafloxacin mesylate blocks the DNA gyrase and topoisomerase IV activity. Trovafloxacin mesylate is also a potent, selective and orally active pannexin 1 channel (PANX1) inhibitor with an IC50 of 4 μM for PANX1 inward current. Trovafloxacin mesylate does not inhibit connexin 43 gap junction or PANX2. Trovafloxacin mesylate leads to dysregulated fragmentation of apoptotic cells by inhibiting PANX1[1][2][3].

  

• HY-N0236

  Corylin	53947-92-5	99.97%
  Corylin is an orally active flavonoid anti-inflammatory and osteogenic agent that inhibits IL-6-induced STAT3 promoter activity and STAT3 phosphorylation. Corylin also has anticancer, antiatherosclerotic, and ameliorating activity in hyperlipidemia and insulin resistance, inducing adipocyte browning and lipolysis through SIRT1 or β3-AR-dependent pathways[1][2][3].

  

• HY-B1436

  Nifuroxazide	965-52-6	99.90%
  Nifuroxazide is an effective inhibitor of STAT3, also exerts potent anti-tumor and anti-metastasis activity. Nifuroxazide is an orally active nitrofuran antibiotic.

  

• HY-B2116

  Osalmid	526-18-1	99.80%
  Osalmid is a ribonucleotide reductase small subunit M2 (RRM2) targeting compound; suppresses ribonucleotide reductase activity with an IC50 of 8.23 μM.

  

• HY-B0509B

  Amikacin disulfate	39831-55-5
  Amikacin disulfate (BAY 41-6551 dissulfate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin disulfate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin disulfate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin disulfate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria[1][2].

  

• HY-122704A

  Surfen dihydrochloride	5424-37-3
  Surfen dihydrochloride is a potent heparan sulfate antagonist. Surfen inhibits FGF2 binding and signal transduction. Surfen binds to glycosaminoglycans and reduces tau hyperphosphorylation. Surfen dihydrochloride inhibits the activity of recombinant uronyl 2-O-sulfotransferase with an IC50 of approximately 2 μM. Surfen dihydrochloride inhibits HSV-1 viral infection. Surfen dihydrochloride inhibits neural differentiation, delays remyelination, and alleviates EAE[1][2][3][4][5][6].

  

• HY-W071746

  Linolelaidic acid	506-21-8
  Linolelaidic acid (Linoelaidic acid) is an omega-6 trans fatty acid (TFA) that is an essential nutrient with oral activity. Linolelaidic acid can be added to enteral nutrition (oral), parenteral nutrition (intravenous), and infant formula. Linolelaidic acid has anti-inflammatory and anti-parasitic ((Parasite)) activities, and can induce Apoptosis. Linolelaidic acid is useful for research in infections[1][2][3].

  

• HY-W250110

  Polyethylenimine (branched) (30% in water)	9002-98-6
  Polyethylenimine (branched) (30% in water) is a organic macromolecule with high cationic-charge-density potential. Polyethylenimine (branched) (30% in water) can ensnare DNA as well as attach to cell membrane. Polyethylenimine (branched) (30% in water) also retains a substantial buffering capacity at virtually any pH. Polyethylenimine (branched) (30% in water) is widely used as transfection reagent[1].

  

• HY-100760

  Toxoflavin	84-82-2	99.88%
  Toxoflavin (Xanthothricin) is an antagonist of transcription factor 4 (TCF4)/β-catenin complex, also acts as an inhibitor of KDM4A, with antitumor and antibiotic activity[1][2].

  

• HY-13637A

  Ganciclovir sodium	107910-75-8	99.92%
  Ganciclovir (BW 759) sodium, a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir sodium also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir sodium inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir sodium has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain[1][2][3].

  

• HY-117650A

  RG7834	2072057-17-9
  RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells[1].

  

• HY-B0200

  Cephalexin	15686-71-2
  Cephalexin (Cefalexin) is a potent, orally active semisynthetic cephalosporin antibiotic with a broad antibacterial spectrum. Cephalexin has antibacterial activity against a wide variety of gram-positive and gram-negative bacteria. Cephalexin targets penicillin-binding proteins (PBPs) to inhibit bacterial cell wall assembly. Cephalexin is used for the research of pneumonia, strep throat, and bacterial endocarditis, et al[1][2].

  

• HY-B0210

  Cefoperazone	62893-19-0	99.90%
  Cefoperazone, a semisynthetic cephalosporin, has a broad spectrum of antibacterial activity[1].

  

• HY-B0413

  Fenbendazole	43210-67-9	99.94%
  Fenbendazole is an orally active benzimidazole anthelmintic agent, with a broad antiparasitic range. Fenbendazole is a microtubule destabilizing agent and acts on helminthes primarily by binding to tubulin and disrupting the tubulin microtubule equilibrium. Fenbendazole stabilizes the transcriptional activator HIF-1α. Fenbendazole possesses an efficient anti-proliferative activity and induces apoptosis. Fenbendazole causes cell-cycle arrest and mitotic cell death, and has antitumor activity in mice xenografted with wild-type p53[1].

  

• HY-150741

  ODN 2216	332437-00-0
  ODN 2216 is a human-specific TLR9 (toll-like receptor 9) ligand or agonist. ODN 2216 induces high amounts of IFN-α and IFN-β. ODN 2216 induces IFN-α by pDC (plasmacytoid DC) and IL-12 (p40) production by DC (dendritic cells). ODN 2216 stimulates IFN-γ production in peripheral blood mononuclear cells (PBMC), which is indirect and mediated by IFN-α/β. ODN 2216 can activate NK cells and promote IFN-γ production of TCR-triggered CD4+ T cells[1][2][3][4][5].

  

• HY-P99756

  Nirsevimab	1989556-22-0
  Nirsevimab (MEDI8897) is a recombinant monoclonal antibody against human respiratory syncytial virus (RSV). Nirsevimab has neutralizing activity against RSV A and RSV B viruses, with IC50 values of 5.42 ng/mL and 9.71 ng/mL, respectively. Nirsevimab can be used for research on respiratory infections[1][2].

  

• HY-15602

  Ledipasvir	1256388-51-8	99.69%
  Ledipasvir (GS-5885) is an inhibitor of the hepatitis C virus NS5A, with EC50s of 34 pM and 4 pM against genotype 1a and 1b replicon, respectively. Ledipasvir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.62 μM[3].

  

• HY-N6708

  Alamethicin	27061-78-5
  Alamethicin is a linear 20-amino acid antibiotic, which can induce voltage-gated conductance in model and cell membranes. Alamethicin exhibits antimicrobial activity against Gram-positive bacteria, but not Gram-negative bacteria. Alamethicin can form an amphipathic α-helical structure in biological membranes[1][2].

  

• HY-P10408

  Candidalysin	1906866-53-2	99.38%
  Candidalysin is a cytolytic peptide toxin secreted by the fungus Candida albicans. Candidalysin drives epithelial immune responses by activating the EGFR-MAPK signaling pathway, inducing MMP expression and calcium influx, and regulating the c-Fos transcription factor and MKP1 via p38 MAPK and ERK1/2 respectively. Candidalysin is essential for mucosal and systemic infections, activating NLRP3 to promote inflammatory responses, neutrophil recruitment, and Th17 immunity. Candidalysin activates LDH causing membrane damage and exhibiting cytotoxicity[1][2][3][4]

  

• HY-10235

  Telaprevir	402957-28-2
  Telaprevir (VX-950) is a highly selective, reversible, and potent peptidomimetic inhibitor of the HCV NS3-4A protease, the steady-state inhibitory constant (Ki) of Telaprevir is 7 nM against a genotype 1 (H strain) NS3 protease domain plus a NS4A cofactor peptide[1][2][3]. Telaprevir inhibits SARS-CoV-2 3CLpro activity[4].

  

• HY-14603

  Clioquinol	130-26-7	99.41%
  Clioquinol (Iodochlorhydroxyquin) is a topical antifungal agent with anticancer activity. Clioquinol acts as an oral antimicrobial agent for the research of diarrhea and skin infections. Antibiotic[1].

  

• HY-13578

  Brivudine	69304-47-8	99.72%
  Brivudine is a thymidine analogue with antiviral activity, indicated for the early treatment of acute herpes zoster.

  

• HY-17025

  Rifabutin	72559-06-9	99.20%
  Rifabutin (Ansamycin) is a semisynthetic ansamycin antibiotic with potent antimycobacterial properties. Rifabutin inhibits DNA-dependent RNA polymerase.

  

• HY-116387

  WR99210	47326-86-3	99.10%
  WR99210 is an orally active and low-toxicity dihydrofolate reductase (DHFR) inhibitor (IC50<0.075 nM). WR99210 shows good antiparasitic activity and is effective against P. falciparum and P. falciparum strains (including Pyrimethamine (HY-18062)-resistant P. falciparum strains) as well as T. gondii[1][2][3].

  

• HY-128067

  5-(N,N-Hexamethylene)-amiloride	1428-95-1
  5-(N,N-Hexamethylene)-amiloride (Hexamethylene amiloride) derives from an amiloride and is a potent Na+/H+ exchanger inhibitor, which decreases the intracellular pH (pHi) and induces apoptosis in leukemic cells. 5-(N,N-Hexamethylene)-amiloride (Hexamethylene amiloride) is also an inhibitor of the HIV-1 Vpu virus ion channel and inhibits mouse hepatitis virus (MHV) replication and human coronavirus 229E (HCoV229E) replication in cultured L929 cells with EC50s of 3.91 μM and 1.34 μM, respectively[1][2].

  

• HY-N1584A

  Halofuginone hydrobromide	64924-67-0	99.99%
  Halofuginone (RU-19110) hydrobromid, a Febrifugine derivative, is a competitive prolyl-tRNA synthetase inhibitor with a Ki of 18.3 nM[1][2]. Halofuginone hydrobromid is a specific inhibitor of type-I collagen synthesis and attenuates osteoarthritis (OA) by inhibition of TGF-β activity[3][4]. Halofuginone hydrobromid is also a potent pulmonary vasodilator by activating Kv channels and blocking voltage-gated, receptor-operated and store-operated Ca2+ channels. Halofuginone hydrobromid has anti-malaria, anti-inflammatory, anti-cancer, anti-fibrosis effects[5].

  

• HY-B1322A

  Amodiaquine	86-42-0	99.98%
  Amodiaquine (Amodiaquin), a 4-aminoquinoline class of antimalarial agent, is a potent and orally active histamine N-methyltransferase inhibitor. Amodiaquine is also a Nurr1 agonist and specifically binds to Nurr1-LBD (ligand binding domain) with an EC50 of ~20 μM. Anti-inflammatory effect[1][2][3][4].

  

• HY-103017A

  JH-X-119-01	2227368-54-7
  JH-X-119-01 is a potent and selective interleukin-1 receptor-associated kinases 1 (IRAK1) inhibitor. JH-X-119-01 ameliorates LPS-induced sepsis in mice[1]. JH-X-119-01 inhibits IRAK1 biochemically with an apparent IC50 of 9 nM while exhibiting no inhibition of IRAK4 at concentrations up to 10 μM[2].

  

• HY-B1464

  Cetylpyridinium chloride	123-03-5
  Cetylpyridinium chloride, a cationic quaternary ammonium compound, is an anti-bacterial agent with broad-spectrum activity. Cetylpyridinium chloride is an effective anti-HBV capsid assembly inhibitor with an IC50 of 2.5 μM. Cetylpyridinium chloride is used in pesticides and various types of mouthwashes, and other personal care products[1][2].

  

• HY-N6722

  Swainsonine	72741-87-8
  Swainsonine (Tridolgosir) is an natural indolizidine alkaloid, a potent and reversible α-mannosidase inhibitor. Swainsonine induces apoptosis and cell cycle arrest at G2/M phase. Swainsonine shows anti-tumor activity[1][2][3].

  

• HY-116815

  Lalistat 1	501104-16-1
  Lalistat 1 is a potent, selective, and competitive inhibitor of lysosomal acid lipase (LAL) and against purified human LAL (phLAL) with an IC50 of 68 nM. Lalistat 1 is a inhibitor of immunoglobulin A1 protease (IgA1P) proteases for H. influenzae, has less effects on other serine hydrolases (trypsin or β-lactamase, etc.). Lalistat 1 can be used for the research of niemann-pick type C (NPC) disease[2].

  

• HY-125118

  GSK-A1	1416334-69-4
  GSK-A1 is a selective type III phosphatidylinositol 4-kinase PI4KA (PI4KIIIα) inhibitor with a pIC50 of 8.5-9.8. GSK-A1 inhibits PtdIns(4,5)P2 resynthesis with an IC50 of about 3 nM. GSK-A1 potently decreases the levels of PtdIns(4)P with a negligible effect on PtdIns(4,5)P2. GSK-A1 has the potential for anti-hepatitis C virus (HCV) research[1].

  

• HY-A0170

  Trovafloxacin	147059-72-1	99.08%
  Trovafloxacin is a broad-spectrum quinolone antibiotic with potent activity against Gram-positive, Gram-negative and anaerobic organisms. Trovafloxacin blocks the DNA gyrase and topoisomerase IV activity. Trovafloxacin is also a potent, selective and orally active pannexin 1 channel (PANX1) inhibitor with an IC50 of 4 μM for PANX1 inward current. Trovafloxacin does not inhibit connexin 43 gap junction or PANX2. Trovafloxacin leads to dysregulated fragmentation of apoptotic cells by inhibiting PANX1[1][2][3].

  

• HY-16050

  Plitidepsin	137219-37-5	99.99%
  Plitidepsin (Aplidine) is a potent anti-cancer agent by targeting eEF1A2 ( KD=80 nM)[1]. Plitidepsin possesses antiviral activity and is against SARS-CoV-2 with an IC90 of 0.88 nM. Plitidepsin is usually used for multiple myeloma and advanced cancer research, and has the potential for COVID-19 research[1][2].

  

• HY-A0166

  Cilastatin	82009-34-5	99.91%
  Cilastatin (MK0791) is a reversible, competitive renal dehydropeptidase I inhibitor with an IC50 of 0.1 μM. Cilastatin inhibits the bacterial metallob-lactamase enzyme CphA with an IC50 of 178 μM. Cilastatin is an antibacterial adjunct[1][2][3].

  

• HY-B0182

  Carmofur	61422-45-5
  Carmofur (HCFU) is a rat recombinant acid ceramidase inhibitor with an IC50 of 29 nM. Carmofur is also a protease inhibitor of SARS-CoV-2 main protease (Mpro), fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amidase (NAAA). Carmofur has anti-cancer, anti-inflammatory and anti-virus activities, and can be used for the study of COVID-19 and acute lung injury (ALI)[1][2][3].

  

• HY-B0134A

  Bestatin hydrochloride	65391-42-6	99.94%
  Bestatin hydrochloride is an inhibitor of CD13 (Aminopeptidase N)/APN and leukotriene A4 hydrolase, used for cancer research.

  

• HY-B1318

  Foscarnet sodium	63585-09-1
  Foscarnet sodium (Trisodium phosphonoformate) is a viral DNA polymerase activity inhibitor, leading to reversible suppression of viral replication. Foscarnet sodium is an antiherpesvirus agent used in cytomegalovirus retinitis[1][2][3].

  

• HY-N0359

  Cynarin	30964-13-7	99.75%
  Cynarin is an antichoke agent with a variety of biological activities including antioxidant, antihistamic and antiviral activities.

  

• HY-N6796

  Manumycin A	52665-74-4
  Manumycin A is a polyketide antibiotic and an inhibitor of thioredoxin reductase 1 (TrxR-1). Manumycin A can inhibit the growth of breast cancer cells and exert its anti-tumor activity through LC3. Manumycin A can downregulate the release of pro-inflammatory cytokines in human monocytes stimulated by TNF α, and has potential anti-inflammatory activity. Manumycin A can inhibit the Ras/Raf/ERK1/2 signaling and hnRNP H1 in castration resistant prostate cancer cells to suppress exosome biogenesis and secretion[1][3][4].

  

• HY-116090

  Conoidin A	18080-67-6	99.32%
  Conoidin A is a cell permeable inhibitor of T. gondii enzyme peroxiredoxin II (TgPrxII) with nematicidal properties. Conoidin A covalently binds to the peroxidatic Cys47 of TgPrxII, irreversibly inhibiting its hyperperoxidation activity with an IC50 of 23 μM. Conoidin A also inhibits hyperoxidation of mammalian PrxI and PrxII (but not PrxIII)[1][2]. Conoidin A has antioxidant, neuroprotective effects and can be used for the research of ischaemic heart disease[3].

  

• HY-117235

  Diallyl Trisulfide	2050-87-5
  Diallyl Trisulfide is an orally active anticancer agent that can be isolated from garlic. Diallyl Trisulfide has the ability to induce apoptosis and exhibits anticancer, anti-inflammatory, antioxidant, and antibacterial activities. Diallyl Trisulfide can be used to study a variety of cancers, including liver, colon and prostate cancer[1][2][3][4].

  

• HY-16305

  Maribavir	176161-24-3	99.94%
  Maribavir is a potent inhibitor of histone phosphorylation catalyzed by wild-type pUL97 in vitro, with an IC50 of 3 nM. Maribavir has potent antiviral activity against HCMV and Epstein-Barr virus (EBV).

  

• HY-108009A

  Rezafungin acetate	1631754-41-0	99.84%
  Rezafungin acetate (Biafungin acetate) is a next-generation, broad-spectrum, and long-lasting echinocandin. Rezafungin acetate shows potent antifungal activity against Candida spp., Aspergillus spp., and Pneumocystis spp.[1][2].

  

• HY-13234

  Rifaximin	80621-81-4
  Rifaximin, a gastrointestinal-selective antibiotic, binds the β-subunit of bacterial DNA-dependent RNA polymerase, resulting in inhibition of bacterial RNA synthesis. Rifaximin susceptibility is higher against Gram-positive strains (MIC: 0.03-5 mg/ml) compared to Gram-negative bacteria (MIC: 8-50 mg/mL)[1][2].

  

• HY-15449

  Kaempferide	491-54-3	99.80%
  Kaempferide is an orally active flavonol isolated from Hippophae rhamnoides L. Kaempferide has anticancer, anti-inflammatory, antioxidant, antidiabetic, antiobesity, antihypertensive, and neuroprotective activities. Kaempferide induces apoptosis. Kaempferide promotes osteogenesis through antioxidants and can be used in osteoporosis research[1][2][3][4][5][6].

  

• HY-66011

  Moxifloxacin Hydrochloride	186826-86-8	99.99%
  Moxifloxacin Hydrochloride (BAY 12-8039) is an oral 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia[1][2].

  

• HY-B0269

  Rifapentine	61379-65-5
  Rifapentine (DL 473) is an antibiotic used in tuberculosis research[1].

  

• HY-B0956

  Paromomycin sulfate	1263-89-4	99.93%
  Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections[1][2][3].

  

• HY-B1286

  Piperacillin sodium	59703-84-3	98.22%
  Piperacillin sodium is a semisynthetic broad-spectrum β-lactam antibiotic which exhibits potent bactericidal activity against Gram-negative bacteria as well as select Gram-positive strains through penicillin-binding proteins. Piperacillin is most commonly used in combination with the β-lactamase inhibitor Tazobactam[1][2][3].

  

• HY-N3014

  Bruceine D	21499-66-1
  Bruceine D is a Notch inhibitor with anti-cancer activity and induces apoptosis in several human cancer cells. Bruceine D is an effective botanical insect antifeedant with outstanding systemic properties, causing potent pest growth inhibitory activity[1][2]. Bruceine D has strong anthelmintic activity against D. intermedius with an EC50 value of 0.57 mg/L[3].

  

• HY-147059

  Dieckol	88095-77-6	99.81%
  Dieckol, is a naturally occurring phlorotannin found in some brown algal species. Dieckol has anti-bacterial, anti-cancer, anti-oxidant, anti-aging, anti-diabetic, neuroprotective actions[1].

  

• HY-B2196

  Gastric mucin	84082-64-4
  Gastric mucin is a large glycoprotein which is thought to play a major role in the protection of the gastrointestinal tract from acid, proteases, pathogenic microorganisms, and mechanical trauma.

  

• HY-B1463

  Penicillin G sodium salt	69-57-8
  Penicillin G sodium salt is a typical β-lactam antibiotic.

  

• HY-14737

  Ceftaroline fosamil	400827-46-5	99.81%
  Ceftaroline fosamil (TAK-599), a cephalosporin derivative, is an N-phosphono proagent of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil can be used for the research of MRSA infection[1][2][3].

  

• HY-B0330A

  Levofloxacin hydrate	138199-71-0	99.93%
  Levofloxacin hydrate (Levofloxacin hemihydrate) is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin hydrate inhibits the DNA gyrase and topoisomerase IV. Levofloxacin hydrate can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin hydrate shows anti-orthopoxvirus activity[1][2][3][4].

  

• HY-B0519A

  Tylosin	1401-69-0
  Tylosin (Tylosin A) is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin is widely used as a feed additive for promoting animal growth. Tylosin is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle[1][2][3].

  

• HY-P99340

  Sotrovimab	2423014-07-5
  Sotrovimab (VIR 7831) is a human IgG1κ pan-sarbecovirus monoclonal antibody (mAb), neutralizes SARS-CoV-2, SARS-CoV-1, and multiple other sarbecoviruses. Sotrovimab is developed based on S309, exhibits a long half-life and great bioavailability in the respiratory mucosa. Sotrovimab could result in immune-mediated viral clearance and prevent progression of Covid-19 early in the course of disease[1][2].

  

• HY-17624

  Framycetin	119-04-0
  Framycetin (Neomycin B), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections[1][2].

  

• HY-N0243

  Theaflavin	4670-05-7	99.69%
  Theaflavin is a suitable natural inhibitor against influenza A (H1N1) neuraminidase.

  

• HY-107931

  Propiolactone	57-57-8
  Propiolactone (β-propiolactone; 2-Oxetanone) is a viral chemical inactivator that causes the infectious inactivation of viruses. Propiolactone was co-incubated with SARS-CoV at a ratio of 1:1000 (v:v) and used as a bacteriostatic agent to formulate the BPL-inactivated influenza virus vaccine (Flu-BPL)[1][2].

  

• HY-100313A

  YM-53601	182959-33-7	99.37%
  YM-53601, a squalene synthase inhibitor, reduces plasma cholesterol and triglyceride levels in vivo[1]. YM-53601 inhibits squalene synthase derived from human hepatoma cells with an IC50 of 79 nM. Lipid-lowering agent[2]. YM-53601 is also an inhibitor of farnesyl-diphosphate farnesyltransferase 1 (FDFT1) enzyme activity and abrogates HCV propagation[3].

  

• HY-10373

  Trimetrexate	52128-35-5	99.22%
  Trimetrexate (CI-898) is an antibiotic, also a potent and orally active dihydrofolate reductase (DHFR) inhibitor, reducing the production of DNA and RNA precursors and leading to cell death, with IC50 values of 4.74 nM and 1.35 nM for human DHFR and Toxoplasma gondii DHFR. Trimetrexate can also inhibit the growth of various cancer cells. Trimetrexate can be used for researching Pneumocystis carinii pneumonia (PCP) and cancer[1][2][3][4][5].

  

• HY-131925

  Diethylamine NONOate diethylammonium salt	372965-00-9
  Diethylamine NONOate (DEA NONOate, diethylammonium salt) is a nitric oxide donor. Diethylamine NONOate is a potent antimicrobial agent, which can inhibit Escherichia coli growth. Diethylamine NONOate also can enhance preservation of the donor rat heart[1][2].

  

• HY-12530

  Velpatasvir	1377049-84-7	99.57%
  Velpatasvir (VEL, GS-5816) is a novel pan-genotypic hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor with activity against genotype 1 (GT1) to GT6 HCV replicons. Velpatasvir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 2.16 μM[2].

  

• HY-16670

  Dafadine-A	1065506-69-5	98.94%
  Dafadine-A is a selective inhibitor of DAF-9 cytochrome P450 in the nematode Caenorhabditis elegans. Dafadine-A inhibits the mammalian ortholog of DAF-9 (CYP27A1). Dafadine-A does not inhibits DAF-12 and sterol- and oxysterol-metabolizing P450s[1].

  

• HY-20685

  Palmitoylethanolamide	544-31-0
  Palmitoylethanolamide (Palmidrol) is an active endogenous compound which can used for preventing virus infection of the respiratory tract.

  

• HY-B1923

  Piperacillin	61477-96-1
  Piperacillin is a semisynthetic broad-spectrum β-lactam antibiotic which exhibits potent bactericidal activity against Gram-negative bacteria as well as select Gram-positive strains through penicillin-binding proteins. Piperacillin is most commonly used in combination with the β-lactamase inhibitor Tazobactam[1][2][3].

  

• HY-D1020

  7-Aminoactinomycin D	7240-37-1
  7-Aminoactinomycin D (7-AAD) a fluorescent DNA stain, is a potent RNA polymerase inhibitor. 7-Aminoactinomycin D selectively binds to GC regions of the DNA. 7-Aminoactinomycin D also has antibacterial effects[1][2][3].

  

• HY-N0166

  Gramine	87-52-5	99.80%
  Gramine (Donaxine) is a natural alkaloid isolated from giant reed[2], acts as an active adiponectin receptor (AdipoR) agonist, with IC50s of 3.2 and 4.2 µM for AdipoR2 and AdipoR1, respectively[1]. Gramine is also a human and mouse β2-Adrenergic receptor (β2-AR) agonist[2]. Gramine (Donaxine) has anti-tumor, anti-viral and anti-inflammatory properties[1].

  

• HY-N0295

  Protocatechualdehyde	139-85-5
  Protocatechualdehyde (Catechaldehyde), a natural polyphenol compound isolated from the roots of radix Salviae Miltiorrhizae, is associated with a wide variety of biological activities and has been widely used in medicine as an antioxidant, anti-aging, an antibacterial and anti-inflammatory agent[1].

  

• HY-N0638

  Dendrobine	2115-91-5
  Dendrobine is an alkaloid isolated from Dendrobium nobile. Dendrobine possesses antiviral activity against influenza A viruses, with IC50s of 3.39 μM, 2.16 μM and 5.32 μM for A/FM-1/1/47 (H1N1), A/Puerto Rico/8/34 H274Y (H1N1) and A/Aichi/2/68 (H3N2), respectively. Dendrobine activates the JNK/p38/Nrf2 signaling pathway. Dendrobine exhibits antiviral, antitumor, anti-inflammatory, and neuroprotective properties[1][2][3][4][5].

  

• HY-N6653

  Lentinan	37339-90-5
  Lentinan is an orally active biocompatible multifunctional polysaccharide with biological activities such as anti-inflammatory, antioxidant, immune regulation, anti-tumor, hypoglycemic, and lipid-lowering[1][4].

  

• HY-N6949

  Juglone	481-39-0	99.77%
  Juglone (5-hydroxy-1,4-naphthalenedione) is a yellow dye that can be extracted from Juglans regia. Juglone induces apoptosis through the mitochondrial pathway. Juglone has antibacterial and antitumor activity [1][2][3].

  

• HY-P3161

  Lactoferrin from Bovine milk	936541-36-5
  Lactoferrin from Bovine milk is a substance released by neutrophils. Lactoferrin from Bovine milk is an orally active multifunctional iron binding glycoprotein. Lactoferrin from Bovine milk prevents cell adhesion, growth and spreading of cell colonies. Lactoferrin from Bovine milk also has antiviral activity and inhibits microbial and viral adhesion and entry into host cells. Besides, Lactoferrin from Bovine milk has anti-inflammatory, immunomodulatory, and anti-cancer activities[1][2][3].

  

• HY-B1831A

  Oritavancin diphosphate	192564-14-0	99.93%
  Oritavancin diphosphate (LY333328 diphosphate), a semisynthetic derivative of Vancomycin (HY-B0671), is an orally active glycopeptide antibiotic with bactericidal activity against gram-positive organisms. Oritavancin diphosphate shows antibacterial effect against B. anthracis, such as Ames strain with a MIC value of 0.015 g/mL. Oritavancin diphosphate inhibits cell wall synthesis and disrupts the membrane potential. Oritavancin diphosphate inhibits ArlS kinase activity thereby interfering the signal transduction. Oritavancin diphosphate enters cells by adsorptive endocytosis, which drives it to lysosomes, where it exerts antibiotic activity[1][2][3][4][5].

  

• HY-W008566

  Norharmane	244-63-3
  Norharmane (Norharman), a β-carboline alkaloid, is a potent and reversible monoamine oxidase inhibitor, with IC50 values of 6.5 and 4.7 μM for MAO-A and MAO-B, respectively. Norharmane causes antidepressant responses. Norharmane is also a prospective anti-cancer photosensitizer. Norharmane alters polar auxin transport (PAT) by inhibiting PIN2, PIN3 and PIN7 transport proteins, thus causing a significant inhibitory effect on the growth of Arabidopsis thaliana seedlings[1][2][3][4][5][6].

  

• HY-W015346

  Desaminotyrosine	501-97-3
  Desaminotyrosine is a microbially associated metabolite protecting from influenza through augmentation of type I interferon signaling.

  

• HY-W017162

  DL-3-Phenyllactic acid	828-01-3	99.91%
  DL-3-Phenyllactic acid is a broad-spectrum antimicrobial compound.

  

• HY-10367

  Canertinib	267243-28-7	99.74%
  Canertinib (CI-1033;PD-183805) is a potent and irreversible EGFR inhibitor; inhibits cellular EGFR and ErbB2 autophosphorylation with IC50s of 7.4 and 9 nM. Canertinib is active against vaccinia virus respiratory infection in mice[1][2][3][4].

  

• HY-12594

  Paritaprevir	1216941-48-8
  Paritaprevir (ABT-450) is a potent, orally active and antiviral non-structural protein 3/4A (NS3/4A) protease inhibitor with EC50s of 1 and 0.21 nM against HCV 1a and 1b, respectively. Paritaprevir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.31 μM. Paritaprevir is metabolized primarily by cytochrome P450 (CYP) 3A. The plasma concentration and half-life of Paritaprevir can be enhanced by Ritonavir (a CYP450 inhibitor)[1][2][3][4].

  

• HY-B0154

  Fluticasone (propionate)	80474-14-2	99.93%
  Fluticasone propionate, a potent topical anti-inflammatory corticosteroid, is a selective glucocorticoid receptor agonist, with an absolute affinity (KD) of 0.5 nM. Fluticasone propionate shows little or no activity at other steroid receptors. Anti-viral activity[1][2].

  

• HY-B0454

  Miconazole	22916-47-8	99.92%
  Miconazole (R18134) is an imidazole antifungal agent. Miconazole also has antibacterial effects[2].

  

• HY-B0616

  Cefepime Dihydrochloride Monohydrate	123171-59-5	99.91%
  Cefepime Dihydrochloride Monohydrate is a broad-spectrum cephalosporin with enhanced coverage against Gram-positive and Gram-negative bacteria[1].

  

• HY-109137

  Selgantolimod	2004677-13-6	98.18%
  Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection[1][2][3].

  

• HY-13725A

  Pirarubicin Hydrochloride	95343-20-7	99.14%
  Pirarubicin Hydrochloride is an anthracycline antibiotics, acts as a topoisomerase II inhibitor, and is a widely used for treatment of various cancers, in particular, solid tumors.

  

• HY-152955

  STING agonist-22	2408723-12-4	99.83%
  STING agonist-22 (CF501) is a potent non-nucleotide STING agonist. STING agonist-22 is a adjuvant by activating STING to induce the type I interferon (IFN-I) response and proinflammatory cytokine production. STING agonist-22 can be used as an adjuvant to boost the original protein vaccine, producing potent, broad, and long-term immune protection. STING agonist-22 can be used for SARS-CoV-2 variants and sarbecovirus diseases research[1].

  

• HY-A0097

  Teicoplanin	61036-62-2
  Teicoplanin is a glycopeptide antibiotic indicated for use in serious infections caused by Gram-positive bacteria, including Methicillin-resistant Staphylococcus aureus and Enterococcus aureus.Teicoplanin shows antiviral activity for HIV-1, SARS-CoV1 and SARS-CoV2. Teicoplanin sodium shows anti-MRSA activity[1][2].

  

• HY-D0214

  Rose Bengal sodium	632-69-9
  Rose Bengal sodium, a synthetic fluorescein derivative, is a deep red dye primarily composed of 4,5,6,7-tetrachloro-2,4,5,7-tetraiodo fluorescein. It is widely used as an ophthalmic diagnostic agent to detect dry or damaged cells on the ocular surface. Rose Bengal sodium exhibits antitumor activity and can inhibit Friend Leukemia Virus (FLV) infection through photodynamic action. Additionally, Rose Bengal sodium can inhibit Aβ aggregation through light irradiation. Rose Bengal sodium holds potential for use in cancer, viral infections, and neurodegenerative disease research[1][2][3][4][5][6].

  

• HY-101848

  Latrunculin B	76343-94-7
  Latrunculin B, an antimicrobial marine alkaloid, is an actin polymerization inhibitor. Latrunculin B regulates pulmonary vein electrophysiological characteristics and attenuates stretch-induced arrhythmogenesis. Antifungal and antiprotozoal activity[1][2].

  

• HY-118122

  Fialuridine	69123-98-4	99.91%
  Fialuridine (FIAU), a nucleoside analog, is a HSV-1 and HSV-2 inhibitor with Kis of 0.14 μM and 0.95 μM, respectively. Fialuridine shows anti-orthopoxvirus and anti-hepatitis B virus (HBV) activities. Fialuridine inhibits duck HBV DNA replication with IC50 values of 0.075 μM and 156 μM in human hepatoma cells and in chicken liver cells, respectively[1][2][3].

  

• HY-B2144B

  Chitosan (MW 30000)	9012-76-4
  Chitosan (MW 30000) (Deacetylated chitin (MW 30000)) is a polycationic linear polysaccharide derived from chitin with the molecular weight of 30000. Chitosan is an versatile biomaterial because of its non-toxicity, low allergenicity, biocompatibility and biodegradability. Chitosan also has antitumor, antibacterial, antifungal, and antioxidant activities[1][2].

  

• HY-150726C

  ODN 1668 sodium		98.79%
  ODN 1668 sodium, a class B CpG ODN (oligodeoxynucleotide), is a TLR-9 agonist. ODN 1668 sodium has strong immune regulatory properties, can enhance the level of antibody IgG2 subtype, promote the immune response of T cells and B cells, and can be used in the study of vaccine adjuvants. In addition, CpG ODN 1668 sodium induces an antimicrobial immune response via a CaTLR9 dependent pathway in groupers. Sequence: 5'-tccatgacgttcctgatgct-3’[1][2][3][4].

  

• HY-Y0479AS

  L-Lactic acid-13C3 (sodium) (20% in water)	201595-71-3
  L-Lactic acid-13C3 ((S)-2-hydroxypropanoic-13C3) sodium (20% in water) is the 13C labeled L-Lactic acid. L-Lactic acid-13C3 sodium (20% in water) can be used for lactate metabolism research[1].

  

• HY-16767

  Doravirine	1338225-97-0
  Doravirine (MK-1439) is a highly specific HIV-1 nonnucleoside reverse transcriptase inhibitor with IC50s of 4.5 nM, 5.5 nM and 6.1 nM against the wild type and K103N and Y181C reverse transcriptase mutants, respectively[1].

  

• HY-17403

  Manidipine dihydrochloride	89226-75-5	99.84%
  Manidipine dihydrochloride is a third-generation, lipophilic, orally active and highly vasoselective calcium channel antagonist (IC50 = 2.6 nM in guinea-pig ventricular cells) and acts as an antihypertensive agent. Manidipine effectively reduces blood pressure as well as improving insulin sensitivity, renal protection, and antiatherosclerotic activity. Manidipine also exerts anti-inflammatory activity mediated by NF-κB and antiviral activity against many flavivirus and negative-strand RNA viruses through the inhibition of calcium channel. Manidipine is widely applied to research of cardiovascular, metabolic disease and infection[1][2][3][4][5][6].

  

• HY-B1256

  Cefuroxime sodium	56238-63-2	99.46%
  Cefuroxime sodium is an orally active second-generation cephalosporin antibiotic with increased stability to β-lactamase. Cefuroxime sodium has a broad spectrum activity against Gram-positive and Gram-negative bacteria[1].

  

• HY-P99376

  Narsoplimab	2108782-45-0
  Narsoplimab (OMS 721) is a high-affinity fully human immunoglobulin gamma 4 (IgG4) monoclonal antibody that binds MASP-2 and blocks lectin pathway activation. Narsoplimab can be used in research of hematopoietic stem-cell transplantation and SARS-CoV-2[1].

  

• HY-B0132

  Norfloxacin	70458-96-7
  Norfloxacin (MK-0366) is a broad-spectrum antibiotic that is active against both Gram-positive and Gram-negative bacteria, which functions by inhibiting DNA gyrase.

  

• HY-N6791

  KT5823	126643-37-6
  KT5823, a selective the cGMP-dependent protein kinase (PKG) inhibitor with an Ki value of 0.23 μM, it also inhibits PKA and PKC with Ki values of 10 μM and 4 μM, respectively. KT5823 is a Staurosporine-related protein kinase inhibitor, increases thyroid-stimulating hormone-induced (Na+/I- symporter) NIS expression, and iodide uptake in thyroid cells. KT5823 arrests cells after the G0/G1 boundary and causes increases in the levels of apoptotic DNA fragmentation[1][2][3][4][5].

  

• HY-W013332A

  3-Deazaadenosine hydrochloride	86583-19-9
  3-Deazaadenosine (hydrochloride) is an inhibitor of S-adenosylhomocysteine hydrolase, with a Ki of 3.9 µM; 3-Deazaadenosine has anti-inflammatory, anti-proliferative and anti-HIV activity.

  

• HY-100711

  Prodigiosin	82-89-3
  Prodigiosin (Prodigiosine) is a red pigment produced by bacteria as a bioactive secondary metabolite. Prodigiosin is a potent inhibitor of the Wnt/β-catenin pathway. Prodigiosin has antibacterial, antifungal, antiprotozoal, antimalarial, immunosuppressive, and anticancer properties[1][2].

  

• HY-136072

  Xeruborbactam disodium	2170848-99-2	99.87%
  Xeruborbactam (QPX7728) disodium is a potent, ultra-broad-spectrum boronic acid beta-lactamase inhibitor. Xeruborbactam disodium inhibits key serine and metallo beta-lactamases at a nano molar range[1].

  

• HY-10466

  Daclatasvir	1009119-64-5	99.57%
  Daclatasvir (BMS-790052) is a potent and orally active HCV NS5A protein inhibitor with EC50s range of 9-146 pM for multiple HCV replicon genotypes. Daclatasvir is also a organic anion transporting polypeptide 1B (OATP1B) and OATP1B3 inhibitor with IC50s of 1.5 µM and 3.27 µM, respectively[1][2][3].

  

• HY-14740

  Elvitegravir	697761-98-1	99.90%
  Elvitegravir (GS-9137; JTK-303; D06677) is an HIV integrase inhibitor for HIV-1IIIB, HIV-2EHO and HIV-2ROD with IC50 of 0.7 nM, 2.8 nM and 1.4 nM, respectively.

  

• HY-B0435

  Roxithromycin	80214-83-1
  Roxithromycin (RU-28965) is an orally active semi-synthethic macrolide antibiotic. Roxithromycin inhibits protein biosynthesis in the elongation step by binding to 50S bacterial ribosome. Roxithromycin has antimicrobial, antiproliferative, anti-inflammatory, tumour vasculature inhibiting and lung injury ameliorating effects[1][2][3][4][5][6][7][8][9][10][11].

  

• HY-B0925

  Oxacillin sodium salt	1173-88-2
  Oxacillin sodium salt is an orally active synthetic penicillin with good bactericidal activity against staphylococci and other gram-positive pathogens[1].

  

• HY-12687

  Tizoxanide	173903-47-4	98.10%
  Tizoxanide (TIZ) is the active metabolite of Nitazoxanide, which is a thiazolide anti-infective compound against anaerobic bacteria, protozoa, and a range of viruses. Tizoxanide (TIZ) has anti-HIV-1 activities and potent inhibition of both HBV and HCV replication with values EC50 of 0.46μM and 0.15 μM, respectively. Tizoxanide also exerts anti-inflammatory effects by inhibiting the production of pro-inflammatory cytokines and suppressing of the activation of the NF-κB and the MAPK signaling pathways in LPS-treated macrophage cells[1][3][4][5].

  

• HY-B0958

  Mupirocin	12650-69-0	98.04%
  Mupirocin (BRL-4910A, Pseudomonic acid) is an orally active antibiotic isolated from Pseudomonas fluorescens. Mupirocin apparently exerts its antimicrobial activity by reversibly inhibiting isoleucyl-transfer RNA, thereby inhibiting bacterial protein and RNA synthesis[1][2].

  

• HY-B2232

  Benzalkonium (chloride) (51% in water)	8001-54-5
  Benzalkonium (Alkyldimethylbenzylammonium) chloride (51% in water) is a potent anti-microbial agent, used as a preservative in eye drops.

  

• HY-100575

  Acriflavine	8048-52-0
  Acriflavine (Acriflavinium chloride) is a fluorescent acridine dye that can be used to label nucleic acid. Acriflavine is an antiseptic agent. Acriflavine is a potent HIF-1 inhibitor that prevents the dimerization of HIF-1α and HIF-1β subunits. Acriflavine inhibits the interaction between monocarboxylate transporter 4 (MCT4) and Basigin. Acriflavine is used in cancer research, such as breast cancer, brain tumor and chronic myeloid leukemia. Acriflavine is a potent papain-like protease (PLpro) inhibitor, which inhibits SARS-CoV-2[1][2][3][4][5][6].

  

• HY-112853

  Fosmidomycin sodium salt	66508-37-0
  Fosmidomycin sodium salt is a phosphonic acid antibiotic and a antimalarial agent, which is active against both Gram-negative and Gram-positive bacteria.

  

• HY-119293

  K777	233277-99-1
  K777 is a potent, orally active and irreversible cysteine protease inhibitor. K777 is also a potent CYP3A4 inhibitor with an IC50 of 60 nM and a selective CCR4 antagonist featuring the potent chemotaxis inhibition. K777 irreversibly inhibits Cruzain, the major cysteine protease of Trypansoma cruzi, and cathepsins B and L. K777 is a broad-spectrum antiviral by targeting cathepsin-mediated cell entry. K777 inhibits SARS-CoV and EBOV pseudovirus entry with IC50 values of 0.68 nM and 0.87 nM, respectively[1][2][3].

  

• HY-156654

  Ibuzatrelvir	2755812-39-4	99.90%
  Ibuzatrelvir (PF-07817883), a second-generation, orally bioavailable, is SARS-CoV-2 main protease (Mpro and 3CLpro) inhibitor with improved metabolic stability. Ibuzatrelvir has demonstrated pan-human coronavirus antiviral activity and off-target selectivity profile in vitro and in preclinical animal studies. Ibuzatrelvir is well tolerated with a safety profile similar to placebo and prevents viral infection and transmission. Ibuzatrelvir can be used to inhibit COVID-19[1][2][3][4].

  

• HY-112205A

  RR-11a analog	685543-66-2	99.12%
  RR-11a analog is a potent and irreversible inhibitor of Schistosoma mansoni legumain, with an IC50 of 31 nM. RR-11a analog is an aza-Asn derivative and aza-peptide Michael acceptor[1][2].

  

• HY-W010155

  Tryptophol	526-55-6
  Tryptophol is an aromatic alcohol and secondary metabolite produced by microorganisms. Tryptophol induces apoptosis and cleavage of caspase-8. Tryptophol inhibits Cunninghamella blakesleeana biofilm. Tryptophol has anti-phage infection, biofilm formation regulation, anti-inflammatory, hemolytic, sleep induction, temperature change, seizure susceptibility and immune regulation activities. Tryptophol is used in the research of African trypanosomiasis, sleep disorders, epilepsy[1][2][3][4][5][6][7][8][9][10][11][12].

  

• HY-13557

  Ascomycin	104987-12-4
  Ascomycin (Immunomycin; FR-900520; FK520) is an ethyl analog of Tacrolimus (FK506) with strong immunosuppressant properties. Ascomycin is also a macrocyclic polyketide antibiotic with multiple biological activities such as anti-malarial, anti-fungal and anti-spasmodic. Ascomycin prevents graft rejection and has potential for varying skin ailments research[1][2].

  

• HY-12559

  Alisporivir	254435-95-5	98.69%
  Alisporivir (Debio-025) is a cyclophilin inhibitor molecule with potent anti-hepatitis C virus (HCV) activity.

  

• HY-19149

  Ro24-7429	139339-45-0	99.89%
  Ro24-7429 is a potent and orally active HIV-1 transactivator protein Tat antagonist. Ro24-7429 is also a runt-related transcription factor 1 (RUNX1) inhibitor. Ro24-7429 has anti-HIV, antifibrotic and anti-inflammatory effects[1][2].

  

• HY-B0509

  Amikacin hydrate	1257517-67-1
  Amikacin hydrate (BAY 41-6551 hydrate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin hydrate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin hydrate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin hydrate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria[1][2].

  

• HY-B1071

  Lasalocid	25999-31-9
  Lasalocid (Lasalocid-A; Ionophore X-537A; Antibiotic X-537A) is an antibacterial and anticoccidial agent used in feed additives.

  

• HY-N0528

  Linarin	480-36-4
  Linarin (Buddleoside) is an orally active and selective inhibitor of acetylcholinesterase (AChE). Linarin has many activities, such as anti-inflammatory, antioxidant, sleep aid and sedation, bone differentiation, anti-tumor, antibacterial and antiviral. Linarin can be used to study diseases such as the nervous system, osteoporosis and cancer[1][2][3][4].

  

• HY-N7364

  (E)-β-Farnesene	18794-84-8	99.92%
  (E)-β-Farnesene (trans-β-Farnesene) is an aphid alarm pheromone, which can be found in Phlomis aurea Decne essential oil. (E)-β-Farnesene shows good binding score with a value of -30.64 kcal/mol to the CDK2 receptor. (E)-β-Farnesene also exhibits good affinity to odorant-binding protein 3 (OBP3). (E)-β-Farnesene can be used as a feeding stimulant for the sand fly Lutzomyia longipalpis[1][2][3][4].

  

• HY-P0012

  Aviptadil	40077-57-4	99.87%
  Aviptadil is an analog vasoactive intestinal polypeptide (VIP) with potent vasodilatory effects. Aviptadil induces pulmonary vasodilation and inhibits vascular SMCs proliferation, platelet aggregation. Aviptadil can be used for the research of pulmonary fibrosis, pulmonary arterial hypertension (PAH) and SARS-CoV-2 caused respiratory failure, et al[1][2][3][4][5].

  

• HY-P2322

  Iturin A	52229-90-0
  Iturin A is a cyclic lipid peptide with strong antifungal activity. Iturin A induces ROS explosion and induces apoptosis and autophagy in tumor cells. Iturin A has antitumor activity[1][2].

  

• HY-Y0264

  4-Hydroxybenzoic acid	99-96-7
  4-Hydroxybenzoic acid, a phenolic derivative of benzoic acid, could inhibit most gram-positive and some gram-negative bacteria, with an IC50 of 160 μg/mL.

  

• HY-125798

  2,3-Dehydro-2-deoxy-N-acetylneuraminic acid	24967-27-9
  N-acetyl-2,3-dehydro-2-Deoxyneuraminic Acid (Neu5Ac2en) is a potent neuraminidase (sialidase) inhibitor. N-acetyl-2,3-dehydro-2-Deoxyneuraminic Acid shows inhibitory activities against human neuraminidase enzymes with IC50s of 143, 43, 61, and 74 μM for NEU1, NEU2, NEU3, and NEU4, respectively. Anti-influenza virus activity[1][2].

  

• HY-139092

  IL-4-inhibitor-1	1332184-63-0
  IL-4-inhibitor-1 (compound 52) is an IL-4 inhibitor, with an EC50 of 1.81 µM[1].

  

• HY-14865C

  Omadacycline hydrochloride	1196800-39-1	99.47%
  Omadacycline (PTK 0796) hydrochloride, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline hydrochloride acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline hydrochloride possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline hydrochloride can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections[1][2][3][4].

  

• HY-W145521

  β-1,3-Glucan	9051-97-2	98.18%
  β-1,3-Glucan (β Glucan) is an orally active polysaccharide composed of glucose polymers. β-1,3-Glucan increase the activity of IKKβ kinase, enhances the production of nitric oxide. β-1,3-Glucan improves resistance to Vibrio harveyi infection. β-1,3-Glucan enhances immune response, promotes blood pressure recovery, reduces lung, kidney and liver damage, inhibits the growth of syngeneic tumors[1][2][3][4][5][6][7][8].

  

• HY-15287A

  Nelfinavir Mesylate	159989-65-8	98.93%
  Nelfinavir Mesylate (AG 1343 Mesylate) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir Mesylate (AG 1343 Mesylate) is a broad-spectrum, anticancer agent[1][2][3].

  

• HY-129111

  EACC	864941-31-1	99.49%
  EACC is a reversible autophagy inhibitor, which can block autophagic flux. EACC selectively inhibits the translocation of autophagosome-specific SNARE Stx17 thereby blocking autophagosome-lysosome fusion[1].

  

• HY-B0210A

  Cefoperazone sodium salt	62893-20-3	99.72%
  Cefoperazone sodium salt (CP 52640-2), a semisynthetic cephalosporin, has a broad spectrum of antibacterial activity[1].

  

• HY-A0090

  Nitrofurantoin	67-20-9	99.95%
  Nitrofurantoin is a potent and orally active broad-spectrum beta-lactamase antimicrobial agent. Nitrofurantoin acts as an antibiotic and can be used for the study of urinary tract infections (UTIs), including cystitis and kidney infections[1].

  

• HY-N0235

  Bakuchiol	10309-37-2
  Bakuchiol is a phytoestrogen that can be obtained from psoralen seeds. Bakuchiol has been proven to be a non-competitive inhibitor of multiple enzymes, including UDP-glucuronosyltransferase 2B7 (UGT2B7) [2] and human carboxylesterase 2 (hCE2) [3], with IC50s values of 40.9 μM and 7.28 μM, respectively. Bakuchiol exhibits significant research and application potential in areas such as anti-inflammatory[5], antibacterial[4], antitumor[1] therapies, as well as drug metabolism regulation.

  

• HY-N0415

  Trigonelline chloride	6138-41-6	99.89%
  Trigonelline chloride is an alkaloid with potential antidiabetic activity that can be isolated from Trigonella foenum-graecum L or Leonurus artemisia. Trigonelline chloride is a potent Nrf2 inhibitor that blocks Nrf2-dependent proteasome activity, thereby enhancing apoptosis in pancreatic cancer cells. Trigonelline chloride also has anti-HSV-1, antibacterial, and antifungal activity, and induces ferroptosis.

  

• HY-N0639

  Punicalin	65995-64-4
  Punicalin is a species that can be isolated from the leaves of Punica granatum. Punicalin is an active molecule against hepatitis b virus (HBV). Punicalin can induce pyroptosis. Punicalin is a Carbonic anhydrase inhibitor. Punicalin blocks the binding of S-glycoprotein and ACE2 receptors. Pnuicalin has anti-inflammatory, antioxidant and antiviral activity[1][2][3][4][5][6][7].

  

• HY-N3006

  Sakuranetin	2957-21-3
  Sakuranetin is a cherry flavonoid phytoalexin, shows strong antifungal activity[1]. Sakuranetin has anti-inflammatory and antioxidative activities. Sakuranetin ameliorates LPS-induced acute lung injury[2].

  

• HY-N8393

  Ascr#18	1355681-10-5
  Ascr#18, an ascaroside, is a hormone of nematodes. Ascr#18 is expressed during nematode development. Ascr#18 increases resistance in Arabidopsis, tomato, potato and barley to viral, bacterial, oomycete, fungal and nematode infections[1].

  

• HY-N8573

  β-Phellandrene	555-10-2
  β-phellandrene is an orally active monocyclic monoterpenes. β-Phellandrene is obtained from Carum petroselinum. β-phellandrene has strong ability to kill pest. β-phellandrene can be used as oil additives, natural pesticides and synthetic materials[1][2].

  

• HY-108527

  CD1530	107430-66-0
  CD1530 is an orally active, selective RARγ agonist and antibacterial agent. CD1530 reduces Smad1/5/8 phosphorylation and overall Smad levels. CD1530 reduces β-catenin, MMP9 protein, and ROS levels. CD1530 exhibits activities such as inhibiting heterotopic ossification, promoting Achilles tendon healing, and inhibiting muscle fatty infiltration. CD1530 can be used in the research of orthopedic diseases (such as heterotopic ossification, Achilles tendon injury), muscle diseases (such as muscle fatty infiltration-related diseases)[1][2][3][4][5][6].

  

• HY-145669

  DIF-3	113411-17-9	99.84%
  DIF-3 is an orally active anticancer agent. DIF-3 reduces the expression levels of cyclin D1 and c-Myc by facilitating their degradation via activation of GSK-3β. DIF-3 inhibits Wnt/β-catenin signaling pathway-related proteins in cells. DIF-3 induces reactive oxygen species (ROS) and autophagy. DIF suppresses the growth of Trypanosoma. cruzi in HT1080 cells. DIF-3 exerts antitumor effects both in vitro and in vivo[1][2][3][4].

  

• HY-A0203A

  Pentosan Polysulfate (Sodium) (W/W 43%)	140207-93-8
  Pentosan Polysulfate Sodium is an orally bioavailable, semi-synthetic medication with anti-inflammatory and pro-chondrogenic properties. Pentosan Polysulfate Sodium also is a potent and selective anti-HIV agent. Pentosan Polysulfate Sodium is used for the treatment of interstitial cystitis[1][2][3].

  

• HY-14908

  Vidofludimus	717824-30-1	99.14%
  Vidofludimus is an orally active inhibitor for dihydroorotate dehydrogenase (DHODH) and also is a novel modulator for farnesoid X receptor (FXR). Vidofludimus, as an immunomodulatory agent, can be used for the research of autoimmune disorders such as inflammatory bowel disease (IBD). Vidofludimus also can be used for the research of fatty liver by targeting FXR[1][2][3].

  

• HY-15306A

  Eltrombopag Olamine	496775-62-3
  Eltrombopag Olamine (Eltrombopag diethanolamine salt) is an orally active thrombopoietin receptor nonpeptide agonist. Eltrombopag Olamine owns thrombopoietic activity, and has been used to research low blood platelet counts with chronic immune thrombocytopenia. Eltrombopag Olamine can be used for the research of cardiovascular. Eltrombopag Olamine also has highly inhibitory effects against multidrug resistant Staphylococcus aureus. Eltrombopag Olamine can induce apoptosis in hepatocellular carcinomab (HCC) as well[1][2][3][4][5].

  

• HY-14532

  Brincidofovir	444805-28-1
  Brincidofovir (CMX001), the lipid-conjugated prodrug of Cidofovir (HY-17438), is an orally available, long-acting antiviral. Brincidofovir shows activity against a broad spectrum of DNA viruses including cytomegalovirus (CMV), adenovirus (ADV), varicella zoster virus, herpes simplex virus, polyomaviruses, papillomaviruses, poxviruses, and mixed double-stranded DNA virus infections. Brincidofovir, an oral antiviral in late stage development, has proven effective against orthopoxviruses in vitro and in vivo.[1][2][3][4].

  

• HY-A0086

  Netilmicin sulfate	56391-57-2
  Netilmicin (Sch 20569) sulfate is a broad-spectrum semisynthetic aminoglycoside antibiotic. Netilmicin sulfate exhibits antibacterial activity against aminoglycoside-susceptible gram-negative strains and aminoglycoside-resistant strain, such as Escherichia coli, Pseudomonas aeruginosa, Proteus, Staphylococcus aureus, Streptococcus, Serratia, and Enterobacter, with MIC of 0.125-8 μg/mL[1].

  

• HY-A0106

  Levamisole	14769-73-4	99.96%
  Levamisole ((-)-Levamisole), an anthelmintic agent with immunomodulatory properties. Levamisole acts as a positive allosteric modulator (PAM) for the α3β2 (EC50=300 μM) and α3β4 (EC50=100 μM) subtype of nAChRs. Orally active[1][2].

  

• HY-B0125

  Ofloxacin	82419-36-1	99.95%
  Ofloxacin (Hoe-280) is a fluoroquinolone whose primary mechanism of action is inhibition of bacterial DNA gyrase. Ofloxacin shows inhibitory activity against vaccinia virus (VV).

  

• HY-N0736

  Coptisine chloride	6020-18-4	99.73%
  Coptisine chloride is an alkaloid from Chinese goldthread, and acts as an efficient uncompetitive IDO inhibitor with a Ki value of 5.8 μM and an IC50 value of 6.3 μM. Coptisine chloride is a potent H1N1 neuraminidase (NA-1) inhibitor with an IC50 of 104.6?μg/mL and can be used for influenza A (H1N1) infection.

  

• HY-15872A

  FTI-277 hydrochloride	180977-34-8	98.29%
  FTI-277 hydrochloride is an inhibitor of farnesyl transferase (FTase); a highly potent Ras CAAX peptidomimetic which antagonizes both H- and K-Ras oncogenic signaling. FTI-277 hydrochloride can inhibit hepatitis delta virus (HDV) infection.

  

• HY-30219

  D-​(+)​-​Phenyllactic acid	7326-19-4	99.93%
  D-​(+)​-​Phenyllactic acid is an anti-bacterial agent, excreted by Geotrichum candidum, inhibits a range of Gram-positive from humans and foodstuffs and Gram-negative bacteria found in humans[1].

  

• HY-B0806

  Proguanil	500-92-5	99.84%
  Proguanil, an antimalarial proagent, is metabolized to the active metabolite Cycloguanil (HY-12784). Proguanil is a dihydrofolate reductase (DHFR) inhibitor[1][2].

  

• HY-N6727

  Gliotoxin	67-99-2
  Gliotoxin is a secondary metabolite, the most abundant mycotoxin secreted by A. fumigatus, inhibits the phagocytosis of macrophages and the immune functions of other immune cells [1]. Gliotoxin inhibits inducible NF-κB activity by preventing IκB degradation, which consequently induces host-cell apoptosis[2]. Gliotoxin activates PKA and increases intracellular cAMP concentration; modulates actin cytoskeleton rearrangement to facilitate A. fumigatus internalization into lung epithelial cells[3]. Gliotoxin is a potent NOTCH2 transactivation inhibitor, can effectively induce apoptosis of chronic lymphocytic leukemia (CLL) cells[4].

  

• HY-101985

  BV02	292870-53-2
  BV02 is a 14-3-3 inhibitor and an antibacterial agent. BV02 enhances the cleavage of PARP and caspase-3. BV02 induces Apoptosis, Autophagy, and enhances Akt activation. BV02 has anti-B. melitensis infection and epilepsy-promoting effects. BV02 can also be used in colitis research.

  

• HY-103353

  SID 26681509	958772-66-2
  SID 26681509 is a potent, reversible, competitive, and selective inhibitor of human cathepsin L with an IC50 of 56 nM. SID 26681509 inhibits in vitro propagation of malaria parasite Plasmodium falciparum and inhibits Leishmania major with IC50s of 15.4 μM and 12.5 μM, respectively. SID 26681509 shows no inhibitory activity against cathepsin G[1].

  

• HY-106634

  Mitoguazone	459-86-9	99.33%
  Mitoguazone (Methylglyoxal-bis(guanylhydrazone)) is a synthetic polycarbonyl derivative with potent antineoplastic activity. Mitoguazone is a brain-penetrant and competitive S-adenosyl-methionine decarboxylase (SAMDC) inhibitor that disrupts polyamine biosynthesis. Mitoguazone induces cell apoptosis. Mitoguazone inhibits HIV DNA integration into the cellular DNA in both monocytes and macrophages. Mitoguazone has the potential for acute leukemia, Hodgkin's and non-Hodgkin's lymphoma treatment[1][2][3][4].

  

• HY-107421

  Prostratin	60857-08-1	99.80%
  Prostratin, a natural terpenoid compound, is a PKC activator, with a Ki of 12.5 nM and shows inhibitory effect on HIV-1.

  

• HY-108547

  Alexidine dihydrochloride	1715-30-6
  Alexidine dihydrochloride is an anticancer agent that targets a mitochondrial tyrosine phosphatase, PTPMT1, in mammalian cells and causes mitochondrial apoptosis. Alexidine dihydrochloride has antifungal and antibiofilm activity against a diverse range of fungal pathogens[1].

  

• HY-136465

  A2ti-1	570390-00-0	99.78%
  A2ti-1 is a selective and high-affinity annexin A2/S100A10 heterotetramer (A2t) inhibitor with an IC50 of 24 μM[1]. A2ti-1 specifically disrupts the protein-protein interaction (PPI) between A2 and S100A10. A2ti-1 prevents human papillomavirus type 16 (HPV16) infection[2].

  

• HY-W041892

  Dimethyl itaconate	617-52-7
  Dimethyl itaconate induces innate immune memory (trained immunity), and exhibits immunomodulatory property. Dimethyl itaconate inhibits the activation of microglia, reduces the neuroinflammation and synaptic structural damage. Dimethyl itaconate regulates the composition of intestinal flora[1][2].

  

• HY-15148

  Tipranavir	174484-41-4
  Tipranavir (PNU-140690) inhibits the enzymatic activity and dimerization of HIV-1 protease, exerts potent activity against multi-protease inhibitor (PI)-resistant HIV-1 isolates with IC50s of 66-410 nM[1][2]. Tipranavir inhibits SARS-CoV-2 3CLpro activity[3].

  

• HY-10238

  Danoprevir	850876-88-9
  Danoprevir (ITMN-191) is an orally active NS3/4A protease inhibitor for hepatitis C virus (HCV) with an IC50 of 0.29 nM and is selective for NS3/4A over a panel of 53 proteases (IC50 higher than 10 μM). Danoprevir (ITMN-191) inhibits HCV genotypes 1a, 1b, 4, 5, and 6 (IC50s=0.2-0.4 nM) as well as 2b and 3a (IC50s=1.6, 3.5 nM)[1][2]. Danoprevir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 0.05 μM[3].

  

• HY-14904A

  Umifenovir hydrochloride	131707-23-8	99.86%
  Umifenovir hydrochloride is a potent, orally active broad-spectrum antiviral with activity against a number of enveloped and non-enveloped viruses. Umifenovir hydrochloride is used as an anti-influenza virus agent. Umifenovir hydrochloride could effectively inhibit the fusion of virus with host cells[1][2]. Umifenovir hydrochloride is an efficient inhibitor of SARS-CoV-2 in vitro. Anti-inflammatory activity[3].

  

• HY-19892A

  Brilacidin tetrahydrochloride	1224095-99-1	98.75%
  Brilacidin tetrahydrochloride (PMX 30063 tetrahydrochloride) is an anti-infective antimicrobial with MIC90s of 1 and 8 μg/mL for Gram-positive bacteria Streptococcus pneumonia and Streptococcus viridans, and MIC90 of 8 and 4 μg/mL for Gram-negative bacteria Haemophilus influenza and Pseudomonas aeruginosa. Brilacidin tetrahydrochloride is a defensin mimetic antibiotic compound[1][2].

  

• HY-126303C

  GS-443902 trisodium	1355050-21-3	99.98%
  GS-443902 trisodium (GS-441524 triphosphate trisodium) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC50s of 1.1 μM, 5 μM for RSV RdRp and HCV RdRp, respectively. GS-443902 trisodium is the active triphosphate metabolite of Remdesivir (GS-5734)[1][2].

  

• HY-17574

  Thio-TEPA	52-24-4
  Thio-TEPA is a DNA alkylating agent, with antitumor activity.

  

• HY-B1159

  Nitroxoline	4008-48-4	99.90%
  Nitroxoline (8-Hydroxy-5-nitroquinoline), an antibiotic, is an orally active antibiofilm agent. Nitroxoline reduces the formation and induces the dispersal of Pseudomonas aeruginosa biofilms by chelation of iron and zinc. Nitroxoline can be used for the urinary tract infections and cancer research[1][2][3].

  

• HY-109509

  Enoxaparin	679809-58-6
  Enoxaparin (PK 10169), a low-molecular-weight heparin (LMWH) derivative. Enoxaparin exerts anticoagulant activity through antithrombin III, an endogenous inhibitor of factor Xa and thrombin IIa. Enoxaparin protect the rat hippocampus against TBI (traumatic brain injury) via antioxidant and anti-inflammatory properties. Enoxaparin can be used for the research of deep vein thrombosis (DVT), pulmonary embolism, TBI and COVID-19[1][2][3].

  

• HY-146246

  EIDD-2749	1613589-24-4	99.85%
  EIDD-2749 (4'-Fluorouridine) is an orally active RdRp inhibitor. EIDD-2749 effectively blocks the replication of RSV and SARS-CoV-2. EIDD-2749 also exhibits activity against HCV and lymphocytic choriomeningitis virus (LCMV). EIDD-2749 is a promising oral therapeutic candidate for COVID-19 and is also suitable for research on other RNA viruses[1][2][3].

  

• HY-B0402A

  Amantadine hydrochloride	665-66-7
  Amantadine (1-Adamantanamine) hydrochloride is an orally avtive and potent antiviral agent with activity against influenza A viruses. Amantadine hydrochloride inhibits several ion channels such as NMDA and M2, and also inhibits Coronavirus ion channels. Amantadine hydrochloride also has anti-orthopoxvirus and anticancer activity. Amantadine hydrochloride can be used for Parkinson's disease, postoperative cognitive dysfunction (POCD) and COVID-19 research[1][2][3][4][5][6].

  

• HY-B0479

  Thiamphenicol	15318-45-3	99.63%
  Thiamphenicol (Thiophenicol), a methyl-sulfonyl derivative of Chloramphenicol, is a broad-spectrum antimicrobial antibiotic. Thiamphenicol acts by binding to the 50S ribosomal subunit, leading to inhibition of protein synthesis and bacteriostatic effect (against Gram-negative, Gram-positive aerobic and anaerobic bacteria)[1][2].

  

• HY-B1327

  Chlortetracycline hydrochloride	64-72-2
  Chlortetracycline hydrochloride (7-Chlorotetracycline hydrochloride) is an orally active, effective and selectively methanogenic bacteria inhibitor with bactericidal effects. Chlortetracycline hydrochloride is also a antibiotic that acts by inhibiting bacterial protein synthesis. Additionally, Chlortetracycline hydrochloride is a specific and potent calcium ionophore antibiotic, inhibiting binding of aminoacyl-tRNA to ribosomes[1][2][3][4].

  

• HY-N1451

  Betulonic acid	4481-62-3
  Betulonic acid (Betunolic acid), a naturally occurring triterpene, is found in many plants. Betulonic acid has anti-tumor, anti-inflammatory, antiparasitic and anti-viral (HSV-1) activities[2][1][3][4].

  

• HY-113135

  5-Methylcytidine	2140-61-6
  5-Methylcytidine is a nucleoside compound. 5-Methylcytidine has antiviral activity, and its IC50 against HSV-1 is 0.06 μM[1][2].

  

• HY-147092

  Oryzalin	19044-88-3	99.62%
  Oryzalin is a dinitroaniline herbicide with antimitotic and antileishmanial activities. Oryzalin can bind to plant tubulin, inhibit the polymerization of microtubules in plant cells, and affect chromosome migration. Oryzalin can also be used to induce chromosome doubling[1][2][3].

  

• HY-148104

  ACSS2-IN-2	2332820-04-7	99.49%
  ACSS2-IN-2 is an acyl-CoA synthetase short-chain family member 2 (ACSS2) inhibitor. ACSS2-IN-2 can inhibit ACSS2 activity with an IC50 value of 3.8 nM. ACSS2-IN-2 can be used for the research of several diseases, such as viral infection, metabolic disorders, neuropsychiatric diseases, inflammatory/autoimmune conditions and cancer[1].

  

• HY-15232A

  Tenofovir alafenamide fumarate	379270-38-9	99.87%
  Tenofovir alafenamide fumarate (GS-7340 fumarate) is an investigational oral proagent of Tenofovir. Tenofovir is a HIV-1 nucleotide reverse transcriptase inhibitor.

  

• HY-N2037A

  Higenamine hydrochloride	11041-94-4
  Higenamine hydrochloride is a selective LSD1 inhibitor (IC50=1.47 μM) that can be isolated from aconite. Higenamine hydrochloride has anti-inflammatory and antibacterial activity. Higenamine (Norcoclaurine) can attenuate IL-1β-induced Apoptosis through ROS-mediated PI3K/Akt signaling pathway. Higenamine hydrochloride protects brain cells from oxygen deprivation. Higenamine can promote bone formation in osteoporosis through the SMAD2/3 pathway. Higenamine hydrochloride can be used to study cancer, inflammation, cardiorenal syndrome and other diseases[1][2][3][4][5][6].

  

• HY-W145667

  Mannan	9036-88-8	98.10%
  Mannan is an orally active polysaccharide compound that binds to the mannose receptor (MR). Mannan promotes bacterial uptake and endosomal degradation by binding to MR, thereby enhancing the production of IL-12 in immune cells. Mannan enhances ROS production. Mannan modulates immunity, inhibits Aflatoxin B1 (HY-N6615)-induced toxicity, and reduces lipid[1][2][3][4].

  

• HY-76667

  3-(Boc-amino)propyl bromide	83948-53-2
  3-(Boc-amino)propyl bromide (Compound 13) is an alkylating structural element. 3-(Boc-amino)propyl bromide can be used to synthesize the active anti-HIV ethane-arginine conjugates targeting the viral TAR RNA sequence[1].

  

• HY-108766

  Ponatinib hydrochloride	1114544-31-8	99.76%
  Ponatinib hydrochloride (AP24534 hydrochloride) is a hydrochloride of ponatinib. Ponatinib is an orally active multi-targeted kinase inhibitor with IC50s of 0.37 nM, 1.1 nM, 1.5 nM, 2.2 nM, and 5.4 nM for Abl, PDGFRα, VEGFR2, FGFR1, and Src, respectively[1].

  

• HY-B0356B

  Ciprofloxacin hydrochloride monohydrate	86393-32-0	99.88%
  Ciprofloxacin (Bay-09867) hydrochloride monohydrate is a potent, orally active topoisomerase IV inhibitor. Ciprofloxacin hydrochloride monohydrate induces mitochondrial DNA and nuclear DNA damage and lead to mitochondrial dysfunction, ROS production. Ciprofloxacin hydrochloride monohydrate has anti-proliferative activity and induces apoptosis. Ciprofloxacin hydrochloride monohydrate is a fluoroquinolone antibiotic, exhibiting potent antibacterial activity[1][2][3][4].

  

• HY-14989

  SQ109	502487-67-4
  SQ109 is a potent inhibitor of the trypomastigote form of the parasite, with IC50 for cell killing of 50±8 nM. SQ109, targets MmpL3, is an antitubercular agent.

  

• HY-103095

  Enmetazobactam	1001404-83-6
  Enmetazobactam (AAI101) is an extended-spectrum β-lactamase inhibitor, against many resistant Gram-negative pathogens[1][2].

  

• HY-112579

  Ceftobiprole	209467-52-7
  Ceftobiprole (Ro 63-9141) is a broad-spectrum cephalosporin with high levels of in vitro activity against methicillin- (MRSA) and vancomycin-resistant staphylococci (VRSA) and penicillin-resistant streptococci with a MIC90 value of 2 μg/mL for MRSA. Ceftobiprole also inhibits gram-positive and gram-negative pathogens. Ceftobiprole can be used for the study of hospital-acquired pneumonia (excluding ventilator-associated pneumonia) and community-acquired pneumonia[1][2][3].

  

• HY-90005

  Etravirine	269055-15-4	99.07%
  Etravirine (R165335; TMC125) is a non-nucleoside reverse transcriptase inhibitor (NNRTI) used for the treatment of HIV.

  

• HY-B0489

  Arecoline hydrobromide	300-08-3
  Arecoline hydrobromide, a naturally occurring psychoactive alkaloid, is a partial agonist of nicotinic and muscarinic acetylcholine receptor. Arecoline hydrobromide exhibits stimulation, alertness, anxiolysis and anti-parasitic effects. Arecoline hydrobromide also can induce oxidative stress[1][2][3][4].

  

• HY-N0017

  Bergenin	477-90-7	99.21%
  Bergenin is a cytoprotective and antioxidative polyphenol found in many medicinal plants. Bergenin has a wide spectrum activities such as hepatoprotective, antiinflammatory, immunomodulatory, antitumor, antiviral, and antifungal properties[1][2].

  

• HY-N0040

  Ginsenoside Rb2	11021-13-9
  Ginsenoside Rb2 is one of the main bioactive components of ginseng extracts. Rb2 can upregulate GPR120 gene expression. Ginsenoside Rb2 has antiviral effects.

  

• HY-U00426

  BF738735	1436383-95-7	99.10%
  BF738735 is a phosphatidylinositol 4-kinase III beta (PI4KIIIβ) inhibitor with an IC50 of 5.7 nM.

  

• HY-13516

  Aloperine	56293-29-9
  Aloperine is an alkaloid in sophora plants such as Sophora alopecuroides L, which has shown anti-cancer, anti-inflammatory and anti-virus properties[1]. Aloperine is widely used to treat patients with allergic contact dermatitis eczema and other skin inflammation in China[2]. Aloperine induces apoptosis and autophagy in HL-60 cells[1].

  

• HY-19711

  STING agonist-1	702662-50-8	99.56%
  STING agonist-1 (G10) is human-specific STING agonist that elicits antiviral activity against emerging Alphaviruses. G10 potently blocks replication of Alphavirus species Venezuelan Equine Encephalitis Virus (VEEV) with IC90 of 24.57 μM[1].

  

• HY-D0186

  2'-Deoxyuridine	951-78-0
  2’-deoxyuridine is a brain-penetrant pyrimidines nucleotide that is associated with nervous system diseases. 2'-Deoxyuridine could increase chromosome breakage and results in a decreased thymidylate synthetase activity. 2'-Deoxyuridine is a precursor in the synthesis of Edoxudine (HY-B1011) and also an analogue of 5-ethynyl-2'-deoxyuridine, EdU (HY-118411). 2’-deoxyuridine reduces microglial activation and improve oxidative stress damage by modulating glycolytic metabolism on the Aβ25-35-induced brain injury, which is promising for research of Alzheimer’s disease (AD)[1][2][3].

  

• HY-N0610

  Trans-Cinnamic acid	140-10-3
  trans-Cinnamic acid is a natural antimicrobial, with minimal inhibitory concentration (MIC) of 250 μg/mL against fish pathogen A. sobria, SY-AS1[1].

  

• HY-N6771

  Cyclopiazonic acid	18172-33-3
  Cyclopiazonic acid is an endoplasmic reticulum calcium ATPase (ECAs) inhibitor and human respiratory syncytial virus (RSV) inhibitor (EC50 value of 4.13 μ M), which can reduce the antagonistic effect of 5-HT receptors in rat thoracic aorta, induce p53 dependent cell apoptosis and reproductive toxicity in mouse testes, and inhibit the biological activation of aflatoxin B[1][4][5].

  

• HY-119283

  CAY10499	359714-55-9	99.58%
  CAY10499 (MAGL-IN-5) is a non-selective lipase inhibitor with IC50 values of 144 nM and 14 nM for monoacylglycerol lipase (MAGL) and fatty acid amide hydrolase (FAAH), respectively. Additionally, CAY10499 exhibits anti-inflammatory and antiviral activities[1][2][3][4].

  

• HY-136406

  Bongkrekic acid	11076-19-0
  Bongkrekic acid is a mitochondrial toxin secreted by the bacteria Pseudomonas cocovenenans[1]. Bongkrekic acid specific ligand for mitochondrial adenine nucleotide translocase (ANT) rather than the electron transport chain. Bongkrekic acid has to cross the mitochondrial inner membrane to produce its inhibitory effect on ADP/ATP transport[2].

  

• HY-16561R

  Resveratrol (Standard)	501-36-0	99.73%
  Resveratrol (Standard) is the analytical standard of Resveratrol. This product is intended for research and analytical applications. Resveratrol (trans-Resveratrol; SRT501), a natural polyphenolic phytoalexin that possesses anti-oxidant, anti-inflammatory, cardioprotective, and anti-cancer properties. Resveratrol (SRT 501) has a wide spectrum of targets including mTOR, JAK, β-amyloid, Adenylyl cyclase, IKKβ, DNA polymerase. Resveratrol also is a specific SIRT1 activator[1][2][3][4]. Resveratrol is a potent pregnane X receptor (PXR) inhibitor[5]. Resveratrol is an Nrf2 activator, ameliorates aging-related progressive renal injury in mice model[6]. Resveratrol increases production of NO in endothelial cells[7].

  

• HY-P1222B

  LL-37, human acetate		99.71%
  LL-37, human acetate is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human acetate could help protect the cornea from infection and modulates wound healing[1][2][3].

  

• HY-100198

  PI4KIIIbeta-IN-10	1881233-39-1	99.84%
  PI4KIIIbeta-IN-10 is a potent PI4KIIIβ inhibitor with an IC50 of 3.6 nM.

  

• HY-19952

  Pleconaril	153168-05-9	99.48%
  Pleconaril is a picornavirus capsid binding inhibitor that prevents attachment and/or virus uncoating. Pleconaril has potential for use in rhinoviruses and enteroviruses research[1][2].

  

• HY-116213

  Sparstolonin B	1259330-61-4
  Sparstolonin B acts as a selective TLR2 and TLR4 antagonist and selectively blocks TLR2- and TLR4-mediated inflammatory signaling. Sparstolonin B has anti-HIV and anticancer activities[1][2].

  

• HY-P1674A

  Murepavadin TFA		99.83%
  Murepavadin (POL7080) (TFA), a 14-amino-acid cyclic peptide, is a highly potent, specific antibiotic. Murepavadin exhibits a potent antimicrobial activity for P. aeruginosa with MIC50 and MIC90 values both of 0.12 mg/L. Murepavadin also can target the lipopolysaccharide transport portin D. Murepavadin can be used for the research of bacterial resistance[1][2].

  

• HY-122571

  Retro-2	1201652-50-7
  Retro-2 is a selective inhibitor of retrograde protein trafficking at the endosome-trans-Golgi network interface. Retro-2 is an ebolavirus (EBOV) infection inhibitor with an EC50 of 12.2 µM in HeLa cells. Retro-2 induces cell autophagy[1][2][3].

  

• HY-139602

  (+)-JNJ-A07	2135640-93-4
  (+)-JNJ-A07 is a highly potent, orally active pan-serotype dengue virus inhibitor targeting the NS3-NS4B interaction. (+)-JNJ-A07 exerts nanomolar to picomolar activity against a panel of 21 clinical isolates. (+)-JNJ-A07 has a favourable pharmacokinetic profile that results in outstanding efficacy against dengue virus infection in mouse infection models[1].

  

• HY-17596

  Closantel	57808-65-8
  Closantel is a halogenated salicylanilide with a potent anti-parasitic activity. Closantel is a potent and highly specific Onchocerca volvulus chitinase (OvCHT1) inhibitor with an IC50 of 1.6 μM and a Ki of 468 nM. Closantel inhibits the O. volvulus L3 to L4 molt of developing[1][2].

  

• HY-B0273

  Sulfadiazine	68-35-9	99.93%
  Sulfadiazine is a sulfonamide?antibiotic with antimalarial activity. Sulfadiazine can be used for toxoplasmosis research[1][2].

  

• HY-B0467

  Amoxicillin sodium	34642-77-8	98.23%
  Amoxicillin (Amoxycillin) sodium is an antibiotic with good oral absorption and broad spectrum antimicrobial activity. Amoxicillin sodium inhibits the biosynthesis of polypeptides in the cell wall, thereby inhibiting cell growth[1][2][3].

  

• HY-Y1326

  Sodium metabisulfite	7681-57-4
  Sodium metabisulfite, a sulfite salt, is used as an antioxidant and antimicrobial agent in a variety of drugs and functions as a preservative in many food preparations[1].

  

• HY-114816

  N-Butanoyl-L-homoserine lactone	67605-85-0
  N-Butanoyl-L-homoserine lactone (C4-HSL) is a cleavable ADC linker used in the synthesis of antibody-drug conjugates (ADCs). N-Butanoyl-L-homoserine lactone has antibacterial activity and is used in antibacterial biofilm[1]. N-Butanoyl-L-homoserine lactone aptamers blocks qurom sensing and inhibits biofilm formation in Pseudomonas aeruginosa[2][3].

  

• HY-17003

  Saquinavir mesylate	149845-06-7	99.84%
  Saquinavir (Ro 31-8959) mesylate is an orally active HIV protease inhibitor that can be used in the research of AIDS. Saquinavir mesylate also has anti-inflammatory activity and can induce apoptosis of human red blood cells[1][2][3].

  

• HY-101662

  Pibrentasvir	1353900-92-1	99.94%
  Pibrentasvir is a novel and pan-genotypic hepatitis C virus (HCV) NS5A inhibitor with EC50s ranging from 1.4 to 5.0 pM against HCV replicons containing NS5A from genotypes 1 to 6.

  

• HY-17358

  Loteprednol Etabonate	82034-46-6	99.53%
  Loteprednol etabonate (LE) is an orally active "soft" steroid belonging to a unique class of glucocorticoids. Loteprednol etabonate (LE) exhibits anti-inflammatory activity and has been used in optometry and ophthalmology[1][2][3].

  

• HY-B1248

  Chlorhexidine	55-56-1	98.69%
  Chlorhexidine is a orally active cationic antimicrobial agent that targets microbial cell membranes. Chlorhexidine binds to cell membrane phospholipids non-specifically, destroys membrane structure and induces leakage of cell contents. Chlorhexidine has broad-spectrum bactericidal activity against both Gram-positive and Gram-negative bacteria. Chlorhexidine can interfere with membrane permeability, cause protein precipitation and energy metabolism disorders, such as rapid inhibition of microbial growth and induction of cell death (necrosis or apoptosis)[1][2][3].

  

• HY-B1350

  Fusidic acid	6990-06-3	99.78%
  Fusidic acid (Fusidate) a bacteriostatic antibiotic produced from the Fusidium coccineum fungus, belongs to the class of steroids. Fusidic acid has no corticosteroid effects. Fusidic acid inhibits the growth of bacteria by preventing the release of translation elongation factor G (EF-G) from the ribosome. Fusidic acid holds promise for research in anticancer and anti-infective applications.[1][2][3][4][5].

  

• HY-B1610

  Sodium citrate dihydrate	6132-04-3
  Sodium citrate dehydrate (Trisodium citrate dihydrate) is a natural product with oral activity that can be found in citrus fruits. Sodium citrate dehydrate can inhibit the proliferation of tumor cells and induce apoptosis. Sodium citrate dehydrate has antibacterial, anti-tumor and antioxidant activities. Sodium citrate dehydrate can be prepared as a cosolvent or buffer[1][2][3].

  

• HY-N0571

  Purpurin	81-54-9
  Purpurin is a natural anthraquinone compound from Rubia cordifolia L.. Purpurin has antidepressant-like effects[1].

  

• HY-N1441

  Afzelin	482-39-3	99.62%
  Afzelin (Kaempferol-3-O-rhamnoside)It is a flavonol glycoside that has anti-inflammatory, anti-oxidative stress response, anti-apoptotic, and anti-cardiac cytotoxic effects. AfzelinIt can reduce mitochondrial damage, enhance mitochondrial biosynthesis, and reduce mitochondria-related proteins. Parkinand PTENinduced putative kinase 1 (putative kinase 1)s level. AfzelinCan be improved D-galactosamine(GalN)/LPSSurvival rate of mice treated with doxorubicin prophylaxis (HY-15142A)Induced cardiotoxicity and scopolamine (HY-N0296)-induced neurological injury. AfzelinAlso inhibits asthma and allergies caused by ovalbumin[1][2][3][4].

  

• HY-N2301

  Pleuromutilin	125-65-5
  Pleuromutilin (Drosophilin B) exhibits antibacterial activity through inhibition of protein synthesis[1].

  

• HY-N2360

  Hinokiflavone	19202-36-9
  Hinokiflavone is a novel modulator of pre-mRNA splicing activity extracted from plants with anti-inflammatory, anti-tumor and antiviral activities. Hinokiflavone is also a potent inhibitor for matrix metalloproteinases (MMPs). Hinokiflavone attenuates the virulence of Methicillin (HY-121544)-resistant staphylococcus aureus by inhibiting caseinolytic protease P (ClpP) with an IC50 value of 34.36 mg/mL. Hinokiflavone induces apoptosis via the reactive oxygen species-mitochondria-mediated apoptotic pathway and inhibits tumor cell migration and invasion. Hinokiflavone is a SUMO protease inhibitor against sentrin-specific protease 1 (SENP1) activity[1][2][3].

  

• HY-103056

  DDD85646	1215010-55-1	99.72%
  DDD85646 (IMP-366) is an orally active of trypanosoma brucei N-myristoyltransferase (TbNMT IC50=2 nM; hNMT IC50=4 nM). The enzyme N-myristoyltransferase (NMT) is a potential agent target for human African trypanosomiasis[1][2][3][4].

  

• HY-117626

  LP-935509	1454555-29-3	99.74%
  LP-935509 is an orally active, potent, selective, ATP-competitive and brain-penetrant inhibitor of adaptor protein-2 associated kinase 1 (AAK1) with an IC50 of 3.3 nM and a Ki of 0.9 nM, respectively. LP-935509 is also a potent inhibitor of BIKE (IC50=14 nM) and a modest inhibitor of GAK (IC50=320 nM). LP-935509 shows antinociceptive activity. LP-935509 can be used for neuropathic pain and SARS-CoV-2 research[1].

  

• HY-122975

  Metronidazole Benzoate	13182-89-3	99.92%
  Metronidazole Benzoate, derives from a metronidazole and a benzoic acid, has a role as an antibacterial, antimicrobial, antiparasitic, and antitrichomonal agent[1].

  

• HY-B2144C

  Chitosan (≥95% deacetylated,viscosity 100-200 mPa.s)	9012-76-4
  Chitosan (Deacetylated chitin) (≥95% deacetylated,viscosity 100-200 mPa.s) is a polysaccharide obtained by deacetylating chitin, and exhibits antimicrobial activity against various bacteria and fungi[1][2].

  

• HY-W009168

  Tazobactam sodium	89785-84-2	99.74%
  Tazobactam sodium is an antibiotic of the beta-lactamase inhibitor class. Ceftolozane combines with Tazobactam, extends the activity of ceftolozane against many ESBL-producing Enterobacteriaceae and some Bacteroides spp..

  

• HY-B1008

  4-Aminobenzoic acid	150-13-0
  4-Aminobenzoic acid is an intermediate in the synthesis of folic acid by bacteria, plants and fungi. 4-Aminobenzoic acid has antibacterial and plant growth regulating properties[1][2][3].

  

• HY-W013571

  4-Isopropylbenzoic acid	536-66-3
  4-Isopropylbenzoic acid (Cuminic acid; p-Isopropyl benzoic acid) an aromatic monoterpenoid, is isolated from the stem bark of Bridelia retusa. 4-Isopropylbenzoic acid exhibits antifungal activities. 4-Isopropylbenzoic acid is also a reversible and uncompetitive inhibitor of mushroom tyrosinase[1][2].

  

• HY-19488A

  Ribocil-C	1825355-56-3
  Ribocil-C is a highly selective inhibitor of bacterial riboflavin riboswitches.

  

• HY-15440

  Temsavir	701213-36-7	98.06%
  Temsavir (BMS-626529) is a novel attachment inhibitor that targets HIV-1 gp120 and prevents its binding to CD4+ T cells.

  

• HY-A0269

  Mecillinam	32887-01-7
  Mecillinam (Amdinocillin), the β-lactam antibiotic, has a broad spectrum of activity against gram-negative organisms[1].

  

• HY-101950

  KIN1148	1428729-56-9
  KIN1148, a small-molecule IRF3 agonist, is a novel influenza vaccine adjuvant found to enhance flu vaccine efficacy.

  

• HY-78131C

  Ibuprofen sodium	31121-93-4	99.98%
  Ibuprofen ((±)-Ibuprofen) sodium is an orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen sodium inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen sodium is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen sodium can be used in the research of pain, swelling, inflammation, infection, immunology, cancers[1][2][5][8].

  

• HY-15303

  Pritelivir	348086-71-5	99.94%
  Pritelivir (AIC316), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2[1].

  

• HY-17647

  Zoliflodacin	1620458-09-4
  Zoliflodacin (ETX0914;AZD0914) is a novel spiropyrimidinetrione bacterial DNA gyrase/topoisomerase inhibitor. Zoliflodacin has potent in vitro antibacterial activity against Gram-positive and Gram-negative organisms, including S. aureus with the MIC90 of 0.25 μg/mL.

  

• HY-19618

  BRD3308	1550053-02-5	98.34%
  BRD3308 is a highly selective HDAC3 inhibitor with an IC50 of 54 nM. BRD3308 is 23-fold selectivity for HDAC3 over HDAC1 (IC50 of 1.26 μM) or HDAC2 (IC50 of 1.34 μM). BRD3308 suppresses pancreatic β-cell apoptosis induced by inflammatory cytokines or glucolipotoxic stress, and increases functional insulin release. BRD3308 activates HIV-1 transcription and disrupts HIV-1 latency[1][2][3].

  

• HY-B1246

  Thonzonium bromide	553-08-2	99.86%
  Thonzonium bromide is an antibacterial agent that is structurally similar to Farnesol (HY-Y0248A). Thonzonium bromide is also a monocationic surface-active agent, which inhibits RANKL-induced osteoclast formation and bone resorption in vitro and prevents LPS-induced bone loss in vivo. Thonzonium bromide inhibits proton transport in a dose-dependent manner (EC50=69 μM)[1][2][3].

  

• HY-B1637

  Ditiocarb sodium	148-18-5	98.29%
  Ditiocarb sodium (Sodium diethyldithiocarbamate) is a copper reagent. The reaction with Cu2+ solution resulted in the formation of a complex, which increased the copper displacement precipitation rate. Ditiocarb sodium can reduce HIV infection and can be used in adjuvant immune research of high-risk breast cancer[1][2][3].

  

• HY-D0205A

  Carbocisteine	638-23-3
  Carbocisteine is an orally active mucolytic agent. Carbocisteine attenuates the phosphorylation of NF-κB p65 and ERK1/2. Carbocisteine modulates Nrf2/HO-1 and NFκB interplay. Carbocisteine inhibits Apoptosis. Carbocisteine is used in chronic obstructive pulmonary disease (COPD) research[1][2][3][4][5][6][7][8][9][10][11][12][13].

  

• HY-P0109A

  Z-FA-FMK	197855-65-5
  Z-FA-FMK ((1S)-Z-FA-FMK) is a potent Cathepsin B and L inhibitor. Z-FA-FMK blocks the induction of DEVDase activity, DNA fragmentation, and externalization of phosphatidylserine by selective synthetic retinoid-related molecules (RRMs). Z-FA-FMK inhibits apoptosis. Z-FA-FMK inhibits caspase activity and selectively inhibits recombinant effector caspases 2, -3, -6, and -7. Z-FA-FMK is a viral inhibitor. Z-FA-FMK inhibits reovirus replication in a susceptible host[1][2][3].

  

• HY-P2036A

  FSL-1 TFA		99.65%
  FSL-1 TFA, a bacterial-derived toll-like receptor 2/6 (TLR2/6) agonist, enhances resistance to experimental HSV-2 infection[1]. FSL-1 TFA induces MMP-9 production through TLR2 and NF-κB/AP-1 signaling pathways in monocytic THP-1 cells[2].

  

• HY-W018791

  Bifendate	73536-69-3	99.91%
  Bifendate (DDB), extracted from Schisandrae chinensis, is an orally active anti-HBV agent against chronic hepatitis B. Bifendate inhibits ATG5-dependent autophagy and attenuates oleic acid-induced lipid accumulation with anti-oxidant properties in vitro. Bifendate can decrease alanine transaminase (ALT) level in mice. Bifendate attenuates hepatic steatosis in cholesterol/bile salt- and high-fat diet-induced hypercholesterolemia in mice. Bifendate potently increases the activity of cytochrome proteins (CYPs) and reverse P-gp-mediated multi-drug resistance (MDR)[1][2][3][4][5][6].

  

• HY-W110551

  2-Methacryloyloxyethyl phosphorylcholine	67881-98-5
  2-Methacryloyloxyethyl phosphorylcholine is a polymer monomer containing a phospholipid polar group. 2-Methacryloyloxyethyl phosphorylcholine polymers modify the surface properties of materials and reduce protein-surface interactions, reduce IL-8 production, inhibit cell, Staphylococcus aureus, and Porphyromonas gingivalis adhesion. 2-Methacryloyloxyethyl phosphorylcholine is used in the study of medical device-associated infections, periodontitis, and dental caries[1][2][3][4].

  

• HY-W141881

  N-Lauroylsarcosine	97-78-9	99.81%
  N-lauroylsarcosine is an anionic surfactant. N-lauroylsarcosine has antiviral activity against HSV-2 strain 333 and HSV-1 strain F. N-lauroylsarcosine synergistically increases skin permeability with 25-50% ethanol. N-lauroylsarcosine can be used to study HSV-2 infection[1][2][3][4].

  

• HY-17015

  Peramivir trihydrate	1041434-82-5
  Peramivir trihydrate (RWJ-270201 trihydrate) is a highly potent, selective and orally active influenza virus neuraminidase (NA) inhibitor, with IC50 values ranging from 0.9 to 4.3 nM for nine NA subtypes[1][2][3].

  

• HY-B1322

  Amodiaquine dihydrochloride dihydrate	6398-98-7	99.92%
  Amodiaquine dihydrochloride dihydrate (Amodiaquin dihydrochloride dihydrate), a 4-aminoquinoline class of antimalarial agent, is a potent and orally active histamine N-methyltransferase inhibitor. Amodiaquine dihydrochloride dihydrate is also a Nurr1 agonist and specifically binds to Nurr1-LBD (ligand binding domain) with an EC50 of ~20 μM. Anti-inflammatory effect[1][2][3][4].

  

• HY-10581

  Gatifloxacin	112811-59-3	99.69%
  Gatifloxacin (AM-1155; BMS-206584; PD135432) is a potent fluoroquinolone antibiotic with broad-spectrum antibacterial activity. Gatifloxacin inhibits bacterial type II topoisomerases (IC50=13.8 μg/ml for S. aureus topoisomerase IV) and E. coli DNA gyrase (IC50=0.109 μg/ml)[1]. Gatifloxacin can be used to treat bacterial conjunctivitis in vivo.

  

• HY-114220

  T-2307	873546-31-7	98.41%
  T-2307, an arylamidine, has antifungal activities in vitro and in vivo. T-2307 exhibits broad-spectrum activity against clinically significant pathogens, including Candida species (MIC range, 0.00025 to 0.0078 μg/ml), Cryptococcus neoformans (MIC range, 0.0039 to 0.0625 μg/ml), and Aspergillus species (MIC range, 0.0156 to 4 μg/mL) [1].

  

• HY-150523

  Ristocetin	1404-55-3
  Ristocetin is a glycopeptide antibiotic. Ristocetin induces platelet aggregation. Ristocetin can be used for Research of Von Willebrand’s disease[1][2].

  

• HY-B0364A

  Dyclonine hydrochloride	536-43-6	99.86%
  Dyclonine (Dyclocaine) hydrochloride is an orally effective ALDH covalent inhibitor (crosses blood-brain barrier), with an IC50 of 35 μM for ALDH2 and 76 μM for ALDH3A1. Dyclonine hydrochloride has sensitizing activities for targeted cancer cells and antibacterial. Dyclonine hydrochloride is also a local agent that can suppress or relieve pain. that blocks the transmission of various nerve impulses or stimuli and inhibits the sensation of touch and pain[1][2][3].

  

• HY-108166A

  Hydroxystilbamidine bis(methanesulfonate)	223769-64-0
  Hydroxystilbamidine bis(methanesulfonate) is a dye that can bind to DNA and RNA; it's a fluorescent cationic dye, often used as a retrograde neuronal tracer and has also been found to be a potent inhibitor of cellular ribonucleases.

  

• HY-B0777

  Moxidectin	113507-06-5	99.32%
  Moxidectin (CL301423) is an orally active macrolide (ML) anthelmintic for the prevention and control of heartworms and roundworms. Moxidectin is also a substrate of BCRP and P-glycoprotein (P-gp) in vivo, and is secreted into breast milk and effluxed from the host and parasite mediated by Bcrp1 and P-gp. This may be related to the presence of chemical residues in milk[1][2][3].

  

• HY-124379

  TPCK	402-71-1	98.55%
  TPCK (L-1-Tosylamido-2-phenylethyl chloromethyl ketone; L-TPCK) is an effective serine protease inhibitor and also a blocker of the PDK1/Akt pathway. TPCK can modify the E7 protein in actively keratinocyte cells. TPCK can induce cellular apoptosis, suppress tumor growth, reduce hypoxic-ischemic brain injury in rat pups, and affect vascular permeability in inflamed rats[1][2][3][4][5].

  

• HY-126741

  Azadirachtin	11141-17-6	99.06%
  Azadirachtin is an oral active triterpenoid compound with anticancer, antimalarial, anti-inflammatory, and insecticidal activities. Azadirachtin induces cell apoptosis through the mitochondrial pathway (by inhibiting Bcl-2/Bax ratio or activating Apaf-1 and caspase-3) or through death receptors (by inhibiting TNFR activation). Additionally, Azadirachtin exerts its anti-inflammatory effects by inhibiting NF-кB signaling pathway activation, and it exhibits insecticidal activity by inducing apoptosis in insect cells[1][2][3][4][5][6].

  

• HY-A0276A

  Gentamicin	1403-66-3
  Gentamicin, an orally active aminoglycoside antibiotic, inhibits the growth of both gram-positive and gram-negative bacteria and to inhibit several strains of mycoplasma in tissue culture. Gentamicin inhibits DNase I with an IC50 of 0.57 mM[1][2][3][4].

  

• HY-B0510C

  Trimethoprim lactate	23256-42-0	99.97%
  Trimethoprim lactate is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim lactate is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim lactate has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim lactate can inhibit infection of Influenza A virus in chick embryo when combinated with zinc[1][2][3][4].

  

• HY-N10473

  Pulcherriminic acid	957-86-8
  Pulcherriminic acid is a cyclic dipeptide antimicrobial agent with high affinity for Fe3+, found mainly in Bacillus and yeast. Pulcherriminic acid chelates iron ions through a non-enzymatic reaction to form the extracellular red pigment pulcherrimin, which competes for iron nutrition and thus achieves an antibacterial effect. Pulcherriminic acid has great applications in food, agriculture and medical industries[1][2].

  

• HY-W016586A

  Acivicin hydrochloride	161922-40-3	99.14%
  Acivicin hydrochloride (AT-125 hydrochloride), a natural product produced by Streptomyces sviceus, is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin hydrochloride can across the blood-brain barrier and has anti-cancer, anti-parasitic properties[1][2].

  

• HY-B1150

  Clofoctol	37693-01-9	99.93%
  Clofoctol is a bacteriostatic antibiotic. Clofoctol is used in the treatment of respiratory tract and ear, nose and throat infections caused by Gram-positive bacteria. Clofoctol is only functional against Gram-positive bacteria and can penetrate into human lung tissue. Clofoctol is also an inhibitor of prostate cancer. Clofoctol has antiviral potency[1][2][3].

  

• HY-W016473

  Adamantane-carboxylic acid	828-51-3
  Adamantane-carboxylic acid is a compound with inhibitory activity against microorganisms. Although its specific target has not been clearly defined, it can inhibit Gram-positive bacteria and some Gram-negative bacteria. It forms a 1-monoacylglycerol derivative through a direct reaction with glycidol, and exerts its antibacterial effect by mechanisms such as altering the permeability of the bacterial cell membrane. This compound can be used in the research of antibacterial agents in the food and cosmetic industries to reduce harmful microbial flora and extend the shelf life of products[1][2].

  

• HY-17367

  Atazanavir	198904-31-3	99.86%
  Atazanavir (BMS-232632) is a highly selective and orally active HIV-1 protease inhibitor . Atazanavir is a substrate and inhibitor of CYP3A4, and an inhibitor of P-glycoprotein (P-gp). Atazanavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 3.49 μM. Atazanavir inhibits cardiac fibrosis, hyperlipidemia and induces malignant glioma death[1][2][3][4][5][6][7][8].

  

• HY-15511

  Tyrphostin A9	10537-47-0
  Tyrphostin A9, a PDGFR inhibitor, is a potent inducer of mitochondrial fission. Tyrphostin A9 emerged as the most potent and selective of 51 tyrosine kinase inhibitors tested against the TNF-induced respiratory burst. Tyrphostin A9 has anti-influenza virus activities.

  

• HY-107775

  Ganfeborole hydrochloride	2131798-13-3	99.97%
  Ganfeborole hydrochloride (GSK656) is a potent antitubercular agent, acting as an inhibitor of Mycobacterium tuberculosis (Mtb) leucyl-tRNA synthetase (LeuRS), with an IC50 of 0.2 μM.

  

• HY-15460

  CHIR-090	728865-23-4	98.58%
  CHIR-090 is a potent, slow, tight-binding inhibitor of the LpxC deacetylase. It binds to E. coli LpxC with a Ki of 4.0 nM. CHIR-090 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-B0425

  Novobiocin	303-81-1
  Novobiocin (Albamycin) is a potent and orally active antibiotic. Novobiocin also is a DNA gyrase inhibitor and a heat shock protein 90 (Hsp90) antagonist. Novobiocin has the potential for the research of highly beta-lactam-resistant pneumococcal infections. Novobiocin shows anti-orthopoxvirus activity[1][2][3][4][6].

  

• HY-N0591

  Dehydrocostus Lactone	477-43-0	99.97%
  Dehydrocostus Lactone ((-)-Dehydrocostus lactone) is a natural sesquiterpene that can be isolated from Saussurea lappa. Dehydrocostus Lactone has multiple activities such as anti-inflammatory, antibacterial, anti-tumor, and immunomodulatory effects. Dehydrocostus Lactone has an MIC of 2 µg/mL against Mycobacterium tuberculosis. Dehydrocostus Lactone can also inhibit the killing activity of cytotoxic T lymphocytes and induce apoptosis in tumor cells[1][2][3][4].

  

• HY-B0698A

  Ceftibuten dihydrate	118081-34-8
  Ceftibuten (Sch-39720) dihydrate, an antibiotic, is an orally active cephalosporin, possesses potent activity in vitro against a wide range of gram-negative and certain gram-positive pathogens[1][2].

  

• HY-B0856

  Validamycin A	37248-47-8
  Validamycin A, a fungicidal, is an agricultural antibiotic. Validamycin A is originally isolated from Streptomyces hygroscopicus var. limoneus. Validamycin A inhibits the growth of A. flavus, with a MIC of 1?μg/mL[1]. Validamycin A shows potent inhibitory activity against trehalase of Rhizoctonia solani, with an IC50 of 72 μM[2]. Validamycin A is a reversible tyrosinase inhibitor, with a Ki of 5.893 mM[3].

  

• HY-N1579

  Pyrogallol	87-66-1
  Pyrogallol is a polyphenol compound, which has anti-fungal and anti-psoriatic properties. Pyrogallol is a reductant that is able to generate free radicals, in particular superoxide anions.

  

• HY-N6712

  Thiolutin	87-11-6
  Thiolutin (Acetopyrrothin) is a disulfide-containing antibiotic and anti-angiogenic compound produced by Streptomyces. Thiolutin inhibits the JAMM metalloproteases Csn5, Associated-molecule-with-the-SH3-Domain-of-STAM (AMSH) and Brcc36[1]. Thiolutin is a potent and selective inhibitor of endothelial cell adhesion accompanied by rapid induction of Heat-shock protein beta-1 (Hsp27) phosphorylation[2].

  

• HY-Y0569

  D-Gluconic acid (solution) (51.205% in water)	526-95-4
  D-Gluconic acid is the carboxylic acid by the oxidation with antiseptic and chelating properties.

  

• HY-113219

  Hydroxyphenyllactic acid	306-23-0	99.95%
  Hydroxyphenyllactic acid is an antifungal metabolite.

  

• HY-14749A

  Pyronaridine tetraphosphate	76748-86-2
  Pyronaridine tetraphosphate is an orally active Mannich base anti-malarial agent. Pyronaridine tetraphosphate is active against P. falciparum and Echinococcus granulosus infection[1][2].

  

• HY-17390A

  Loxapine succinate	27833-64-3	98.84%
  Loxapine succinate is an orally active dopamine inhibitor, 5-HT receptor antagonist and also a dibenzoxazepine anti-psychotic agent. Loxapine can also suppresses bacterial efflux pump activity and inhibit intracellular multiple-antibiotic-resistant Salmonella enterica serovar Typhimurium in macrophages[1][4][6].

  

• HY-116282A

  Dextran sulfate sodium salt (MW 4500-5500)	9011-18-1
  Dextran sulfate sodium salt (DSS) (MW 4500-5500) is a polymer of dehydrated glucose with a molecular weight of approximately 4500-5500. Dextran sulfate sodium salt with different molecular weights exhibits different biological activities. Dextran sulfate sodium salt (MW 4500-5500) is an inhibitor of complement and coagulation pathways, and belongs to the glycosaminoglycans (GAG) family. Dextran sulfate sodium salt (MW 4500-5500) acts as an anticoagulant, antiviral, and anti-lipemic agent. Dextran sulfate sodium salt (MW 4500-5500) stops HIV-1 virus adsorption to host cells. Dextran sulfate sodium salt (MW 4500-5500) prevents NK cell-mediated cytotoxicity. Dextran sulfate sodium salt (MW 4500-5500) inhibits instant blood-mediated inflammatory reaction (IBMIR)[1][2][3][4][5].

  

• HY-N1428S1

  Citric acid-13C6	287389-42-8
  Citric acid-13C6 is the 13C-labeled Citric acid (HY-N1428). Citric acid is a natural preservative and food tartness enhancer. Citric acid induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-B0803

  Lumefantrine	82186-77-4
  Lumefantrine is an active antimalarial molecule used in combination with Artemether as a first- and second-line antimalarial drug with oral activity[1][2].

  

• HY-17015A

  Peramivir	330600-85-6	99.32%
  Peramivir is an novel cyclopentane neuraminidase inhibitor of influenza virus. Peramivir has antiviral activity and anti-cytokines stom effects. Peramivir can be used for the research of COVID-19[1][2][3].

  

• HY-15278

  Epothilone D	189453-10-9
  Epothilone D (KOS 862) is a potent microtubule stabilizer.

  

• HY-16727

  Presatovir	1353625-73-6
  Presatovir (GS-5806) is an orally bioavailable RSV fusion inhibitor with a mean EC50 value of 0.43 nM[1].

  

• HY-14648C

  Dexamethasone (Water Soluble)	50-02-2
  Dexamethasone (Hexadecadrol) Water Soluble is a water-soluble form of Dexamethasone (HY-14648). Dexamethasone is a glucocorticoid receptor agonist, apoptosis inducer, and a common disease inducer in experimental animals. It can be used to construct models of muscle atrophy, hypertension, and depression. Dexamethasone can inhibit the production of inflammatory miRNA-155 exosomes in macrophages and significantly reduce the expression of inflammatory factors in neutrophils and monocytes. Dexamethasone also has the potential to be used in COVID-19 research[1].

  

• HY-13560

  AVN-944	297730-17-7	99.89%
  AVN-944 (VX-944) is an orally active, potent, selective, noncompetitive and specific inhibitor of IMPDH (inosine monophosphate dehydrogenase). AVN-944 is an essential rate-limiting enzyme in de novo guanine nucleotide synthesis. AVN-944 is also an inhibitor of arenavirus RNA synthesis, and blocks arenavirus infection. AVN-944 has broad anti-cancer activities, and can be used for multiple myeloma (MM) and acute myeloid leukemia (AML) research[1][2][3].

  

• HY-B0688

  Dapsone	80-08-0	99.76%
  Dapsone (4,4′-Diaminodiphenyl sulfone) is an orally active and blood-brain penetrant sulfonamide antibiotic with bacteriostatic, antimycobacterial and antiprotozoal activities[1]. Dapsone?exerts effective antileprosy activity?and inhibits folate synthesis in cell extracts of?M. leprae. Dapsone is used for dermatologic disorder research, including leprosy, dermatitis herpetiformis, acne vulgaris et al[2][3].

  

• HY-N0238

  Atractylodin	55290-63-6	99.99%
  Atractylodin (Atractydin) is an orally active active ingredient obtained from the rhizome of Atractylodes lancea and A. chinensis. Atractylodin is a natural insecticide. Atractylodin has anti-inflammatory activity[1][2][3].

  

• HY-A0032A

  Valganciclovir hydrochloride	175865-59-5
  Valganciclovir hydrochloride is an orally active antiviral agent. Valganciclovir hydrochloride can inhibit the growth of adenoviruses and have a protective effect on immunosuppressed hamsters. Valganciclovir hydrochloride can be used for the research of Cytomegalovirus[1][2][3].

  

• HY-W009783

  1-Deoxymannojirimycin hydrochloride	73465-43-7
  1-Deoxymannojirimycin hydrochloride is a selective class I α1,2-mannosidase inhibitor with an IC50 of 20 μM. 1-Deoxymannojirimycin hydrochloride is also a N-linked glycosylation inhibitor. 1-Deoxymannojirimycin hydrochloride has antiviral activity against HIV‐1 strains . 1-Deoxymannojirimycin hydrochloride increases high mannose structures. 1-Deoxymannojirimycin hydrochloride can be used for the study of liver cancer and colon cancer[1][2][3][4][5][6].

  

• HY-14865

  Omadacycline	389139-89-3	99.85%
  Omadacycline (PTK 0796), a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections[1][2][3][4].

  

• HY-15275

  BMS-265246	582315-72-8	99.59%
  BMS-265246 is a potent and selective cyclin-dependent kinase CDK1 and CDK2 inhibitor, with IC50 values of 6 and 9 nM, respectively. BMS-265246 inhibits CHI3L1 (chitinase 3-like-1) stimulation of ACE2 (angiotensin converting enzyme 2) and SPP (viral spike protein priming proteases). BMS-265246 can be used for ovarian cancer and COVID-19 research[1][2][3].

  

• HY-B0275

  Oxytetracycline	79-57-2	99.05%
  Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity[1][2][3].

  

• HY-B1117

  Cefoxitin sodium	33564-30-6
  Cefoxitin sodium (MK-306) is a cephalosporin-class antibiotic. Cefoxitin sodium is highly stable against β-Lactamase (HY-P2998). Cefoxitin sodium has a broad spectrum of antibacterial activity, including Gram-negative and Gram-positive bacteria[1][2][3].

  

• HY-B1302

  Quinidine hydrochloride monohydrate	6151-40-2
  Quinidine hydrochloride monohydrate is an anti-arrythmic agent which is also a potent blocker of K+ channel with an IC50 of 19.9 μM.

  

• HY-N0470

  L-Lysine hydrochloride	657-27-2
  L-lysine hydrochloride is an essential amino acid for humans with various benefits including treating herpes, increasing calcium absorption, reducing diabetes-related illnesses and improving gut health.

  

• HY-N1127

  Tricin	520-32-1	99.87%
  Tricin is a natural flavonoid found in large amounts in wheat. Tricin inhibits HCMV replication by inhibiting CDK9. Tricin inhibits the proliferation and invasion of C6 glioma cells by upregulating the expression of FAK-targeting microRNA-7 [1][2][3].

  

• HY-N6769

  Radicicol	12772-57-5
  Radicicol is an inhibitor of Hsp90 with an IC50 value < 1 μM, and leads to proteasomal degradation[1]. Radicicol exhibits inhibition on PDK with IC50s of 230 μM (PDK1) and 400 μM (PDK3). Radicicol is an antifungal and antimalarial antibiotic, impairs mitochondrial replication by targeting P. falciparum topoisomerase VIB[2]. Radicicol is also an inhibitor of fat mass and obesity-associated protein (FTO), with an IC50 value of 16.04 μM[3].

  

• HY-N6952

  Geraniol	106-24-1
  Geraniol is an olefin terpene with oral activity. Geraniol inhibits cell proliferation and promotes apoptosis. Geraniol has antibacterial, antifungal, antioxidant, anti-inflammatory and antitumor activities. Geraniol can be used to study diabetes[1][2][3][4][5].

  

• HY-N7432

  DIMBOA	15893-52-4
  DIMBOA, an antibiotic, has antibacterial properties and inhibits bacteria such as Staphylococcus aureus and the mycotoxin-producing fungus Fusarium graminearum (which causes scab). DIMBOA exhibits strong free radical scavenging activity and weak iron(III) ion reducing activity, and has antioxidant activity. DIMBOA inhibits the biosynthesis and accumulation of toxic trichothecenes by affecting the expression of Tri6 and Tri5. DIMBOA reduces plant susceptibility to scab. DIMBOA also exhibits cytotoxicity to plant cells, causing plasmolysis, cell collapse, and cell rupture[1][2][3][4][5].

  

• HY-P2988

  Neuraminidase, Microorganism	9001-67-6
  Neuraminidase, Microorganism (Exo-α-sialidase) is an exosialidase, is often used in biochemical studies. Neuraminidase cleaves α-ketosidic linkage between the sialic (N-acetylneuraminic) acid and an adjacent sugar residue. Neuraminidase, derived from mucosal pathogens, is a virulence factor that modifies the host's response to infection[1].

  

• HY-112779

  Pertussis Toxin	70323-44-3
  Pertussis Toxin is a protein-based AB5-type exotoxin produced by the bacterium Bordetella pertussis, which causes whooping cough. Pertussis Toxin inhibits G protein-coupled receptor (GPR) signaling through Gi proteins[1][2][3].

  

• HY-128554

  N-Desethyl amodiaquine	79352-78-6
  N-Desethyl amodiaquine is the biologically active metabolite of Amodiaquine (HY-B1322A). N-Desethyl amodiaquine is an antiparasitic agent, has inhibitory for strains V1/S and 3D7 with IC50 values of 97 nM and 25 nM, respectively. N-Desethyl amodiaquine can be used for the research of malaria[1][2].

  

• HY-B0413S

  Fenbendazole-d3	1228182-47-5	99.70%
  Fenbendazole-d3 is a deuterium labeled Fenbendazole. Fenbendazole-d3 is a HIF-1α agonist and activates the HIF-1α-related GLUT1 pathway. Fenbendazole is an orally active benzimidazole anthelmintic agent, with a broad antiparasitic range. Fenbendazole is a microtubule destabilizing agent. Fenbendazole causes cell-cycle arrest and mitotic cell death, and has antitumor activity in mice xenografted with wild-type p53[1][2][3][4].

  

• HY-N0625A

  Alpinetin	36052-37-6	99.51%
  Alpinetin is a flavonoid isolated from cardamom and possesses antitumor, antiinflammation, hepatoprotective, cardiovascular protective, lung protective, antibacterial, antiviral, neuroprotective properties. Alpinetin inhibits lipopolysaccharide (LPS)-induced inflammation, activates PPAR-γ, activates Nrf2, and inhibits TLR4 expression to protect LPS-induced renal injury[1][2][3][4].

  

• HY-W019670

  N4-Acetylcytidine	3768-18-1
  N4-acetylcytidine (N4A) is an endogenous nucleoside metabolite from the degradation of tRNA. N4-Acetylcytidine is formed by N-acetyltransferase 10 and other enzymes. N4-acetylcytidine might sustain NLRP3 inflammasome activation via induction of HMGB1 expression and releasee. N4-Acetylcytidine modifies mRNA, tRNA and rRNA, affecting their stability, translation efficiency (such as enterovirus 71 RNA). N4-Acetylcytidine is used in the study of cancer, neuroinflammatory diseases, viral infections and obesity[1][2][3][4][5].

  

• HY-B0537

  Pentamidine	100-33-4
  Pentamidine (MP-601205) is an antimicrobial agent and interferes with DNA biosynthetics. Pentamidine inhibits parasite Leishmania infantum with an IC50 of 2.5 μM. Pentamidine is a potent and selective protein tyrosine phosphatases (PTPases) and phosphatase of regenerating liver (PRL) inhibitor. Pentamidine has the potential for Gambian trypanosomiasis, antimony-resistant leishmaniasis, and Pneumocystis carinii pneumonia treatment. Antitumor and antibacterial activities[1][2][3][4].

  

• HY-17421

  Tenatoprazole	113712-98-4	99.75%
  Tenatoprazole (TU-199) is an orally active imidazopyridine-based proton pump inhibitor with a prolonged plasma half-life. Tenatoprazole inhibits hog gastric H+/K+-ATPase activity with an IC50 of 6.2 μM. Tenatoprazole blocks the interaction of ubiquitin with the ESCRT-1 factor Tsg101, inhibits production of several enveloped viruses, including EBV[1][2][3].

  

• HY-B0766

  Bicyclol	118159-48-1	99.91%
  Bicyclol (SY801) is an orally active derivative of the traditional Chinese medicine Schisandra chinensis, which has antiviral, anti-inflammatory, immunomodulatory, antioxidant, anti-steatosis, anti-fibrotic and anti-tumor activities. Bicyclol regulates the expression of heat shock proteins and plays an anti-apoptosis role in hepatocytes. Bicyclol reduces the activation of NF-κB and the levels of inflammatory factors in hepatocytes infected with hepatitis C virus (HCV) by inhibiting the activation of the ROS-MAPK-NF-κB pathway, and prevents ferroptosis in acute liver injury. Bicyclol can change the expression of Mdr-1, GSH/GST and Bcl-2, increase the intracellular concentration of anticancer drugs, and sensitize drug-resistant cells to anticancer drugs. Bicyclol inhibits the proliferation of human malignant hepatoma cells by regulating the PI3K/AKT pathway and the Ras/Raf/MEK/ERK pathway. Bicyclol can be used in the study of chronic hepatitis, acute liver injury, nonalcoholic fatty liver disease, liver fibrosis and hepatocellular carcinoma[1][2][3][4][5][6][7][8].

  

• HY-B0942

  Benzethonium chloride	121-54-0	98.47%
  Benzethonium chloride inhibits nicotinic acetylcholine receptors in human recombinant α7 and α4β2 neurons in Xenopus laevis oocytes, which has antibacterial, anticancer, antisepsis and disinfection activity. Benzethonium chloride induced Apoptosis and activated caspases in cancer cell lines. Benzethonium chloride ablates the tumor-forming ability of FaDu cells, delays the growth of xenograft tumors in vivo[1][2][3].

  

• HY-148560

  ccc_R08	2919019-72-8	98.87%
  ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection[1][2].

  

• HY-B0017

  Telbivudine	3424-98-4	99.98%
  Telbivudine (Epavudine), an orally active thymidine nucleoside analog, is a potent antiviral inhibitor of hepatitis B virus (HBV) replication[1].

  

• HY-B1892

  Cefazolin	25953-19-9	99.76%
  Cefazolin (Cephazolin) is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research[1]. Cefazolin has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD)[2].

  

• HY-B1920

  Josamycin	16846-24-5
  Josamycin (EN-141) is an orally active macrolide antibiotic exhibiting antimicrobial activity against a wide spectrum of pathogens, such as bacteria. The dissociation constant Kd from ribosome for Josamycin is 5.5 nM[1][2].

  

• HY-N0408

  Picroside II	39012-20-9	99.91%
  Picroside II is an antioxidant with oral activity that can reduce the production of ROS and protect the blood-brain barrier (BBB) after CI/R injury, offering neuroprotective effects. Picroside II has antioxidant, immune-regulating, antiviral properties, and inhibits apoptosis. Picroside II alleviates the inflammatory response in sepsis by suppressing the activation of the NLRP3 inflammasome and NF-κB pathways[1][2][3][4][5].

  

• HY-N0482

  Phillyrin	487-41-2	98.99%
  Phillyrin is isolated from Forsythia suspensa Vahl (Oleaceae), has antibacterial and anti-inflammatory activities. Phillyrin has potential inductive effects on rat CYP1A2 and CYP2D1 activities, without affecting CYP2C11 and CYP3A1/2 activities[1]. Phillyrin has anti-influenza A virus activities[2].

  

• HY-N1420

  Rhamnose	3615-41-6
  Rhamnose (L-Rhamnose ) is an orally active deoxysugar. Rhamnose can inhibit levels of pro-inflammatory interleukin and matrix metalloproteinases (MMPs) in skin aging models. Rhamnose can promote the phosphorylation levels of PKA substrates and HSL in SVF-derived adipocytes, stimulating PKA signaling. Rhamnose can act against obesity in mice by stimulating fat dopamine receptors and inducing thermogenesis. Rhamnose shows anti-aging effects. Rhamnose monohydrate can be used in the study of Ehrlich’s solid tumors and sarcomas[2][3][5].

  

• HY-N1480

  (-)-Fucose	2438-80-4
  (-)-Fucose is classified as a member of the hexoses, plays a role in A and B blood group antigen substructure determination, selectin-mediated leukocyte-endothelial adhesion, and host-microbe interactions. (-)-Fucose is orally active, inhibits CL11-induced inflammatory response in kidney and tumor growth[2].

  

• HY-Y0030

  3-Hydroxypicolinic acid	874-24-8
  3-Hydroxypicolinic acid is a picolinic acid derivative, and belongs to the pyridine family. 3-hydroxypicolinic acid can be used to synthesize copper(II) complexes with anti-tuberculosis activity[1][2].

  

• HY-N0716A

  Berberine hemisulfate	316-41-6
  Berberine hemisulfate is the hemisulfate form of Berberine (HY-N0716). Berberine hemisulfate is an alkaloid isolated from the Chinese herbal medicine Huanglian. Berberine hemisulfate exhibits anti-inflammatory, antibiobic, antitumor, cardiovascular protective and neuroprotective activity[1][2][3][4][5][6].

  

• HY-106783A

  Polymyxin B nonapeptide TFA	2220175-42-6	99.80%
  Polymyxin B nonapeptide TFA is a cyclic peptide obtained from Polymyxin B by proteolytic removal of its terminal amino acyl residue. Polymyxin B nonapeptide TFA is less toxic, lacks bactericidal activity, and retains its ability to render gram-negative bacteria susceptible to several antibiotics by permeabilizing their outer membranes[1][2][3].

  

• HY-129047A

  Trypsin (MS grade)	9002-07-7
  Trypsin MS grade is a serine protease enzyme, and hydrolyzes proteins at the carboxyl side of the Lysine or Arginine. Trypsin MS grade activates PAR2 and PAR4. Trypsin MS grade induces cell-to-cell membrane fusion in PDCoV infection by the interaction of S glycoprotein of PDCoV and pAPN. Trypsin MS grade also promotes cell proliferation and differentiation. Trypsin MS grade can be used in the research of wound healing and neurogenic inflammation[1][2][3][4][6].

  

• HY-13986

  Merimepodib	198821-22-6	99.27%
  Merimepodib (VX-497) is a noncompetitive and oral inhibitor of inosine monophosphate dehydrogenase (IMPDH) with broad spectrum antiviral activities.

  

• HY-119726

  Fosmanogepix	2091769-17-2
  Fosmanogepix (APX001) is a broad-spectrum agent against invasive fungal infections. Fosmanogepix (APX001) targets the conserved Gwt1 enzyme required for the localization of glycosylphosphatidylinositol-anchored mannoproteins in fungi. This inhibition prevents the appropriate localization of cell wall mannoproteins, which compromises cell wall integrity, biofilm formation, germ tube formation, and fungal growth. Fosmanogepix (APX001) can be used for invasive fungal infections research[1].

  

• HY-126253

  BI-4916	2244451-48-5	98.67%
  BI-4916 is a proagent of BI-4924. BI-4924 is a NADH/NAD+-competitive PHGDH inhibitor. BI-4916 inhibits cancer cell migration. BI-4916 can be used for cancer, inflammation and infection study[1][2][3].

  

• HY-B0308

  Sparfloxacin	110871-86-8	99.93%
  Sparfloxacin (CI-978) is a fluoroquinolone antibiotic, shows broad and potent antibacterial activity[1].

  

• HY-139010

  Merafloxacin	91188-00-0	98.98%
  Merafloxacin (CI-934), a fluoroquinolone antibacterial agent, is a selective programmed -1 ribosomal frameshifting (-1 PRF) inhibitor of beta coronaviruses. Merafloxacin exhibits in vitro activity against gram-positive and gram-negative bacteria[1][2].

  

• HY-B0433A

  Quinine hydrochloride dihydrate	6119-47-7
  Quinine hydrochloride dihydrate (Qualaquin) is an orally active and can be used in anti-malarial studies. Quinine hydrochloride dihydrate is a potassium channel inhibitor that inhibits WT mouse Slo3 (KCa5.1) channel currents evoked by voltage pulses to +100 mV with an IC50 of 169 μM[1][2].

  

• HY-12651

  Primaquine diphosphate	63-45-6
  Primaquine diphosphate is a potent antimalaria agent and a potent gametocytocide in falciparum malaria. Primaquine diphosphate prevents relapse in vivax and ovale malaria[1].

  

• HY-15311

  Avermectin B1	71751-41-2	98.36%
  Avermectin B1 (Abamectin) is a mixture of two similar segments of avermectin. Avermectin B1 is an orally anti-infection agent, which can be used in the research of parasitic worms, insect pests, agriculture and animal husbandry. Avermectin B1 can also induce the production of ROS and induces cytotoxicity, apoptosis and autophagy[1][2][4].

  

• HY-16911

  AFN-1252	620175-39-5	99.49%
  AFN-1252 is an orally active and selective inhibitor of FabI, an essential enzyme in fatty acid biosynthesis in Staphylococcus spp. AFN-1252 exhibits exquisite and highly selective activity against Staphylococcus spp. AFN-1252 exhibits typical MIC90 values of ⩽0.015 μg/ml against diverse clinical isolates of S. aureus. AFN-1252 is efficacious in a mouse model of septicemia providing 100% protection from an otherwise lethal peritoneal infection of S. aureus Smith[1][2].

  

• HY-17374

  Benfotiamine	22457-89-2	99.39%
  Benfotiamine (S-Benzoylthiamine O-monophosphate) is a vitamin B1 derivative that exhihibits potent antioxidative and anti-inflammatory activity. Benfotiamine can be used for the research of various secondary diabetic complications. Benfotiamine also can be used in infectious diseases such as HIV and COVID-19[1][2][3].

  

• HY-17586

  Dalbavancin hydrochloride	2227366-51-8
  Dalbavancin hydrochloride (MDL-63397 hydrochloride) is a semisynthetic lipoglycopeptide antibiotic with potent bactericidal activity against Gram-positive bacteria. Dalbavancin hydrochloride inhibits Staphylococcus aureus and Bacillus anthracis with MIC90s of 0.06 μg/mL and 0.25 μg/mL, respectively[1][2].

  

• HY-17592

  Bithionol	97-18-7	99.32%
  Bithionol is an antibacterial, anthelmintic, and algaecide agent. Bithionol is also a potent inhibitor of soluble adenylyl cyclase through binding to the allosteric activator site (IC50: 4 μM)[1][2].

  

• HY-B0027

  Valnemulin hydrochloride	133868-46-9	98.03%
  Valnemulin hydrochloride is an orally effective truncated pleurotin antibiotic that inhibits protein synthesis in bacteria by binding to peptidyl transferase in the 50s ribosome subunit. Valnemulin hydrochloride effectively eliminates Mycobacterium bovis in the lungs in an experimental bovine model of Mycoplasma bovis infection. Valnemulin hydrochloride can reduce the mortality of epidemic rabbit enteropathy and has no adverse effect on the growth performance of rabbits[1][2].

  

• HY-B0249

  Didanosine	69655-05-6	99.45%
  Didanosine (2',3'-Dideoxyinosine; ddI) is a a potent and orally active dideoxynucleoside analogue, and also is a potent nucleoside reverse transcriptase inhibitor. Didanosine shows antiretroviral activity for HIV[1][2][3].

  

• HY-B0567

  Dequalinium Chloride	522-51-0	99.91%
  Dequalinium chloride is an Apamin (HY-P0256)-sensitive potassium channel selective blocker. Dequalinium chloride is a cationic, lipophilic mitochondrial poison. Dequalinium chloride is also an antagonist pf α7 nAChR, and an anti-microbial antiseptic agent with a broad bactericidal and fungicidal activity[1][2][3][4].

  

• HY-B0621

  Triclabendazole	68786-66-3	99.36%
  Triclabendazole is an orally active parasite inhibitor. Triclabendazole has anti-Leishmania activity and induces gasdermin E (GSDME)-dependent pyroptosis by caspase-3 activation. Triclabendazole can be used for the research of fasciola hepatica[1][2][3].

  

• HY-B0836

  λ-Cyhalothrin	91465-08-6	99.83%
  λ-Cyhalothrin is a high efficiency, broad-spectrum type II synthetic pyrethroid insecticide containing α-cyano group. λ-Cyhalothrin is used to control a wide range of pests in a variety of applications. λ-Cyhalothrin is a neurotoxin that targets sodium channels in the membranes of neurons in the central nervous system[1].

  

• HY-B0885

  Econazole	27220-47-9	99.93%
  Econazole ((±)-Econazol) is an orally active imidazole antifungal agent, as well as a cytochrome P-450 inhibitor and a blocker of calcium and manganese ion uptake. Econazole is active against a variety of fungi and some Gram-positive bacteria, but has no significant activity against Gram-negative bacteria. Econazole can inhibit the synthesis of prostaglandins and can also induce liver damage[1][2][3][4][5].

  

• HY-B1381

  Cefixime	79350-37-1	99.77%
  Cefixime (FR-17027) is an orally active antibiotic and a third generation cephalosporin antibiotic, useful for the treatment of a number of bacterial infections[1][2].

  

• HY-B1826

  Adefovir	106941-25-7
  Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses[1][2][3].

  

• HY-N0068

  Solasodine	126-17-0
  Solasodine (Purapuridine) is a steroidal alkaloid that occurs in plants of the Solanaceae family. Solasodine induces apoptosis by inhibiting the p53-MDM2 complex, p21Waf1/Cip1, and Bcl-2 proteins. Solasodine has neuroprotective, antifungal, hypotensive, anticancer, antiatherosclerotic, antiandrogenic and anti-inflammatory activities[1][2][3].

  

• HY-N0447

  8-Gingerol	23513-08-8	99.82%
  8-Gingerol can be found in the rhizome of ginger (Z. officinale) and has oral bioactivity. It activates TRPV1, with an EC50 value of 5.0 µM. 8-Gingerol inhibits COX-2 and also suppresses the growth of H. pylori in vitro. Additionally, 8-Gingerol exhibits anticancer, antioxidant, and anti-inflammatory properties by inhibiting the epidermal growth factor receptor (EGFR) and modulating its downstream STAT3/ERK pathway to suppress the proliferation, migration, and invasion of colorectal cancer cells. 8-Gingerol also exerts immunosuppressive effects by inhibiting oxidative stress, inducing cell cycle arrest, promoting apoptosis, and regulating autophagy. Furthermore, 8-Gingerol has cardioprotective effects. 8-Gingerol is promising for research in the fields of cancer, infection, immunosuppression, and cardiovascular diseases.

  

• HY-N0761

  Isoferulic acid	537-73-5
  Isoferulic acid (3-Hydroxy-4-methoxycinnamic acid) is an orally active cinnamic acid derivative. Isoferulic acid exhibits hypoglycemic, antiviral, and antioxidant activities. Isoferulic acid can also inhibit fructose- and glucose-mediated protein glycation. Isoferulic acid can be used in the research of diseases such as diabetes[1][2][3][4].

  

• HY-N0763

  Angelicin	523-50-2	99.98%
  Angelicin is a furanocoumarin compound that functions as an inhibitor of NF-κB and MAPK signaling pathways, exhibiting anti-inflammatory, antiviral, and antitumor activities. It suppresses the lytic replication of γ-herpesviruses, such as MHV-68, early during viral infection, potentially inhibiting RTA gene expression (IC50=28.95 μM). Angelicin also mitigates inflammation by inhibiting the phosphorylation and nuclear translocation of NF-κB, and the phosphorylation of p38 and JNK. Furthermore, it induces apoptosis in neuroblastoma cells by downregulating anti-apoptotic proteins like Bcl-2, Bcl-xL, and Mcl-1, while activating caspase-9 and caspase-3.

  

• HY-N2229

  Rhapontigenin	500-65-2	99.66%
  Rhapontigenin is a natural analog of resveratrol with anticancer, antioxidant, antifungal and antibacterial activities. Rhapontigenin is amechanism-based, potent and selective cytochrome P450 1A1 inactivator (IC50  = 400 nM). Rhapontigenin exhibits 400-fold and 23-fold selectivity for P450 1A1 over P450 1A2 and P450 1B1, respectively[1].

  

• HY-N9481

  Lipoteichoic acid	56411-57-5
  Lipoteichoic acid is an orally effect anti-inflammatory and antitumor agent. Lipoteichoic acid is a crucial immune molecule in Gram-positive bacteria that activates the complement system by inducing C3 and inhibiting CD55. Lipoteichoic acid regulates macrophage autophagy through the PI3K/Akt/mTOR pathway. Lipoteichoic acid induces lung damage in mice. Lipoteichoic acid inhibits the production of melanin[1][2][3][4][5][6][7].

  

• HY-110137

  Furamidine dihydrochloride	55368-40-6
  Furamidine dihydrochloride (DB75 dihydrochloride) is a selective protein arginine methyltransferase 1 (PRMT1) inhibitor with an IC50 of 9.4 μM. Furamidine dihydrochloride is selective for PRMT1 over PRMT5, PRMT6, and PRMT4 (CARM1) (IC50s of 166 µM, 283 µM, and >400 µM, respectively). Furamidine dihydrochloride is a potent, reversible and competitive tyrosyl-DNA phosphodiesterase 1 (TDP-1) inhibitor. Inhibition of TDP-1 by Furamidine dihydrochloride is effective both with single- and double-stranded DNA substrates but is slightly stronger with the duplex DNA. Furamidine dihydrochloride is also an antiparasite agent[1][2][3].

  

• HY-115364

  Parbendazole	14255-87-9
  Parbendazole is a potent inhibitor of microtubule assembly, destabilizes tubulin, with an EC50 of 530 nM, and exhibits a broad-spectrum anthelmintic activity.

  

• HY-115497

  BRD5529	1358488-78-4	98.94%
  BRD5529 is an effective dose-dependent CARD9-TRIM62 protein–protein interaction (PPI) inhibitor with an IC50 value of 8.6 μM. BRD5529 has potency and complete inhibition of CARD9 ubiquitinylation in vitro, also has favorable solubility. BRD5529 can be used for the research of inflammatory bowel disease (IBD) such as Crohn’s disease (CD) and ulcerative colitis (UC)[1][2].

  

• HY-122502

  Pyrazofurin	30868-30-5
  Pyrazofurin is an antitumor pyrimidine nucleoside analogue and a orotate-phosphoribosyltransferase inhibitor. Pyrazofurin inhibits cell proliferation and intracellular DNA synthesis by inhibiting uridine 5'-phosphate synthase. Pyrazofurin is also an antibiotic with a broad spectrum of antiviral activity[1][2][3][4].

  

• HY-125850

  Berberrubine chloride	15401-69-1	99.28%
  Berberrubine chloride is an orally active metabolite of berberine. Berberrubine chloride alleviates mucosal lesions and inflammation in mouse colitis models. Berberrubine chloride has anti-inflammatory, anti-tumor, and antiviral activities[1][1][3].

  

• HY-135470

  Nifurpirinol	13411-16-0	98.74%
  Nifurpirinol (P-7138) is a selective prosubstrate of bacterial nitroreductase (NTR). NTR catalyzes the reduction of nifurpirinol to generate cytotoxic metabolites that induce apoptosis in target cells. Nifurpirinol selectively ablates NTR-expressing cells such as pancreatic β cells, osteoblasts, dopaminergic neurons, and podocytes in transgenic zebrafish models. Nifurpirinol can be used in regeneration studies and disease modeling such as focal segmental glomerulosclerosis (FSGS)[1][2].

  

• HY-139729

  HOPan	18679-90-8
  HoPan inhibits phosphopantotenoylcysteine synthetase activity.

  

• HY-14814A

  Delafloxacin meglumine	352458-37-8	99.87%
  Delafloxacin meglumine (ABT492 meglumine; RX-3341 meglumine; WQ-3034 meglumine) is a broad-spectrum fluoroquinolone antibiotic. Delafloxacin has a broad spectrum of activity that includes drug-resistant Staphylococcus aureus, Streptococcus pneumoniae, and Klebsiella pneumonia[1].

  

• HY-150726

  ODN 1668	1186063-66-0	98.79%
  ODN 1668, a class B CpG ODN (oligodeoxynucleotide), is a TLR-9 agonist. ODN 1668 has strong immune regulatory properties, can enhance the level of antibody IgG2 subtype, promote the immune response of T cells and B cells, and can be used in the study of vaccine adjuvants. In addition, CpG ODN 1668 induces an antimicrobial immune response via a CaTLR9 dependent pathway in groupers. Sequence: 5'-tccatgacgttcctgatgct-3’[1][2][3][4].

  

• HY-P99209

  Motavizumab	677010-34-3	99.17%
  Motavizumab (MEDI-524) is an anti-human RSV (respiratory syncytial virus) monoclonal antibody. Motavizumab can be used in respiratory syncytial virus infection in high-risk infants research[1].

  

• HY-136548B

  Tenofovir diphosphate disodium	2738719-07-6	99.42%
  Tenofovir diphosphate disodium is an antiretroviral agent and an inhibitor of DNA polymerases. Tenofovir diphosphate disodium is a substrate of HIV-1 reverse transcriptase (RT). Tenofovir diphosphate disodium can be used for the research of Aids[1].

  

• HY-108917

  Morphothiadin	1092970-12-1	99.79%
  Morphothiadin is a potent inhibitor on the replication of both wild-type and adefovir (HY-B1826)-resistant HBV with an IC50 of 12 nM.

  

• HY-B1828A

  Spectinomycin dihydrochloride pentahydrate	22189-32-8
  Spectinomycin dihydrochloride pentahydrate is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin dihydrochloride pentahydrate acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin dihydrochloride pentahydrate is also a noncompetitive inhibitor of td intron RNA with an Ki value of 7.2 mM[1]-[5].

  

• HY-128773A

  MRL-494 hydrochloride	2699937-04-5	98.39%
  MRL-494 hydrochloride, an antibacterial agent, is a inhibitor of β-barrel assembly machine A (BamA) impervious to efflux and the outer membrane permeability barrier. MRL-494 hydrochloride can inhibits Gram-positive (MIC of 12.5 μM for Staphylococcus aureus COL) and Gram-negative (MIC of 25 μM for E. coli JCM158) bacterias[1].

  

• HY-B0005

  Toremifene citrate	89778-27-8	99.75%
  Toremifene citrate (Z-Toremifene citrate) is a second-generation selective estrogen-receptor modulator (SERM) in development for the prevention of osteoporosis. Toremifene citrate also potent inhibits infectious EBOV Zaire and Marburg (MARV) with IC50 of 0.07 µM and 2.6 µM, respectively[1][2].

  

• HY-B1080

  Tilorone dihydrochloride	27591-69-1	99.29%
  Tilorone dihydrochloride is an orally active interferon (IFN) inducer with broad-spectrum antiviral activities. Tilorone dihydrochloride possesses robust anti-Severe fever with thrombocytopenia syndrome virus (SFTSV) activity in vitro and in vivo through stimulation of host innate immunity. Tilorone dihydrochloride can penetrate the blood-brain barrier to activate HIF in the CNS[1][2][3].Tilorone dihydrochloride exhibits an inhibitory activity with EC50 of 230 nM against Ebola virus (EBOV)[4].

  

• HY-N0793

  Protopine	130-86-9
  Protopine (Corydinine), an isoquinoline alkaloid, is a specific reversible and competitive inhibitor of acetylcholinesterase. Protopine exhibits anti-inflammation, anti-microbial, anti-angiogenic and anti-tumour activity[1][2].

  

• HY-P2853

  Hemocyanin	9013-72-3
  Hemocyanin is a large copper-containing respiratory protein. Hemocyanin is an important non-specific innate immune defense molecule with phenoloxidase, antiviral, antibacterial, hemolytic, and antitumor activities[1].

  

• HY-117778

  SF2312	107729-45-3
  SF2312, a natural phosphonate antibiotic (Antibiotic), is a highly potent Enolase inhibitor with IC50s of 37.9 nM and 42.5 nM for human recombinant ENO1 and ENO2, respectively. SF2312 is active against bacteria under anaerobic conditions[1].

  

• HY-B0535A

  Ethambutol dihydrochloride	1070-11-7	98.75%
  Ethambutol dihydrochloride is an antimycobacterial compound that prevents cell wall formation by inhibiting arabinosyltransferase activity. Ethambutol dihydrochloride can be used to establish animal models of hyperuricemia and optic neuropathy.

  

• HY-107126A

  Ibrexafungerp citrate	1965291-08-0	99.38%
  Ibrexafungerp citrate (MK 3118 citrate) is an orally active β-1,3-glucan synthesis inhibitor, with potential antifungal activity. Ibrexafungerp citrate is an investigational agent for the treatment of Candida and Aspergillus infections[1].

  

• HY-147217A

  Bepirovirsen sodium	2563929-84-8	98.44%
  Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].

  

• HY-16933

  L-Alanosine	5854-93-3
  L-Alanosine (NSC-153353), an antibiotic from Streptomyces alanosinicus, has antineoplastic activity. L-Alanosine (NSC-153353) inhibits adenylosuccinate synthetase, which converts inosine monophospate (IMP) into adenylosuccinate. L-Alanosine is the inhibitor for methylthioadenosine phosphorylase (MTAP)[1][2][3].

  

• HY-A0076

  Tebipenem	161715-21-5
  Tebipenem is an orally available carbapenem antibiotic, shows broad-spectrum activity against Gram-positive and -negative bacteria, except for Pseudomonas aeruginosa.

  

• HY-N1996

  Chebulagic acid	23094-71-5	99.67%
  Chebulagic acid is a COX-LOX dual inhibitor isolated from the fruits of Terminalia chebula Retz, on angiogenesis. Chebulagic acid is a M2 serine to asparagine 31 mutation (S31N) inhibitor and influenza antiviral. Chebulagic acid also against SARS-CoV-2 viral replication with an EC50 of 9.76 μM.

  

• HY-N4118

  Cephaeline	483-17-0
  Cephaeline ((-)-Cephaeline), a desmethyl analog of Emetine, is a phenolic alkaloid in Indian Ipecac roots isolated from the Cephaelis ipecacuanha. Cephaeline exhibits potent inhibition of both Zika virus (ZIKV) and Ebola virus (EBOV) infections. Cephaeline is an inductor of histone H3 acetylation and an inhibitor of mucoepidermoid carcinoma cancer stem cells (MEC), which promotes ferroptosis by inhibiting NRF2 to exert anti-lung cancer efficacy[1][2][3][4].

  

• HY-P1680

  Astin C	148057-23-2	98.77%
  Astin C (Asterin) is a cyclopeptide that can be extracted from Aster tataricus. Astin C has anti-inflammatory and anti-cancer activities. Astin C can specifically inhibit the cGAS-STING signaling pathway, block the recruitment of IRF3 to the STING signalosome, and thus inhibit the innate inflammatory response. Astin C can be used in the research of autoimmune diseases and cancers[1][2][3].

  

• HY-138941

  Octaethylene glycol monododecyl ether	3055-98-9
  Octaethylene glycol monododecyl ether (C12E8) is an non-ionic detergent that can be used for membrane protein extraction. Octaethylene glycol monododecyl ether can solubilize the viral membrane of intact influenza virus[1][2].

  

• HY-150725

  ODN 1585	386832-46-8
  ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant[1][2][3].

  

• HY-B0334A

  Sulbactam sodium	69388-84-7	99.66%
  Sulbactam (CP45899) sodium is a competitive, irreversible beta-lactamase inhibitor. Sulbactam sodium shows antimicrobial activity against multidrug-resistant (MDR) acinetobacter calcoaceticus--Acinetobacter baumannii (Acb) complex[1][2].

  

• HY-N0674A

  Dehydrocorydaline chloride	10605-03-5
  Dehydrocorydaline chloride (13-Methylpalmatine chloride) is an alkaloid that regulates protein expression of Bax, Bcl-2; activates caspase-7, caspase-8, and inactivates PARP[1]. Dehydrocorydaline chloride elevates p38 MAPK activation. Anti-inflammatory and anti-cancer activities[2]. Dehydrocorydaline chloride shows strong anti-malarial effects (IC50?=38 nM), and low cytotoxicity (cell viability?>?90%) using P. falciparum 3D7 strain[3].

  

• HY-W017766

  Poly(hexamethylenebiguanide) hydrochloride	32289-58-0
  Poly(hexamethylenebiguanide) hydrochloride (PHMB) is an antimicrobial and antiviral agent. Poly(hexamethylenebiguanide) hydrochloride is active against both Gram-positive and Gram-negative bacteria. Poly(hexamethylenebiguanide) hydrochloride works by adsorbing to the surface of cellulose, which can damage microbial cell membranes and interfere with metabolism. Poly(hexamethylenebiguanide) hydrochloride is widely used in medical, clothing and household textiles, and cosmetic fields[1][2][3].

  

• HY-W018025

  5,6-Dihydroxyindole	3131-52-0
  5,6-Dihydroxyindole, a melanin precursor, has a broad-spectrum antibacterial, antifungal, antiviral, antiparasitic activity. 5,6-Dihydroxyindole has cytotoxic effects and is strongly toxic against various pathogens[1].

  

• HY-P1068

  Lysozyme	9001-63-2
  Lysozyme (Muramidase) is a conserved antimicrobial protein. Lysozyme exerts its bactericidal effect by hydrolyzing bacterial cell wall peptidoglycan (PG). Lysozyme plays an important role in limiting bacterial growth on mucosal surfaces and other sites, not only controlling potential pathogens but also limiting overgrowth of microbiota to prevent dysbiosis. Extracellular lysozyme can also degrade polymeric PG into soluble fragments, activate NOD receptors in mucosal epithelial cells, and lead to the secretion of chemokines and activating factors by neutrophils and macrophages[1][2].

  

• HY-160229

  ssRNA40 sodium
  ssRNA40 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA40 is a uridine-rich ssRNA derived from the HIV-1 long terminal repeat on activation of NK cells via TLR7/8[1][2].

  

• HY-W009886

  3,4,5-Trimethoxybenzaldehyde	86-81-7
  3,4,5-Trimethoxybenzaldehyde is a derivative of benzaldehyde. 3,4,5-Trimethoxybenzaldehyde has antimicrobial activity. 3,4,5-Trimethoxybenzaldehyde is also an important intermediate for the synthesis of various drugs, such as Trimethoprim (HY-B0510)[1][2].

  

• HY-10980

  Tavaborole	174671-46-6
  Tavaborole (AN-2690) is an antifungal agent with activity against Trichophyton species, in a topical solution formulation for the potential treatment of onychomycosis.

  

• HY-19961

  KIN1408	1903800-11-2	99.55%
  KIN1408 is an agonist of the RIG-1-like receptor (RLR) pathway and exhibits a broad-spectrum antiviral activity. KIN1408 exhibits activity against HCV, influenza A, dengue virus 2, Ebola, Nipah, and Lassa viruses[1][2].

  

• HY-111532

  (3R,4R)-A2-32-01	1359752-95-6	99.73%
  (3R,4R)-A2-32-01 (compound 24(R,R)), the (R,R)-enantiomer of A2-32-01, is a Staphylococcus aureus caseinolytic protease (SaClpP) inhibitor[1].

  

• HY-B0113A

  Omeprazole sodium	95510-70-6	99.98%
  Omeprazole sodium (H 16868 sodium), a proton pump inhibitor (PPI), is available for treatment of acid-related gastrointestinal disorders. Omeprazole sodium shows competitive inhibition of CYP2C19 activity with a Ki of 2 to 6 μM[1]. Omeprazole sodium also inhibits growth of Gram-positive and Gram-negative bacteria[2]. Omeprazole is a potent brain penetrant neutral sphingomyelinase (N-SMase) inhibitor (exosome inhibitor)[3].

  

• HY-15970

  Verdinexor	1392136-43-4	99.88%
  Verdinexor (KPT-335) is an orally active inhibitor for selective inhibitor of nuclear export (SINE). Verdinexor inhibits the respiratory syncytial virus A2 (RSV A2) replication with an IC50 of 0.96 µM. Verdinexor inhibits the function of nuclear export protein Exportin 1 (XPO1/CRM1), inhibiting pro-inflammatory responses. Verdinexor exhibits antitumor effciency[1][2].

  

• HY-B0244

  Praziquantel	55268-74-1	99.65%
  Praziquantel is a broadly effective trematocide and cestocide, the initial effect of praziquantel on the schistosome may be an interaction of the drug with lipid constituents of the tegumental membrane. Praziquantel is used for the research of schistosomiasis[1][2].

  

• HY-112639

  Aristeromycin	19186-33-5	99.34%
  Aristeromycin, an adenosine analog, is an antibiotic and a potent S-adenosylhomocysteine hydrolase (AHCY) inhibitor[1][2].

  

• HY-17425A

  Valacyclovir hydrochloride	124832-27-5	99.85%
  Valacyclovir hydrochloride (Valaciclovir hydrochloride) is an orally active antiviral agent for herpes simplex, herpes zoster, and herpes B. Valacyclovir hydrochloride inhibits HSV-1 W (50=2.9 μg/ml). Valacyclovir hydrochloride is a proagent of Aciclovir (HY-17422) [1][2][3][4][5].

  

• HY-16974

  Afoxolaner	1093861-60-9	99.95%
  Afoxolaner is an orally active isoxazoline insecticide/acaricide against Ixodes scapularis in dogs. Afoxolaner acts on the insect γ-aminobutyric acid receptor (GABA) and glutamate receptors, inhibiting GABA & glutamate-regulated uptake of chloride ions, resulting in excess neuronal stimulation and death of the arthropod[1][2].

  

• HY-17395

  Terbinafine hydrochloride	78628-80-5	99.92%
  Terbinafine hydrochloride (TDT 067 hydrochloride) is an orally active and potent antifungal agent. Terbinafine hydrochloride is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine hydrochloride also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria[1][2][3]. Terbinafine hydrochloride is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-B0887

  Permethrin	52645-53-1
  Permethrin (NRDC-143) is an insecticide, acaricide and a high selectively inhibitor of the Mitochondrial complex I, found in sediment and water samples. Permethrin shows estrogenic in vivo and anti-estrogenic activity in vitro. Permethrin also acts as a neurotoxin affecting neuron membranes by prolonging Sodium channel activation. Permethrin decreases resistance to bacterial infections in medaka (Oryzias latipes)[1][2][3][4][5][6][7].

  

• HY-B1422

  9-Aminoacridine	90-45-9
  9-Aminoacridine, a fluorescent probe, acts as an indicator of pH for quantitative determination of transmembrane pH gradients (inside acidic). 9-Aminoacridine is an antimicrobial. 9-Aminoacridine exerts its antimicrobial activity by interacting with specific bacterial DNA and disrupting the proton motive force in K. pneumoniae. 9-Aminoacridine is a HIV-1 inhibitor and inhibits HIV LTR transcription highly dependent on the presence and location of the amino moiety. 9-Aminoacridine inhibits virus replication in HIV-1 infected cell lines. 9-Aminoacridine is used as a Rifampin (RIF; HY-B0272) adjuvant for the multidrug-resistant K. pneumoniae infections[1][2][3].

  

• HY-N2014

  Verbenalin	548-37-8	99.91%
  Verbenalin is an orally active terpenoid glycoside that can be extracted from the medicinal plant Verbena officinalis. Verbenalin has anti-inflammatory, antiviral, and neuroprotective effects. Verbenalin has a strong binding affinity to the nsp-12 protein of the SARS-CoV-2 virus. Verbenalin can be used in the research of inflammatory and nervous system diseases such as hepatitis and Alzheimer's disease[1][2][3][4][5].

  

• HY-N2033

  Chebulinic acid	18942-26-2	99.68%
  Chebulinic acid is a potent natural inhibitor of M. tuberculosis DNA gyrase, also can inhibit SMAD-3 phosphorylation, inhibit H+ K+-ATPase activity.

  

• HY-N2181

  Acetylshikonin	24502-78-1	99.89%
  Acetylshikonin is an oral active anti-cancer, anti-inflammatory, antioxidant, anti-fertility, antibacterial, and neuroprotective agent. Acetylshikonin is a inhibitor of acetylcholinase (AChE) (IC50=34.6 μM) and nonselective cytochrome P450. Acetylshikonin can induce Apoptosis and Autophagy in cancer cells. Acetylshikonin regulates blood glucose, liver fat metabolism, and renal fibrosis, and is used in the study of diabetes, diabetic nephropathy (DN), obesity, and nonalcoholic fatty liver disease (NAFLD)[1][2][3][4][5][6][7][8][9].

  

• HY-N2187

  Deoxyshikonin	43043-74-9	99.96%
  Deoxyshikonin increases the expression of VEGF-C and VEGF-A mRNA in HMVEC-dLy, promotes HIF-1α and HIF-1β subunit interaction and binds to specific DNA sequences targeted by HIF. Deoxyshikonin inhibited colorectal cancer (CRC) through the PI3K/Akt/mTOR pathway. Deoxyshikonin has proangiogenesis effect and antitumor activity. Deoxyshikonin is an antibacterial agent against methicillin-resistant S. aureus (MRSA) and S. pneumonia (MIC=17 μg/mL)[1][2][3].

  

• HY-N6739

  Beauvericin	26048-05-5	99.97%
  Beauvericin is a cyclohexapeptide Fusarium toxin with insecticidal, antibacterial, anticancer, antiviral and cytotoxic activities. Beauvericin causes cellular genotoxicity by producing DNA breaks, chromosomal aberrations and micronuclei, and inhibits the PI3K/AKT pathway to induce apoptosis, thereby inhibiting the growth of HCC. In addition, Beauvericin affects immune function by inhibiting lymphocyte proliferation and interfering with the differentiation process of human monocytes into macrophages[1][2][3][4][5][6][7][8][9].

  

• HY-P2560

  LCMV GP (61-80)	232598-19-5	99.80%
  LCMV GP (61-80) is a peptide fragment derived from lymphocytic choriomeningitis virus (LCMV) glycoprotein (GP), and corresponds to amino acids 61-80. LCMV GP (61-80) is a specific epitope which can induce CD4+ T-cell response[1][2][3].

  

• HY-Y0061

  Oxindole	59-48-3	99.59%
  Oxindole (Indolin-2-one) is an aromatic heterocyclic building block. 2-indolinone derivatives have become lead compounds in the research of kinase inhibitors.

  

• HY-Y0367

  Maleic Acid	110-16-7
  Maleic Acid is a Glutamate Decarboxylase (GAD) inhibitor of E. coli and L. monocytogenes.

  

• HY-101128

  Bicyclomycin benzoate	37134-40-0
  Bicyclomycin benzoate is an antibiotic exhibiting activity against a broad spectrum of Gram-negative bacteria and against the Gram-positive bacterium.

  

• HY-139100B

  m7G(5')ppp(5')A diammonium	75252-10-7	99.15%
  m7G(5')ppp(5')A (m7GpppA) diammonium is a dinucleotide cap analog that can be used for in vitro RNA transcription[1].

  

• HY-W008344

  2-Chloroadenosine	146-77-0
  2-Chloroadenosine is an adenosine analog, a transporter permeabilizer of nucleoside transporters, and a competitive uridine influx inhibitor (apparent Ki=33 μM). 2-Chloroadenosine binds to nitrobenzylthioinosine with high affinity (apparent Ki=0.18 mM). 2-Chloroadenosine promotes Apoptosis and increases cerebral blood flow. 2-Chloroadenosine has anticonvulsant properties. 2-Chloroadenosine is used to study infection, inflammatory diseases, cancer, blood-related diseases, lung injury, epilepsy, and kidney disease[1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17].

  

• HY-W040129

  Chromomycin A3	7059-24-7
  Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg2+. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe[1][2][3].

  

• HY-W088075

  Acriflavine hydrochloride	69235-50-3
  Acriflavine (Acriflavinium chloride) hydrochloride is a fluorescent acridine dye that can be used to label nucleic acid. Acriflavine hydrochloride is an antiseptic agent. Acriflavine hydrochloride is a potent HIF-1 inhibitor that prevents the dimerization of HIF-1α and HIF-1β subunits. Acriflavine hydrochloride inhibits the interaction between monocarboxylate transporter 4 (MCT4) and Basigin. Acriflavine hydrochloride is used in cancer research, such as breast cancer, brain tumor and chronic myeloid leukemia. Acriflavine hydrochloride is a potent papain-like protease (PLpro) inhibitor, which inhibits SARS-CoV-2[1][2][3][4][5][6].

  

• HY-W013403

  2'-Deoxy-2'-fluorouridine	784-71-4
  2'-Deoxy-2'-fluorouridine can be used as an intermediate for antiinfluenza virus agents synthesis[1].

  

• HY-10237

  Boceprevir	394730-60-0	98.52%
  Boceprevir (EBP 520) is a potent, highly selective, orally bioavailable HCV NS3 protease inhibitor with a Ki of 14 nM in both enzyme assay and an EC90 of 350 nM in cell-based replicon assay[1][2][3][4][5]. Boceprevir inhibits SARS-CoV-2 3CLpro activity[6].

  

• HY-10465

  Daclatasvir dihydrochloride	1009119-65-6
  Daclatasvir dihydrochloride (BMS-790052 dihydrochloride) is a potent and orally active HCV NS5A protein inhibitor with EC50s range of 9-146 pM for multiple HCV replicon genotypes. Daclatasvir dihydrochloride is also an organic anion transporting polypeptide 1B (OATP1B) and OATP1B3 inhibitor with IC50s of 1.5 μM and 3.27 μM, respectively[1][2][3].

  

• HY-15739

  Ansamitocin P-3	66584-72-3
  Ansamitocin P-3 (Antibiotic C 15003P3) is a microtubule inhibitor. Ansamitocin P-3 is a macrocyclic antitumor antibiotic.

  

• HY-100008

  Peretinoin	81485-25-8	99.79%
  Peretinoin is an oral acyclic retinoid with a vitamin A-like structure that targets retinoid nuclear receptors such as retinoid X receptor (RXR) and retinoic acid receptor (RAR). Peretinoin reduces the mRNA level of sphingosine kinase 1 (SPHK1) in vitro by downregulating a transcription factor, Sp1[1]. Peretinoin prevents the progression of non-alcoholic steatohepatitis (NASH) and the development of hepatocellular carcinoma (HCC) through activating the autophagy pathway by increased Atg16L1 expression[2]. Peretinoin inhibits HCV RNA amplification and virus release by altering lipid metabolism with a EC50 of 9 μM[3].

  

• HY-12479A

  Epetraborole hydrochloride	1234563-16-6	99.63%
  Epetraborole (GSK2251052) hydrochloride is a novel leucyl-tRNA synthetase (LeuRS) inhibitor (IC50=0.31 μM), thereby inhibiting protein synthesis. Epetraborole hydrochloride can be used in multidrug-resistant gram-negative pathogens infection research[1][2][3].

  

• HY-14865B

  Omadacycline tosylate	1075240-43-5	99.37%
  Omadacycline (PTK 0796) tosylate, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline tosylate acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline tosylate possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline tosylate can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections[1][2][3][4].

  

• HY-14882A

  Cenicriviroc Mesylate	497223-28-6	99.04%
  Cenicriviroc Mesylate (TAK-652 Mesylate) is a dual CCR2/CCR5 antagonist, also inhibits both HIV-1 and HIV-2, and displays potent anti-inflammatory and antiinfective activity.

  

• HY-17367A

  Atazanavir sulfate	229975-97-7	99.94%
  Atazanavir (BMS-232632) sulfate is a highly selective and orally active HIV-1 protease inhibitor . Atazanavir sulfate is a substrate and inhibitor of CYP3A4, and an inhibitor of P-glycoprotein (P-gp). Atazanavir sulfate is also a SARS-CoV 3CLpro inhibitor with an IC50 of 3.49 μM. Atazanavir sulfate inhibits cardiac fibrosis, hyperlipidemia and induces malignant glioma death[1][2][3][4][5][6][7][8].

  

• HY-17583

  Griseofulvin	126-07-8	98.93%
  Griseofulvin is an orally active antifungal antibiotic with antitumor activity. Griseofulvin induces apoptosis and G2/M cell cycle arrest in cancer cells. Griseofulvin also has cardiovascular modulatory activity, reducing angina pectoris, relieving hand artery spasm associated with onychomycosis, and peripheral vascular diseases such as shoulder-hand syndrome[1][2][3][4][5][6].

  

• HY-B0212

  Sulfapyridine	144-83-2	99.85%
  Sulfapyridine, a major metabolite of Sulfasalazine, is a sulfonamide antibiotic agent. Sulfapyridine inhibits recombinant P. carinii dihydropteroate synthetase (DHPS) with an IC50 of 0.18 μM. Sulfapyridine has antibacterial, anti-inflammatory and anti-rheumatic activities[1][2][3].

  

• HY-B0294

  Flubendazole	31430-15-6	99.33%
  Flubendazole is an anthelmintic drug based on altering microtubule structure, inhibition of tubulin polymerization and disruption of microtubule function. Flubendazole induces apoptosis in human colorectal cancer (CRC) by blocking the STAT3 signaling axis and activation of autophagy. Flubendazole induces P53 expression and reduced Cyclin B1 and p-cdc2 expression. Flubendazole is an antitumor agent. Flubendazole can be used for worm and intestinal parasites[1][2].

  

• HY-B1374

  Florfenicol	73231-34-2	99.64%
  Florfenicol ((-)-Florfenicol) is an orally active broad-spectrum antibacterial antibiotic with anti-inflammatory, pro apoptotic, and immunomodulatory functions[6][7].

  

• HY-134940

  Quabodepistat	1883747-71-4	98.00%
  Quabodepistat (OPC-167832) is a potent and orally active dprE1 inhibitor with an IC50 of 0.258 μM. Quabodepistat has antituberculosis activity and can be used for the research of tuberculosis caused by Mycobacterium tuberculosis[1].

  

• HY-13998

  Dasabuvir	1132935-63-7	98.70%
  Dasabuvir (ABT-333) is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively[1].

  

• HY-B0984

  Fendiline hydrochloride	13636-18-5	99.80%
  Fendiline hydrochloride, a diphenylalkylamine type of antianginal agent, is an L-type calcium channel blocker (IC50 of 17 µM). Fendiline hydrochloride is also a selective K-Ras inhibitor, and has no effect on H-Ras and N-Ras. Fendiline hydrochloride inhibits K-Ras plasma membrane localization (IC50 of 9.64 μM), inhibits K-Ras signal output and blocks the proliferation of pancreatic, colon, lung, and endometrial cancer cell lines expressing oncogenic mutant K-Ras. Fendiline hydrochloride is a STING agonist and is able to inhibit the growth of multiple refractory cold tumors (MC38, CT26 and B16F10)[1][2][4].

  

• HY-B1285

  Dimercaprol	59-52-9
  Dimercaprol (2,3-Dimercapto-1-propanol) is an anti-heavy metal-poisoning agent, which exhibits anti-HIV activity. Dimercaprol can be used for the study for arsenic, mercury, gold, lead, antimony, and other toxic metal poisoning[1].

  

• HY-B1360

  Chlorquinaldol	72-80-0	98.69%
  Chlorquinaldol (Chloquinan) is an antibacterial agent with the potential use in topical skin conditions and vaginal infections. Chlorquinaldol is a β-catenin/TCF4 inhibitor, showing anti-proliferation, anti-migration, and apoptosis-inducing activity in cancer cells[1][2].

  

• HY-N0368

  Linalool	78-70-6
  Linalool is a natural monoterpene which is a competitive NMDA receptor antagonist. Linalool is orally active and crosses the blood-brain barrier. Linalool has anticancer, antibacterial, anti-inflammatory, neuroprotective, anxiolytic, antidepressant, anti-stress, cardioprotective, hepatoprotective, nephroprotective and pulmonary protective activities[1][2][3][4][5].

  

• HY-N0436

  Engeletin	572-31-6	99.88%
  Engeletin is a flavanonol glycoside isolated from Smilax glabra Roxb. , inhibits NF-κB signaling-pathway activation, and possesses anti-inflammatory, analgesic, diuresis, detumescence, and antibiosis effects.

  

• HY-N5142

  α-Terpineol	98-55-5
  α-Terpineol (with oral activity) can be found in Eucalyptus globulus Labill. α-Terpineol exhibits strong antimicrobial activity against periodontopathic and cariogenic bacteria.α-Terpineol possesses antifungal activity against T. mentagrophytes, and the activity might lead to irreversible cellular disruption. In addition, α-Terpineol exhibits antineuropathic and anti-inflammatory activities. α-Terpineol can be utilized in research related to diarrhea, neuropathic pain, infections, and inflammation[1][2][3][4][5][6][7].

  

• HY-N6742

  Borrelidin	7184-60-3
  Borrelidin (Treponemycin) is a bacterial and eukaryal threonyl-tRNA synthetase inhibitor which is a nitrile-containing macrolide antibiotic isolated from Streptomyces rochei[1]. Borrelidin is an inhibitor of Cdc28/Cln2 of the budding yeast, with an IC50 of 24 μM[2]. Borrelidin is a potent angiogenesis inhibitor, with an IC50 of 0.8 nM. Borrelidin induces apoptosis in the tube-forming cells[3]. Borrelidin has strong antimalarial activities, with IC50s of 1.9 nM and 1.8 nM against K1 and FCR3 strains of Plasmodium falciparum, respectively[4].

  

• HY-N7057

  Nonanoic acid	112-05-0
  Nonanoic acid is a naturally-occurring saturated fatty acid with nine carbon atoms. Nonanoic acid significantly reduces bacterial translocation, enhances antibacterial activity, and remarkably increases the secretion of porcine β-defensins 1 (pBD-1) and pBD-2[1].

  

• HY-105049

  T-91825	189345-04-8
  T-91825 (PPI-0903M), an N-phosphono-type cephalosporin, is the active form of TAK-599. T-91825 is active against both gram-positive and gram-negative bacteria[1][2].

  

• HY-112177

  Myxothiazol	76706-55-3
  Myxothiazol, an antifungal antibiotic, is a mitochondrial electron transport chain complex III (bc1 complex) inhibitor. Myxothiazol inhibits the growth of many yeasts and fungi at concentrations between 0.01 and 3 μg/ml[1][2].

  

• HY-113054

  DL-Glyceraldehyde 3-phosphate	591-59-3
  DL-Glyceraldehyde 3-phosphate is an intermediate in several metabolic pathways, including glycolysis and gluconeogenesis. DL-Glyceraldehyde 3-phosphate is a potent inhibitor of the growth of E. coli. DL-Glyceraldehyde 3-phosphate is a competitive inhibitor of the acyltransferase[1][2].

  

• HY-114936

  Piericidin A	2738-64-9
  Piericidin A (AR-054) is a natural mitochondrial NADH-ubiquinone oxidoreductase (complex I) inhibitor. Piericidin A is a potent neurotoxin and inhibits mitochondrial respiration by disrupting the electron transport system through its action on NADH-ubiquinone reductase. Piericidin A is also a potential quorum-sensing inhibitor that suppresses the expression of the virulence genes of Erwinia carotovora subsp. atroseptica (Eca). Piericidin A is an ADC cytotoxin and has anti-bacterial, anticancer, insecticidal activity[1][2][2].

  

• HY-130055

  HQNO	341-88-8	99.19%
  HQNO, secreted by P. aeruginosa, is a potent electron transport chain inhibitor with a Kd of 64 nM for complex III[1]. HQNO is a potent inhibitor of mitochondrial NDH-2 in many species[2].

  

• HY-135747

  Gut restricted-7	2553218-46-3
  Gut restricted-7 (GR-7) is a potent, covalent and orally active pan-bile salt hydrolase (BSH) inhibitor. Gut restricted-7 has a tissue-selective and is restricted to the gut. Gut restricted-7 decreases gut bacterial BSHs and decreases deconjugated bile acid levels in feces of mice[1].

  

• HY-136462

  CYM50358	1314212-39-9	98.04%
  CYM50358 is a potent and selective S1PR4 antagonist, with an IC50 of 25 nM. CYM50358 can be used for the research of influenza infection[1][2].

  

• HY-153591

  ROS-IN-1	298193-11-0
  ROS-IN-1 is a mitochondrial ROS inhibitor. ROS-IN-1 can reduce oxidative stress or inhibit reactive oxygen species (ROS) production[1].

  

• HY-A0166A

  Cilastatin sodium	81129-83-1	98.84%
  Cilastatin sodium (MK0791 sodium) is a reversible, competitive renal dehydropeptidase I inhibitor with an IC50 of 0.1 μM. Cilastatin sodium inhibits the bacterial metallob-lactamase enzyme CphA with an IC50 of 178 μM. Cilastatin sodium is an antibacterial adjunct[1][2][3].

  

• HY-A0181A

  Adenosine 5'-monophosphate monohydrate	18422-05-4
  Adenosine 5'-monophosphate monohydrate is an adenosine A1 receptor agonist. Adenosine 5'-monophosphate monohydrate has significant antiviral activity against HSV-1 and HSV-2[1][2][3].

  

• HY-B0467B

  Amoxicillin trihydrate	61336-70-7
  Amoxicillin (Amoxycillin) trihydrateis an antibiotic with good oral absorption and broad spectrum antimicrobial activity. Amoxicillin trihydrateis inhibits the biosynthesis of polypeptides in the cell wall, thereby inhibiting cell growth[1][2][3].

  

• HY-P1649B

  SPR741 acetate		99.55%
  SPR741 acetate (NAB741 acetate) is a cationic peptide derived from polymyxin B and is a potentiator molecule. SPR741 acetate increases the permeability of the outer membrane of Gram-negative bacteria and is used to treat severe Gram-negative bacteria infections. SPR741 acetate inhibits multidrug-resistant Gram-negative bacteria. The spectrum of activity of the antibiotic can be widened when used in combination with SPR741 acetate[1][2].

  

• HY-141619A

  Cotrimoxazole (Trimethoprim/sulfamethoxazole 1:19)	8064-90-2	99.87%
  Cotrimoxazole (Trimethoprim/sulfamethoxazole 1:19), an antimicrobial agent, is a Trimethoprim and Sulfamethoxazole mixture. The ratio of Trimethoprim to Sulfamethoxazole in the combination mixture is 1 : 19[1].

  

• HY-79457

  S-Methylisothiourea sulfate	867-44-7
  S-Methylisothiourea sulfate is a potent, selective and competitive inhibitor of inducible nitric oxide synthase (iNOS). S-Methylisothiourea sulfate exerts beneficial effects in rodent models of septic shock[1].

  

• HY-B0712

  Ceftriaxone	73384-59-5	99.07%
  Ceftriaxone (Ro 13-9904 free acid) is a broad spectrum β-lactam third-generation cephalosporin antibiotic, which has good antibacterial activity against a variety of gram-negative and positive bacteria. Ceftriaxone is a covalent inhibitor of GSK3β with IC50 value of 0.78 μM. Ceftriaxone is an inhibitor of Aurora B. Ceftriaxone has anti-inflammatory, antitumor and antioxidant activities. Ceftriaxone can be used in the study of bacterial infections and meningitis[1][2][3][4][5][6][7].

  

• HY-W012531

  2-Hydroxycinnamic acid	614-60-8
  2-Hydroxycinnamic acid is a phenolic acid with antimicrobial and antioxidant properties. 2-Hydroxycinnamic acid has antimicrobial activity against Staphylococcus aureus and is not susceptible to drug resistance. 2-Hydroxycinnamic acid shows inhibitory effects on infection of HIV/SARS-CoV S pseudovirus with an IC50 of 0.3 mM. In addition, 2-Hydroxycinnamic acid has neuroprotective and antitumor activity[1][2][3][4].

  

• HY-19487

  Ribocil	1381289-58-2
  Ribocil is a highly selective chemical modulator of bacterial riboflavin riboswitches.

  

• HY-10392

  Sutezolid	168828-58-8	99.50%
  Sutezolid (PNU-100480), an orally active oxazolidinone antimicrobial agent, acts by inhibiting bacterial protein synthesis. Sutezolid has potent activity against mycobacteria, and is used for the research of drug-resistant tuberculosis[1][2].

  

• HY-B0852

  Tebuconazole	107534-96-3	99.66%
  Tebuconazole is an agricultural azole fungicide which can also inhibit CYP51 with IC50s of 0.9 and 1.3 μM for Candida albicans CYP51 (CaCYP51) and truncated Homo sapiens CYP51 (Δ60HsCYP51), respectively. Tebuconazole induces lipid accumulation and oxidative stress in HepG2 Cells. Tebuconazole decreases MAC-T cells viability and proliferation, induces ER-stress-mediated apoptosis and increases oxidative stress levels in MAC-T cells[1][2][3][4][5][6].

  

• HY-100184

  DSM265	1282041-94-4	99.92%
  DSM265 is a long-duration inhibitor of P. falciparum dihydroorotate dehydrogenase (PfDHODH) with an IC50 of 8.9 nM. DSM265 can also inhibit the growth of Pf3D7 parasites with an EC50 of 4.3 nM[1][2].

  

• HY-100870

  Obefazimod	1258453-75-6	99.80%
  Obefazimod (ABX464) is a potent anti-HIV agent. Obefazimod inhibits HIV-1 replication in stimulated peripheral blood mononuclear cells (PBMCs) with an IC50 ranging between 0.1 μM and 0.5 μM.

  

• HY-123475

  Sisunatovir	1903763-82-5	99.40%
  Sisunatovir (RV521) is a potent and orally active respiratory syncytial virus (RSV) inhibitor with IC50 values of 1.4, 1.0 nM for RSV A, RSV B, respectively. Sisunatovir inhibits RSV infection and reduces virus titers in the lungs of mice[1].

  

• HY-18649A

  Galidesivir	249503-25-1	99.29%
  Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM[1][2][3].

  

• HY-B1322B

  Amodiaquine dihydrochloride	69-44-3	99.89%
  Amodiaquine dihydrochloride (Amodiaquin dihydrochloride), a 4-aminoquinoline class of antimalarial agent, is a potent and orally active histamine N-methyltransferase inhibitor with a Ki of 18.6 nM. Amodiaquine dihydrochloride is also a Nurr1 agonist and specifically binds to Nurr1-LBD (ligand binding domain) with an EC50 of ~20 μM. Anti-inflammatory effect[1][2][3][4][5].

  

• HY-P0018B

  Pepstatin Ammonium		99.76%
  Pepstatin (Pepstatin A) Ammonium is a specific, orally active aspartic protease inhibitor produced by actinomycetes, with IC50s of 4.5 nM, 6.2 nM, 150 nM, 290 nM, 520 nM and 260 nM for hemoglobin-pepsin, hemoglobin-proctase, casein-pepsin, casein-proctase, casein-acid protease and hemoglobin-acid protease, respectively. Pepstatin Ammonium also inhibits HIV protease[1][2].

  

• HY-12983

  ALS-8112	1445379-92-9	99.40%
  ALS-8112 is a potent and selective respiratory syncytial virus (RSV) polymerase inhibitor. The 5'-triphosphate form of ALS-8112 inhibits RSV polymerase with an IC50 of 0.02 μM.

  

• HY-17424

  Penciclovir	39809-25-1	99.92%
  Penciclovir (VSA 671) is a potent and selective anti-herpesvirus agent with EC50 values of 0.5, 0.8 µg/ml for HSV-1 (HFEM), HSV-2 (MS), respectively. Penciclovir shows anti-herpesvirus activity with no-toxic. Penciclovir preventes mortality in mouse[1][2].

  

• HY-B0255

  Adefovir dipivoxil	142340-99-6	99.03%
  Adefovir dipivoxil is an orally active adenosine analog and Adefovir prodrug. Adefovir dipivoxil inhibits DNA synthesis, activates the ATR signaling pathway, and disrupts the KCTD12-CDK1 interaction. Adefovir dipivoxil has antiviral activity against PRV, HBV, and orthopoxviruses. Adefovir dipivoxil has inhibitory effects on both lamivudine-resistant and wild-type strains. Adefovir dipivoxil has antitumor activity against lung and colon cancer[1][2][3][4][5][6][7][8][9][10][11].

  

• HY-B0276

  Ethionamide	536-33-4	99.73%
  Ethionamide (2-ethylthioisonicotinamide) is a second-line anti-tuberculosis antibiotic with antibacterial effect and oral activity[1][2][3][4].

  

• HY-B0449

  Methacycline hydrochloride	3963-95-9	99.71%
  Methacycline hydrochloride is a tetracycline antibiotic and can inhibits bacterial protein synthesis. Methacycline hydrochloride is a potent epithelial-mesenchymal transition (EMT) inhibitor. Methacycline hydrochloride blocks EMT in vitro and fibrogenesis in vivo without directly affecting TGF-β1 Smad signaling. Methacycline hydrochloride is an antimicrobial and has the potential for pulmonary fibrosis[1].

  

• HY-124042

  K6PC-5	756875-51-1	99.27%
  K6PC-5, a ceramide derivative, is a sphingosine kinase 1(SPHK1) activator and elicites a rapid transient increase in intracellular calcium levels. K6PC-5 has the potential for skin diseases involving abnormal keratinocyte, and neurodegeneration and virus infection research[1][2][3].

  

• HY-13623A

  Entecavir monohydrate	209216-23-9
  Entecavir monohydrate (BMS200475 monohydrate; SQ34676 monohydrate) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.

  

• HY-B0782A

  Acetazolamide sodium	1424-27-7	99.54%
  Acetazolamide sodium is a carbonic anhydrase (CA) IX inhibitor with an IC50 of 30 nM for hCA IX. Acetazolamide sodium has diuretic, antihypertensive and anti-gonococcal activities[1][4][5][6].

  

• HY-B2170A

  Octenidine dihydrochloride	70775-75-6
  Octenidine dihydrochloride is an effective antiseptic compound for skin mucous membranes and wounds.

  

• HY-17010

  Retapamulin	224452-66-8
  Retapamulin (SB-275833) is a topical antibiotic that binds Staphylococcus aureus and E. coli ribosomes with a Kd of 3 nM. Retapamulin can be used in researches of atopic dermatitis and prostate cancer[1][2][8].

  

• HY-46759

  Genevant CL1	1450888-71-7
  Genevant CL1 (Lipid 10) is an ionizable lipid (pKa=6.3). Genevant CL1 can be used for mRNA lipid nanoparticle (LNP) vaccine delivery[1][2].

  

• HY-49116

  CP26	500285-30-3
  CP26 is a small molecule inhibitor of protein dislocation from the ER lumen to the cytosol. CP26 targets the Hrd1 complex, inhibits ERAD, and induces ER stress[1].

  

• HY-A0059

  Nifuratel	4936-47-4	99.77%
  Nifuratel (NF 113) is an orally active broad-spectrum antibiotic with antiprotozoal, antibacterial, anticancer and anti-inflammatory activities, and has good inhibitory effects on Candida and Trichomonas. Nifuratel is also a STAT3 inhibitor, which significantly inhibits the growth and proliferation of human gastric cancer cells and induces apoptosis. In addition, Nifuratel also inhibits mast cell-mediated antigen hypersensitivity reactions and can be used in the study of IgE-mediated allergic diseases[1][2][3][4][5][6][7][8].

  

• HY-B1078

  Cefazolin sodium	27164-46-1	98.45%
  Cefazolin sodium is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research[1]. Cefazolin sodium has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD)[2].

  

• HY-N0006

  Demethoxycurcumin	22608-11-3
  Demethoxycurcumin is one of the main active ingredients of curcumin, which has anti-inflammatory, antioxidant, antibacterial, anti-cancer and neuroprotective effects. Demethoxycurcumin is orally active. Demethoxycurcumin can be used in inflammation, cancer and Alzheimer's disease research[1][2][3][4][5].

  

• HY-N0656

  Usnic acid	125-46-2
  Usnic acid is a secondary metabolite of lichens with a unique dibenzofuran skeleton. Usnic acid inhibits DNA/RNA synthesis and has antibacterial activity. Usnic acid induces cell cycle arrest and apoptosis and has anticancer activity. Usnic acid inhibits RANKL-mediated osteoclast formation and function by reducing the transcriptional and translational expression of NFATc1. Usnic acid has antioxidant and anti-inflammatory activities by inhibiting lipid peroxidation and myeloperoxidase[1][2][3][4].

  

• HY-N0769

  Isopimpinellin	482-27-9
  Isopimpinellin, an orally active compound isolated from Glomerella cingulata. Isopimpinellin blocks DNA adduct formation and skin tumor initiation by 7,12-dimethylbenz[a]anthracene. Isopimpinellin possesses anti-leishmania effect[1].

  

• HY-N1312

  Sinapaldehyde	4206-58-0	99.96%
  Sinapaldehyde is a methoxyphenol and a selective COX-2 inhibitor (IC50: 47.8 µM) that can be extracted from various plants. Sinapaldehyde has antibacterial, anti-inflammatory, and antioxidant activities. Sinapaldehyde can scavenge DPPH free radicals (IC50: 172 μM). Sinapaldehyde is active against both Gram-negative and Gram-positive bacteria[1][2].

  

• HY-N2369

  Chelidonine	476-32-4	99.91%
  Chelidonine, an isoquinoline alkaloid, can be isolated from Chelidonium majus L.. Chelidonine causes G2/M arrest and induces caspase-dependent and caspase-independent apoptosis, and prevents cell cycle progression of stem cells in Dugesia japonica. Chelidonine has cytotoxic activity against melanoma cell lines. with anticancer and antiviral activity[1][2][3].

  

• HY-N6939

  Pseudolaric Acid B	82508-31-4	99.47%
  Pseudolaric Acid B is an orally active diterpene acid. Pseudolaric Acid B has anti-fungal, anti-fertility, anti-angiogenesis and anticancer activity, and can induce tumor cell apoptosis and autophagy. In addition, Pseudolaric Acid B can inhibit the secretion of hepatitis B virus (HBV) and has immunosuppressive effect, selectively inhibiting the proliferation of T lymphocytes and the production of IL-2[1][2][3][4][5].

  

• HY-N8537

  Enfumafungin	260979-95-1	99.76%
  Enfumafungin, a triterpene glycoside, is isolated from extracts derived from fungus Hormonema carpetanum. Enfumafungin is an antifungal compound that is acting on the fungal cell wall, as the (1,3)-beta-D-glucan synthase inhibitor. Enfumafungin is specific for yeasts and fungi (excluding Cryptococcus) and does not inhibit the growth of Bacillus subtilis[1][2].

  

• HY-P1291

  PKI 14-22 amide,myristoylated	201422-03-9	99.65%
  PKI 14-22 amide, myristoylated is a selective, cAMP-dependent, competitive PKA inhibitor with Ki=~36 nM. The myristoylation modification of PKI 14-22 amide, myristoylated makes it more permeable to cell membranes and blood-brain barriers than the precursor molecule. PKI 14-22 amide, myristoylated can block the phosphorylation of cAMP-dependent downstream targets (such as CREB). PKI 14-22 amide, myristoylated can prevent the development of morphine analgesic tolerance in mice, and also inhibits protein translation and negative-strand RNA synthesis of Zika virus. PKI 14-22 amide, myristoylated can be used in research fields such as opioid tolerance mechanisms and antiviral drugs[1][2][3].

  

• HY-Y0017

  L-Norleucine	327-57-1
  L-Norleucine ((S)-2-Aminohexanoic acid) is an isomer of leucine, specifically affects protein synthesis in skeletal muscle, and has antivirus activity.

  

• HY-118069

  (R)-ZINC-3573	2089389-15-9	99.30%
  (R)-ZINC-3573 is a selective Mas-related G protein-coupled receptor X2 (MRGPRX2) agonist with an EC50 value of 740 nM. (R)-ZINC-3573 can be used as a MRGPRX2 probe for the research of pain and itch[1].

  

• HY-119502

  Camalexin	135531-86-1	99.70%
  Camalexin is a phytoalexin isolated from Camelina sativa (Cruciferae) with antibacterial, antifungal, antiproliferative and anticancer activities. Camalexin can induce reactive oxygen species (ROS) production[1][2][3].

  

• HY-119917

  Gossypetin	489-35-0
  Gossypetin is a hexahydroxylated flavonoid and is a potent mitogen-activated protein kinase kinase (MKK)3 and MKK6 inhibitor with strongly attenuates the MKK3/6-p38 signaling pathway, has various pharmacological activities, including antioxidant, antibacterial and anticancer activities[1].

  

• HY-129983

  5-Hydroxymethyl-2'-deoxyuridine	5116-24-5	99.98%
  5-Hydroxymethyl-2'-deoxyuridine is a nucleoside analog. 5-Hydroxymethyl-2'-deoxyuridine inhibits the replication of multiple human leukemia cell lines with IC50 values of 1.7-5.8 μM. 5-Hydroxymethyl-2'-deoxyuridine prolongs the survival of mice carrying L1210 leukemia. 5-Hydroxymethyl-2'-deoxyuridine can be used for the research of cell replication and leukemia[1][2][3].

  

• HY-139147

  iHCK-37	516478-09-4	99.52%
  iHCK-37 (ASN05260065) is a potent and specific Hck inhibitor with a Ki value of 0.22 μM. iHCK-37 blocks HIV-1 viral replication with an EC50 value of 12.9 μM. iHCK-37 is used for chronic myeloid leukemia (CML) research[1].

  

• HY-164036

  Lolamicin	2930690-12-1	98.02%
  Lolamicin is an orally effective inhibitor that specifically targets the Gram-negative bacteria lipoprotein transport system LolCDE complex. It selectively inhibits the transmembrane transport of outer membrane lipoproteins by competitively binding to lipoprotein binding sites. Lolamicin destroys the integrity of the bacterial outer membrane, leading to cell death, and has both bactericidal and antibacterial activity. It has significant effects on multidrug-resistant Enterobacteriaceae pathogens (such as Escherichia coli and Klebsiella pneumoniae). Lolamicin can be used to inhibit the study of acute pneumonia, sepsis and other infections caused by Gram-negative bacteria[1].

  

• HY-B2144A

  Chitosan (MW 150000)	9012-76-4
  Chitosan (MW 150000) (Deacetylated chitin (MW 150000)) is a polycationic linear polysaccharide derived from chitin with the molecular weight of 150000. Chitosan is an versatile biomaterial because of its non-toxicity, low allergenicity, biocompatibility and biodegradability. Chitosan also has antitumor, antibacterial, antifungal, and antioxidant activities[1][2].

  

• HY-E70306

  Zymolyase, Arthrobacter luteus
  Zymolyase, Arthrobacter luteus, is a zymolyase mainly found in Arthrobacter luteus. Enzyme, an enzyme with beta-1,3 glucanase activity, removes the electron-dense outer layer of the Plasmodium karinii cell wall, exposing an electron-lucent layer[1].

  

• HY-111529A

  Tafenoquine Succinate	106635-81-8	99.91%
  Tafenoquine Succinate (WR 238605 Succinate) is an 8-aminoquinoline. Tafenoquine is an anti-malarial prophylactic agent[1].

  

• HY-W355700

  1-Oleoyl-2-hydroxy-sn-glycero-3-phosphoethanolamine	89576-29-4
  1-oleoyl-sn-glycero-3-phosphoethanolamine (LysoPE 18:1) is a lysophosphatidylethanolamine molecule involved in phospholipid metabolism, targeting cell membrane receptors (such as G protein-coupled receptors) to regulate cell signaling pathways. 1-oleoyl-sn-glycero-3-phosphoethanolamine may activate mitogen-activated protein kinase (MAPK) signaling, promote cell migration, regulate inflammatory responses and lipid metabolism, and has both pro-inflammatory and anti-inflammatory activities. 1-oleoyl-sn-glycero-3-phosphoethanolamine is mainly used in the screening of biomarkers for metabolic diseases (such as non-alcoholic fatty liver disease and obesity), as well as the study of the mechanism of lysophospholipids in cell membrane homeostasis and signal transduction[1][2].

  

• HY-W440832

  DSPE-PEG-Azide, MW 2000
  DSPE-PEG-Azide (MW 2000) is an azide containing lipid that can be used to form micelles as nanoparticles for drug delivery[1]. DSPE-PEG-Azide (MW 2000) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-17566

  Capreomycin sulfate	1405-37-4
  Capreomycin sulfate is a macrocyclic peptide antibiotic that inhibits phenylalanine synthesis in mycobacterial ribosomal translation. Capreomycin sulfate has anti-amyloidogenic and pro-fibrinolytic activities, reducing amyloid-induced cytotoxicity by inhibiting the occurrence of amyloid fibrillation. Capreomycin sulfate can be used in the study of multidrug-resistant tuberculosis, type 2 diabetes, Alzheimer's disease and Parkinson's disease[1][2][3][4][5].

  

• HY-13238A

  Dolutegravir sodium	1051375-19-9	99.97%
  Dolutegravir sodium (S/GSK1349572 sodium) is a highly potent and orally bioavailable HIV integrase strand transfer inhibitor with an IC50 of 2.7 nM for HIV-1 integrase-catalyzed strand transfer. Dolutegravir sodium (S/GSK1349572 sodium) inhibits HIV-1 viral replication with an IC50 of 0.51 nM in peripheral blood mononuclear cells. Dolutegravir sodium (S/GSK1349572 sodium) retains a high potency against the HIV-1 Y143R, N155H, and G140S/Q148H mutants (EC50=3.6-5.8 nM)[1][2].

  

• HY-14809

  Amenamevir	841301-32-4	99.89%
  Amenamevir is a helicase-primase inhibitor which has potent antiviral activity against HSVs with an EC50 of 14 ng/mL.

  

• HY-112180

  Rilematovir	1383450-81-4
  Rilematovir (JNJ-678) is a novel fusion protein inhibitor. Rilematovir has the potential for respiratory syncytial virus (RSV) research.

  

• HY-120072

  PF-3450074	1352879-65-2	98.44%
  PF-3450074 (PF-74) is a specifical inhibitor of HIV-1 capsid protein (CA) and displays a broad-spectrum inhibition of HIV isolates with submicromolar potency (EC50=8-640 nM). PF-3450074 (PF-74) acts at an early stage of HIV-1 infection, inhibits viral replication by directly competing with the binding of CPSF6 and NUP153, and blocks the uncoating, assembly, and the reverse transcription steps of the viral life cycle[1][2]. CPSF6: nuclear host factors cleavage and polyadenylation specific factor 6; NUP153: nucleoporin 153.

  

• HY-158312

  UH15-38	2540881-21-6	99.80%
  UH15-38 is a potent RIPK3 inhibitor with an IC50 value of 20 nM. UH15-38 blocks IAV (influenza A virus)-activated necroptosis. UH15-38 dampens IAV-induced lung injury[1].

  

• HY-17560

  Demeclocycline hydrochloride	64-73-3
  Demeclocycline hydrochloride is a tetracycline antibiotic; is an antibiotic in the treatment of Lyme disease, acne, and bronchitis.

  

• HY-N0012

  Glycitin	40246-10-4	99.71%
  Glycitin (Glycitein 7-O-β-glucoside) is a natural isoflavone with antibacterial, antiviral, anticancer, anti-inflammation, anti-aging and estrogenic effects. Glycitin may regulate osteoblasts through TGF-β or AKT signaling pathways in bone marrow stem cells (BMSCs)[1][2].

  

• HY-145994

  Obeldesivir	2647441-36-7	99.53%
  Obeldesivir (ATV006) is a potent, orally active antiviral agent and ester proagents of GS-441524. Obeldesivir inhibits the replication of SARS-CoV-2 and its variants. Obeldesivir can be used for SARS-CoV-2 research[1].

  

• HY-P2455

  LLO (91-99)	137856-41-8	99.04%
  LLO (91-99) (Listeriolysin O (91-99)) is an exotoxin and class I MHC-restricted T-cell epitope of listeriolysin (LLO). LLO (91-99) is processed by antigen-presenting cells, binds to MHC class I molecules and is presented to the cell surface. LLO (91-99) induces CTL responses and effectively eliminates Listeria from infected cells. LLO (91-99) can be used in the research of Listeria infections (e.g., listeriosis)[1][2][3].

  

• HY-13573

  Biapenem	120410-24-4
  Biapenem (CLI 86815; L 627; LJC 10627) a parenteral carbapenem antibacterial agent with a broad spectrum.

  

• HY-13702

  Nilutamide	63612-50-0
  Nilutamide (Nilandron) is an orally active nonsteroidal androgen receptor antagonist with affinity for androgen receptors but not for progestogen, estrogen or glucocorticoid receptors. Nilutamide can be used to research prostate cancer. Nilutamide also has antischistosomal properties[1][4].

  

• HY-15308

  Avermectin B1a	65195-55-3
  Avermectin B1a is an antiparasitic agent that paralyzes nematodes without causing hypercontraction or flaccid paralysis.

  

• HY-50730

  Asparagusic acid	2224-02-4
  Asparagusic acid is a sulfur-containing flavor component produced by Asparagus officinalis Linn., with anti-parasitic effect. Asparagusic acid is a plant growth inhibitor[1][2][3].

  

• HY-B0462

  Azelastine hydrochloride	79307-93-0	99.93%
  Azelastine hydrochloridem, an antihistamine, is a potent and selective histamine 1 (H1) antagonist. Azelastine hydrochloride can be used for the research of allergic rhinitis, asthma, diabetic hyperlipidemic and SARS-CoV-2[1][2][3][4].

  

• HY-B2184

  Sofalcone	64506-49-6	98.84%
  Sofalcone, a gastric antiulcer agent, is known to induce the expression of Heme oxygenase-1 (HO-1) in gastric epithelium.

  

• HY-N0207

  Patchouli alcohol	5986-55-0
  Patchouli alcohol is a natural tricyclic sesquiterpene, exhibits anti-Helicobacter pylori, anti-inflammatory and antioxidant properties[1].

  

• HY-N0704

  Agrimol B	55576-66-4
  Agrimol B, a polyphenol, is an orally active and potent SIRT1 activator. Agrimol B shows anti-adipogenic and anticancer activity. Agrimol B shows antibacterial activity against plant pathogens. Agrimol B dramatically inhibits 3T3-L1 adipocyte differentiation by reducing PPARγ, C/EBPα, FAS, UCP-1, and apoE expression. The action of Agrimol B on the cancer cells is likely derived from its effect on c-MYC, SKP2 and p27[1][2][3].

  

• HY-N2594

  Isoforsythiaside	1357910-26-9	99.94%
  Isoforsythiaside is an antioxidant and antibacterial phenylethanoid glycoside with MICs of 40.83, 40.83, and 81.66 μg/mL for Escherichia coli(E. coli), Pseudomonas aeruginosa(PAO), and Staphylococcus aureus (SA), respectively[1].

  

• HY-N6613

  Polygalacturonic acid	25990-10-7
  Polygalacturonic acid (Galacturonic acid polymer) is transparent colloid, is a major component of the cell wall. Polygalacturonic acid can be used to prepare silver nanoparticles (AgNPs), as an antioxidant and anti-inflammatory that protect cells from destructive effect of elevated ROS and accelerate wound healing. Polygalacturonic acid nanoparticles also displays anti-bacterial activity[1][2].

  

• HY-N6871

  Abietic acid	514-10-3
  Abietic acid, an orally active diterpene isolated from Colophony, displays significant anti-proliferative, anti-inflammatory, anti-obesity effect, bacteriostatic, cell cycle arresting and pro-apoptotic activities. Abietic acid inhibits lipoxygenase activity for allergy. Abietic acid enhances cell migration and tube formation in HUVECs. Abietic acid induces significant angiogenic potential, which is associated with upregulation of extracellular signal-regulated kinase (ERK) and p38 expression. Abietic acid attenuates sepsis-induced lung injury by inhibiting nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathway to inhibit M1 macrophage polarization. Abietic acid exhibits a positive effect against liver injury by attenuating inflammation and ferroptosis. Abietic acid shows accelerated wound closure in a mouse model of cutaneous wounds. Abietic acid significantly reduces the proliferation and growth of NSCLC cells by IKKβ inhibition.Additionally, Abietic acid ameliorates psoriasis-like inflammation and modulates gut microbiota in mice. Abietic acid is promising for research in non-small-cell lung cancer (NSCLC), liver injury-related deseases and psoriasis[1][2][3][4][5][6][7].

  

• HY-100373

  Isavuconazonium sulfate	946075-13-4	98.53%
  Isavuconazonium sulfate (BAL8557-002) is an orally active broad-spectrum antifungal molecule. Isavuconazonium sulfate is a precursor of the triazole antifungal active molecule Isavuconazole. Isavuconazonium sulfate can be used in the study of invasive aspergillosis, mucormycosis, blastomycosis, and Acanthamoeba keratitis[1][2][3][4][5].

  

• HY-101448

  TMI-1	287403-39-8
  TMI-1 (WAY-171318) inhibits TNF converting enzyme (TACE) (IC50 of 8.4 nM), ADAM-TS-4, ADAM-17 and various MMPs with oral activity. TMI-1 significantly suppresses the secretion of TNF-α , alleviating collagen-induced arthritis in mice. TMI-1 inhibits cancer cell proliferation, induces apoptosis through a caspase-dependent pathway. TMI-1 also reverses TRPV1 upregulation and lowers the levels of inflammatory factors (TNF-α、IL-1β、IL-6) in nerve cells, protecting against paclitaxel-induced neurotoxicity. TMI-1 leads to changes in pro-atherogenic lipoprotein profiles, but does not affect the progression of early lesions[1][2][3][4].

  

• HY-101476

  Emodepside	155030-63-0	98.42%
  Emodepside (PF 1022-221) is a cyclooctadepsipeptide with broad-spectrum anthelmintic activity.

  

• HY-117832

  Pyripyropene A	147444-03-9
  Pyripyropene A is an orally active, potent and selective sterol O-acyltransferase 2 (SOAT2)/acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) inhibitor, with an IC50 of 0.07 µM. Pyripyropene A attenuates hypercholesterolemia and atherosclerosis in vivo[1][2][3][4].

  

• HY-118697

  N-dodecanoyl-L-Homoserine lactone	137173-46-7
  N-dodecanoyl-L-Homoserine lactone (C12-HSL) is a quorum sensing (QS) signaling molecule. N-dodecanoyl-L-Homoserine lactone (C12-HSL) aptamers blocks qurom sensing and inhibits biofilm formation in Pseudomonas aeruginosa[1].

  

• HY-B0268A

  Enoxacin hydrate	84294-96-2	99.85%
  Enoxacin hydrate (Enoxacin sesquihydrate), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin hydrate is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin hydrate has potent activities against gram-positive and -negative bacteria. Enoxacin hydrate is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing[1][2][3][4].

  

• HY-W010629

  2-Chloroacetamide	79-07-2
  2-Chloroacetamide is a preservative and is a herbicide for both uplands and paddy fields. 2-Chloroacetamide is a biocide in agriculture, glues, paints and coatings. 2-Chloroacetamide inhibits very-long-chain fatty acid elongase[1][2][3].

  

• HY-W062216

  2-Aminoimidazole	7720-39-0
  2-Aminoimidazole is a potent antibiofilm agent that can be used as an adjuvant to antimicrobial. 2-aminoimidazoles disrupts the ability of bacteria to protect themselves by inhibiting biofilm formation and genetically-encoded antibiotic resistance traits. 2-Aminoimidazole is also a weak noncompetitive inhibitor of human arginase I with a Ki of 3.6 mM[1][2][3].

  

• HY-121295

  Roseoflavin	51093-55-1
  Roseoflavin, a natural pigment originally isolated from Streptomyces davawensis, is an antimetabolite analog of Riboflavin and flavin mononucleotide that has antimicrobial properties[1].

  

• HY-13997

  Ombitasvir	1258226-87-7	99.79%
  Ombitasvir is a potent inhibitor of the hepatitis C virus protein NS5A, with EC50s of 0.82 to 19.3 pM against HCV genotypes 1 to 5, and 366 pM against genotype 6a.

  

• HY-15728

  Radotinib	926037-48-1	98.92%
  Radotinib (IY-5511) is an orally active and BBB-permeable selective tyrosine kinase Bcr-Abl1 inhibitor with an IC50 of 34 nM. Radotinib has anti-prion and anti-tumor activities. Radotinib can inhibit the proliferation, induce cell cycle arrest and apoptosis of tumor cells . Radotinib can be used in the research of cancer such as chronic myeloid leukemia and multiple myeloma, as well as neurodegenerative diseases such as prion diseases[1][2][3].

  

• HY-17430

  Amprenavir	161814-49-9	99.53%
  Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.09 μM.

  

• HY-80003

  QL47	1469988-75-7	98.11%
  QL47, a broad-spectrum antiviral agent, inhibits dengue virus and other RNA viruses. QL47 selectively inhibits eukaryotic translation. QL47 is a potent covalent inhibitor of BTK with an IC50 of 7 nM[1][2][3].

  

• HY-B0778

  Milbemycin oxime	129496-10-2	99.52%
  Milbemycin oxime is an orally active macrolide with broad-spectrum antiparasitic activity. Milbemycin oxime is a mixture of oximes consisting of oxime derivatives corresponding to milbemycin A4 and A3. Milbemycin oxime binds to glutamate-gated chloride channels and has inhibitory potency against intestinal nematodes and lung/heart worms[1][2][3].

  

• HY-139597

  Temocillin disodium	61545-06-0
  Temocillin disodium, a 6-α-methoxy penicillin, possesses antibacterial activity[1].

  

• HY-15233

  Letermovir	917389-32-3	99.96%
  Letermovir (AIC246) is a potent inhibitor of CMV, which targets the viral terminase complex and remains active against virus resistant to DNA polymerase inhibitors.

  

• HY-17008

  Toltrazuril (sulfone)	69004-04-2	98.59%
  Toltrazuril sulfone (Ponazuril) is a metabolite of Toltrazuril (HY-B0175), with antiprotozoal activity. Toltrazuril sulfone is a triazine anticoccidial that is developed to prevent coccidiosis in poultry[1][2].

  

• HY-19314

  Azvudine	1011529-10-4	99.79%
  Azvudine (RO-0622) is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine inhibits NRTI-resistant viral strains[1]. Azvudine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-B0277

  Vidarabine	5536-17-4
  Vidarabine (Ara-A) an antiviral agent which is active against herpes simplex and varicella zoster viruses[1][2]. Vidarabine has IC50s of 9.3 μg/ml for HSV-1 and 11.3 μg/ml for HSV-2[2]. Vidarabine also has anti-orthopoxvirus activity[3].

  

• HY-B0853

  Paclobutrazol	76738-62-0
  Paclobutrazol is a triazole-containing plant growth retardant that is known to inhibit the biosynthesis of gibberellins. Paclobutrazol also has antifungal activities. Paclobutrazol, transported acropetally in plants, can also suppress the synthesis of abscisic acid and induce chilling tolerance in plants. Paclobutrazol is typically used to support research on the role of gibberellins in plant biology[1][2].

  

• HY-B1099

  Hycanthone	3105-97-3	99.97%
  Hycanthone is a thioxanthenone DNA intercalator and inhibits RNA synthesis as well as the DNA topoisomerases I and II. Hycanthone inhibits nucleic acid biosynthesis and inhibits apurinic endonuclease-1 (APE1) by direct protein binding with a KD of 10 nM. Hycanthone is a bioactive metabolite of Lucanthone (HY-B2098) and has anti-schistosomal agent[1].

  

• HY-B1156

  Cephradine	38821-53-3
  Cephradine (Cefradine) is a broad-spectrum and orally active cephalosporin. Cephradine is active against both gram-positive and gram-negative pathogens. Cephradine is effective in eradicating most penicillinase-producing organisms. Cephradine has been used in the research of genitourinary, gastrointestinal and respiratory tract infections, and in infections of the skin and soft tissues. Cephradine blocks solar-ultraviolet induced skin inflammation through direct inhibition of TOPK[1][2][3].

  

• HY-N0152

  Myricitrin	17912-87-7	99.64%
  Myricitrin, a naturally occurring flavonoid, is an orally active nitric oxide (NO) and PKC inhibitor. Myricitrin has central nervous system activity, including anxiolytic-like action. Myricitrin possesses antioxidant, anti-inflammatory, antifibrotic and anti-malarial effects[1][2][3][4][5].

  

• HY-N0216

  Benzoic acid	65-85-0
  Benzoic acid is an aromatic alcohol existing naturally in many plants and is a common additive to food, drinks, cosmetics and other products. It acts as preservatives through inhibiting both bacteria and fungi[1][2].

  

• HY-N0808

  Camphor	76-22-2
  Camphor ((±)-Camphor) is a topical anti-infective and anti-pruritic and internally as a stimulant and carminative. However, Camphor is poisonous when ingested. Antiviral, antitussive, and anticancer activities[1]. Camphor is a TRPV3 agonist[2].

  

• HY-N1365

  Isoscopoletin	776-86-3	99.92%
  Isoscopoletin (6-Hydroxy-7-methoxycoumarin) is an active constituent in Artemisia argyi leaves. Isoscopoletin shows substantial inhibition against cell proliferation, with IC50s of 4.0 μM and 1.6 μM for human CCRF-CEM leukaemia cells and multidrug resistant subline CEM/ADR5000, respectively[1]. Isoscopoletin (6-Hydroxy-7-methoxycoumarin) possesses inhibitory activity against HBV replication[2]. Isoscopoletin exhibits anti-inflammatory activity through inhibition of MAPK/NF-κB/STAT/AKT signaling pathway[3].

  

• HY-N6626

  Pyraclostrobin	175013-18-0	99.91%
  Pyraclostrobin is a highly effective and broad-spectrum strobilurin fungicide. Pyraclostrobin can induce oxidative DNA damage, mitochondrial dysfunction and autophagy through the activation of AMPK/mTOR signaling. Pyraclostrobin can be used to control crop diseases[1][2][3].

  

• HY-N6647

  Luteolin-7-rutinoside	20633-84-5
  Luteolin-7-rutinoside has both anti-arthritic and antifungal activities, can result in a combination therapy for the treatment of fungal arthritis due to C. albicans infection.

  

• HY-100593

  Spiramycin	8025-81-8	98.56%
  Spiramycin (Rovamycin) is a macrolide antibiotic produced by Streptomyces ambofaciens with against bacteria and Toxoplasma gondii activities, and also has antiparasitic effect. Spiramycin is composed of a 16-member lactone ring, on which three sugars (mycaminose, forosamine, and mycarose) are attached[1][2].

  

• HY-100719

  BRD-6929	849234-64-6
  BRD-6929 is a potent, selective brain-penetrant inhibitor of class I histone deacetylase HDAC1 and HDAC2 inhibitor with IC50 of 1 nM and 8 nM, respectively. BRD-6929 shows high-affinity to HDAC1 and HDAC2 with Ki of 0.2 and 1.5 nM, respectively. BRD-6929 can be used for mood-related behavioral model research[3].

  

• HY-111919

  3-Nitrocoumarin	28448-04-6
  3-Nitrocoumarin is an inhibitor for phospholipase C that blocks the generation of inositol triphosphate (IP3), thereby affecting the calcium signaling pathway[1][2].

  

• HY-116010

  Oleandomycin	3922-90-5
  Oleandomycin is a macrolide antibiotic structurally closely related to Erythromycin. Oleandomycin is similar to Erythromycin with antimicrobial activity. Oleandomycin inhibits protein synthesis by interference with translation of activated amino acids to nascent peptide chains on the ribosomes[1][2].

  

• HY-121620

  Monolaurin	142-18-7	99.26%
  Monolaurin (1-Monolaurin) is an orally active antibiotic with antiviral and antibacterial properties[1][2][3].

  

• HY-121969

  DDX3-IN-2	1919828-81-1	99.36%
  DDX3-IN-2 is an active DEADbox polypeptide 3 (DDX3) inhibitor with an IC50 value of 0.3 μM. DDX3-IN-2 shows a broad spectrum of antiviral activity. DDX3-IN-2 has the potential to overcome HIV resistance[1].

  

• HY-122818

  BpV(phen) trihydrate	171202-16-7
  BpV(phen) trihydrate, a insulin-mimetic agent, is a potent protein tyrosine phosphatase (PTP) and PTEN inhibitor with IC50s of 38 nM, 343 nM and 920 nM for PTEN, PTP-β and PTP-1B, respectively. BpV(phen) trihydrate inhibits proliferation of the protozoan parasite Leishmania in vitro. bpV(phen) trihydrate strongly induces the secretion of a large number of chemokines and pro-inflammatory cytokines, and it activates a Th1-type pathway (IL-12, IFNγ). BpV(phen) trihydrate can also induce cell apoptosis, and has anti-angiogenic and anti-tumor activity[1][2][3][4][5].

  

• HY-142021

  Z-Leu-Arg-AMC	156192-32-4	98.98%
  Z-Leu-Arg-AMC is a 4-methylcoumarinyl-7-amide (Amc) leucine derivative with carboxybenzoyl (Z). Z-Leu-Arg-AMC is the active site of cysteine proteinase trypanopain-Tb from Trypanosoma brucei brucei[1].

  

• HY-17624A

  Framycetin sulfate	4146-30-9
  Framycetin sulfate (Neomycin B sulfate), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin sulfate competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin sulfate inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin sulfate, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections[1][2].

  

• HY-A0246A

  Flucloxacillin sodium	1847-24-1
  Flucloxacillin sodium is an active antibiotic against gram-positive and gram-negative bacteria[1][2].

  

• HY-B1071A

  Lasalocid sodium	25999-20-6	98.28%
  Lasalocid sodium (Lasalocid-A sodium) is an antibacterial agent.

  

• HY-B1350A

  Fusidic acid sodium salt	751-94-0	99.64%
  Fusidic acid sodium salt is an orally available antibacterial agent that inhibits bacterial protein synthesis by preventing the release of translation elongation factor G (EF-G) from ribosomes. Fusidic acid sodium salt inhibits the inhibitory and activating effects of interleukins IL-1 and IL-6 on glucose-induced insulin production and exhibits antidiabetic effects in a rat model. Fusidic acid sodium salt improves the symptoms of colitis in rats and inhibits the growth of Toxoplasma gondii and Listeria monocytogenes EGD in vitro, but not in mice[1][2][3][4][5][6].

  

• HY-129434A

  4aα,7α,7aα-Nepetalactone	21651-62-7	99.69%
  4aα,7α,7aα-Nepetalactone exhibits antibacterial activity, and inhibits Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi and Enterococcus faecalis.

  

• HY-W008806

  N-(3-Oxohexanoyl)-L-homoserine lactone	143537-62-6
  N-(3-Oxohexanoyl)-L-homoserine lactone (OHHL; N-(3-Oxohexanoyl)homoserine lactone) is a specific agonist of LuxR-type transcription factor CarR with a Kd of 1.8 μM. N-(3-Oxohexanoyl)-L-homoserine lactone activates CarR by inducing protein multimerization, promoting its binding to target DNA sequences in the carR-carA intergenic region, thereby upregulating the transcription of carbapenem biosynthesis genes. N-(3-Oxohexanoyl)-L-homoserine lactone acts as a quorum sensing signal molecule, enabling bacteria to coordinate the production of carbapenem antibiotics in a cell density-dependent manner. N-(3-Oxohexanoyl)-L-homoserine lactone is used to study bacterial quorum sensing mechanisms, especially the secondary metabolism and virulence factor regulatory pathways of Erwinia carotovora and Yersinia enterocolitica[1][2][3].

  

• HY-Y0319B

  Acetic acid potassium 99%	127-08-2
  Acetic acid potassium 99% is a potassium salt employed to replenish electrolytes, for restoration of water-electrolyte balance. Acetic acid potassium 99% can employ in DNA and protein purification. Acetic acid potassium 99% has been used to prepare neutralizing solution for alkaline lysis of bacteria[1][2].

  

• HY-P0018A

  Pepstatin Trifluoroacetate		98.77%
  Pepstatin (Pepstatin A) Trifluoroacetate is a specific, orally active aspartic protease inhibitor produced by actinomycetes, with IC50s of 4.5 nM, 6.2 nM, 150 nM, 290 nM, 520 nM and 260 nM for hemoglobin-pepsin, hemoglobin-proctase, casein-pepsin, casein-proctase, casein-acid protease and hemoglobin-acid protease, respectively. Pepstatin Trifluoroacetate also inhibits HIV protease[1][2].

  

• HY-14272

  Ravuconazole	182760-06-1	99.91%
  Ravuconazole (BMS-207147;ER-30346) is an orally available triazole antifungle agent that potently inhibits a wide range of fungi.

  

• HY-14818

  Laninamivir	203120-17-6	99.27%
  Laninamivir (R 125489) is a potent influenza neuraminidase (NA) inhibitor with IC50s of 0.90 nM, 1.83 nM and 3.12 nM for avian H12N5 NA (N5), pH1N1 N1 NA (p09N1) and A/RI/5+/1957 H2N2 N2 (p57N2), respectively[1].

  

• HY-16278

  Pradigastat	956136-95-1	98.88%
  Pradigastat (LCQ-908) is a selective and orally effective diacylglyceryl acyltransferase 1 (DGAT1) inhibitor with IC50 at 0.157 µM. Pradigastat is primarily used to study diseases associated with abnormal triglyceride metabolism. Pradigastat has anti-obesity and anti-diabetic effects. Pradigastat inhibited BCRP, OATP1B1, OATP1B3 and OAT3 activities with IC50 of 5 µM, 1.66µM, 3.34µM and 0.973µM, respectively. In addition, Pradigastat has antiviral activity and can inhibit hepatitis C virus replication in vitro[1][2][3][4].

  

• HY-112762

  LHF-535	1450929-77-7	99.14%
  LHF-535 is an antiviral agent extracted from patent WO2013123215A2, Compound 38, has EC50s of <1 μM, <1 μM, <1 μM, and 1-10 μM for Lassa, Machupo, Junin, and VSVg virus, respectively[1].

  

• HY-B1222

  Sisomicin sulfate	53179-09-2
  Sisomicin sulfate is a broad-spectrum aminoglycoside antibiotic produced by Micromonospora inyoensis. Sisomicin sulfate is highly active against Gram-positive bacteria.

  

• HY-15381

  Fingolimod phosphate	402615-91-2	99.18%
  Fingolimod phosphate (FTY720 phosphate) is an orally active sphingosine 1-phosphate (S1P) receptor agonist. Fingolimod phosphate can promote the neuroprotective effects of microglia. Fingolimod phosphate can be used for the research of multiple sclerosis and neurologic diseases[1].

  

• HY-15662

  Tulathromycin A	217500-96-4
  Tulathromycin A (Tulathromycin), a macrolide antibiotic, inhibits protein synthesis (IC50=0.26 µM) by targeting bacterial ribosome. Tulathromycin A is used for the research of respiratory disease in cattle and swine. Immunomodulatory effects[1][2][3].

  

• HY-B0905

  Tilmicosin	108050-54-0
  Tilmicosin (LY-177370) is an orally active calcium channel antagonist and macrolide antibiotic with antimicrobial activity. Tilmicosin mainly acts on the 50S subunit of bacterial ribosomes, inhibiting protein synthesis. Tilmicosin is effective in the treatment of respiratory diseases in livestock such as cattle, sheep and pigs. In addition, Tilmicosin has immunomodulatory and anti-inflammatory effects[1][2][3][4][5][6].

  

• HY-D1117

  NADA-green	2253733-11-6
  NADA-green is a fluorescent D-amino acid probe. NADA-green is efficiently incorporated into the peptidoglycan of diverse bacterial species peptidoglycan biosynthesis. NADA-green allows probing of bacterial growth with minimal perturbation[1].

  

• HY-N0440

  Germacrone	6902-91-6	99.76%
  Germacrone is a sesquiterpene compound with multiple biological activities. Germacrone inhibits the H1N1 and H3N2 influenza A virus and the influenza B virus. Germacrone blocks the progressionof arthritis by regulating Th1/Th2 balance and inhibiting NF-κB signaling. Germacrone can arrest the cell cycle at G0/G1 and G2/M phases and induce apoptosis in breast cancer cells. Germacrone inhibits 5α-reductase and has anti-androgenic effect. Germacrone has neuroprotective functions and can be used for the study of traumatic brain injury (TBI). Germacrone also has antioxidant activity[1][2][3][4][5].

  

• HY-N0576

  Solanesol	13190-97-1
  Solanesol is an aliphatic terpene alcohol mainly found in Solanaceous plants, with anti-inflammatory, neuroprotective, and antimicrobial activities[1].

  

• HY-N0765

  Isoliquiritin	5041-81-6	99.79%
  Isoliquiritin, isolated from Licorice Root, inhibits angiogenesis and tube formation. Isoliquiritin also exhibits antidepressant-like, anti-oxidative, anti-Inflammatory effects and antifungal activity[1][2][3].

  

• HY-N2010

  Methyl gallate	99-24-1
  Methyl gallate is a plant phenolic with antioxidant, anticancer, and anti-inflammatory activities. Methyl gallate also shows bacterial inhibition activity. Methyl gallate also has anti-HIV-1 and HIV-1 enzyme inhibitory activities.

  

• HY-N2011

  Octyl gallate	1034-01-1	98.01%
  Octyl gallate (Progallin O) is widely used as a food additive, with antimicrobial and antioxidant activity[1][2]. Octyl gallate (Progallin O) shows selective and sensitive fluorescent property[2]. Octyl gallate shows a marked antiviral effect against HSV-1, vesicular stomatitis virus (VSV) and poliovirus[3].

  

• HY-N6961

  Lapachol	84-79-7
  Lapachol, a natural naphthoquinone, is an orally active, potent DHODH inhibitor. Lapachol has immunosuppressive activity on lymphocytes through its direct ability to block DHODH activity and inhibit pyrimidine synthesis. Lapachol is a vitamin K antagonist with antitumor activity and can inhibit DNA and RNA synthesis in neoplastic cells. Lapachol has anti-Leishmania activity[1][2][3].

  

• HY-N7108

  7-Hydroxyflavone	6665-86-7	99.84%
  7-Hydroxyflavone is a flavonoid isolated from Clerodendrum phlomidis, with anti-inflammatory activity. 7-Hydroxyflavone protects renal cells from nicotine (NIC)-associated cytotoxicity via the ERK/Nrf2/HO-1 pathway. 7-Hydroxyflavone inhibits PKM2 with an IC50 of 2.12 μM. 7-Hydroxyflavone inhibits COX-2 and 5-LOX with IC50 of 27 µg/mL and 33 µg/mL. 7-Hydroxyflavone is orally active[1][2][4].

  

• HY-P3466

  Nisin Z	137061-46-2
  Nisin Z is an antimicrobial and anti-inflammatory peptide. Nisin Z is effective against Gram-positive bacteria and fungi, such as C. albicans[1][4].

  

• HY-101441

  ST-193	489416-12-8	99.93%
  ST-193 is a potent broad-spectrum arenavirus inhibitor; inhibits Guanarito, Junin, Lassa and Machupo virus with IC50 values of 0.44, 0.62, 1.4 and 3.1 nM, respectively.

  

• HY-107212

  Selamectin	220119-17-5	99.05%
  Selamectin, a semi-synthetic macrocyclic lactone, is a potent parasiticide and anthelminthic. Selamectin activates glutamate-gated chloride channels in neurons and pharyngeal muscles to prevent heartworm, Lymphatic filariae, and nematode infection. Selamectin is also a potent P-glycoprotein substrate and a P-glycoprotein inhibitor with an IC50 of 120 nM[1][2].

  

• HY-108472

  Loxoribine	121288-39-9
  Loxoribine (7-Allyl-8-oxoguanosine) is a guanosine analog with anti-viral and anti-tumor activities. Loxoribine is an orally bioavailable and selective Toll-like receptor (TLR) 7 agonist[1][2][3].

  

• HY-111832

  1,2,3,6-Tetragalloylglucose	79886-50-3
  1,2,3,6-Tetragalloylglucose (TEgG) is a competitive inhibitor of UDP-glucuronyltransferase UGT1A1, targeting the competitive substrate binding site of UGT1A1. 1,2,3,6-Tetragalloylglucose inhibits UGT1A1-mediated β-estradiol 3-glucuronidation and SN-38 glucuronidation with IC50 of 6.01 μM and 4.31 μM, respectively, and binds to UGT1A1 with Ki of 3.55 μM. 1,2,3,6-Tetragalloylglucose also induces tumor cell apoptosis, inhibit cell proliferation, activates caspase-3 and induces DNA fragmentation in HL-60 cells. 1,2,3,6-Tetragalloylglucose also inhibits HIV integrase and reverse transcriptase, and inhibits HCV protease[1][2][3].

  

• HY-119024

  BCI-137	112170-24-8
  BCI-137 is a competitive AGO2 inhibitor, with an IC50 of 342 μM. BCI-137 tightly binds to several residues of the Mid domain[1].

  

• HY-128423

  Tylvalosin tartrate	63428-13-7	98.77%
  Tylvalosin (Acetylisovaleryltylosin) tartrate is an orally active, broad-spectrum macrolide antibiotic with antimicrobial activity. Tylvalosin tartrate is an antiviral agent useful in studying PRRSV infection. Tylvalosin tartrate induces apoptosis. Tylvalosin tartrate also has anti-inflammatory activity, relieves oxidative stress, and alleviates acute lung injury by inhibiting NF-κB activation[1][2][3][4].

  

• HY-14855B

  Tedizolid phosphate	856867-55-5	99.65%
  Tedizolid phosphate (TR-701FA) is a MAO-A and MAO-B inhibitor with activity against Gram-positive bacteria[1].

  

• HY-155583

  RNase L-IN-1		98.55%
  RNase L-IN-1 (compound 17a) is an inhibitor of RNase L, or Ribonuclease L. RNase L degrades RNAs to prevent viral replication, and mediates the innate immune responses and inflammation[1].

  

• HY-N10470

  Bleomycin A5	11116-32-8	98.55%
  Bleomycin A5 (Pingyangmycin) is an orally active glycopeptide antibiotics. Bleomycin A5 has a role as an antineoplastic agent, an apoptosis inducer and a bacterial metabolite[1][2].

  

• HY-N1428S

  Citric acid-d4	147664-83-3
  Citric acid-d4 is the deuterium labeled Citric acid (HY-N1428). Citric acid is a natural preservative and food tartness enhancer. Citric acid induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-126437A

  Poly-L-lysine hydrochloride	26124-78-7
  Poly-L-lysine hydrochloride is a nonspecific attachment factor for cells useful in promoting cell adhesion to solid substrates by enhancing electrostatic interaction between negatively charged ions of the cell membrane and the culture surface. Poly-L-lysine hydrochloride is a strong-attraction regulator that promotes liquid-liquid phase separation (LLPS) at low concentrations but suppresses LLPS at high concentrations. Antibacterial cationic peptide.[1].

  

• HY-130187A

  Sapienic acid sodium	217477-25-3
  Sapienic acid sodium is a fatty acid commonly found on the skin and in mucosa. Sapienic acid sodium has variable antimicrobial activities against Gram-positive and Gram-negative bacteria found on the skin and in the oral cavity. Sapienic acid sodium is active against Streptococcus sanguinis, Streptococcus mitis and Fusobacterium nucleatum with MBC values of 31.3 μg/mL, 375.0 μg/mL and 93.8 μg/mL, respectively[1].

  

• HY-135748A

  Poly (I:C):Kanamycin (1:1) (sodium)
  Poly (I:C):Kanamycin (1:1) sodium is an isometric complex of Poly (I:C) (HY-135748) and Kanamycin (HY-16566). Poly(I:C) sodium, a synthetic analog of double-stranded RNA, is a TLR3 and retinoic acid-inducible gene I receptor (RIG-I and b>MDA5) agonist. Poly(I:C) sodium can be used as a vaccine adjuvant to enhance innate and adaptive immune responses and induce apoptosis in cancer cells[1][2]. Kanamycin is an orally active antibacterial agent (Gram-negative/positive bacteria) that inhibits translocation and causes miscoding by binding to the 70S ribosomal subunit. Kanamycin shows good inhibitory activity against Mycobacterium tuberculosis (susceptible and drug-resistant) and Klebsiella pneumoniae, and can be used in the research of tuberculosis and pneumonia[3][4][5][6].

  

• HY-W016819

  5-Fluoroorotic acid	703-95-7
  5-Fluoroorotic acid is the inhibitor for thymidylate synthase that acts as a selective agent in yeast molecular genetics. 5-Fluoroorotic acid exhibits antimalarial activity[1][2][3].

  

• HY-17442

  Azathramycin	76801-85-9
  Azathramycin (Desmethyl Azithromycin) is a macrolide antibiotic. Azathramycin is a derivative of the anti-ribosomal antibiotic Azithromycin (HY-17506). Azathramycin exerts its antibacterial activity by binding to ribosomes and inhibiting bacterial protein synthesis. Azathramycin can selectively target and kill human senescent fibroblasts and is expected to be used in anti-aging research. Azathramycin affects multiple ion channels such as SCN5A, hERG, KCNQ1 + KCNE1, L-type Ca++ and Kir2.1[1][2][3].

  

• HY-B1924

  Norvancomycin hydrochloride	213997-73-0
  Norvancomycin hydrochloride is a cell wall synthesis inhibitor targeting peptidoglycan precursors of Gram-positive bacteria and cannot pass the blood-brain barrier. Norvancomycin hydrochloride can competitively bind to peptidoglycan precursors, irreversibly inhibit bacterial cell wall synthesis, and exert antibacterial activity. Norvancomycin hydrochloride is mainly used in the study of Gram-positive bacterial infections, especially infections caused by methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant Staphylococcus epidermidis (MRSE). Norvancomycin hydrochloride can also be incorporated into the bionic calcium phosphate coating of titanium implants to enhance antibacterial activity and inhibit postoperative orthopedic infections[1][2].

  

• HY-154965

  Simnotrelvir	2920904-06-7	99.62%
  SARS-CoV-2-IN-41 (compound 2) is a potent SARS-CoV-2 3CLpro inhibitor with an IC50 value of 0.022 µM. SARS-CoV-2-IN-41 shows antiviral effect[1].

  

• HY-106254A

  Vapendavir diphosphate	1198151-75-5	98.75%
  Vapendavir diphosphate (BTA798 diphosphate) is a potent enteroviral capsid binder (CB). Vapendavir diphosphate (BTA798 diphosphate) possesses potent antiviral activity for enterovirus 71 (EV71) replication, with EC50 values of 0.5-1.4 μM in different EV71 strains[1][2].

  

• HY-18299

  Purvalanol B	212844-54-7
  Purvalanol B (NG 95) is a potent, selective, reversible and ATP-competitive inhibitor CDK, with IC50s of 6 nM, 6 nM, 9 nM, 6 nM for cdc2-cyclin B, CDK2-cyclin A, CDK2-cyclin E and CDK5-p35, respectively. Purvalanol B shows selectivity for CDK over a range of other protein kinases (IC50>1000 nM). Purvalanol B inhibits the growth a chloroquine-resistant strain of P. falciparum[1][1].

  

• HY-145964

  INE963	2640567-43-5	98.43%
  INE963 is a potent and fast-acting blood-stage antimalarial agent, with an EC50s of 3-6 nM. INE963 is potential for single-dose cures in uncomplicated malaria[1].

  

• HY-17452A

  Cefditoren Pivoxil	117467-28-4	99.29%
  Cefditoren Pivoxil (ME 1207) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren Pivoxil has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren Pivoxil can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections[1][2].

  

• HY-P99008

  Atibuclimab	2417175-94-9	99.06%
  Atibuclimab (IC14), is a chimeric monoclonal antibody directed against CD14 and is composed of murine variable and human IgG4 Fc regions. Atibuclimab attenuates Lipopolysaccharides (HY-D1056) (LPS)-induced symptoms and strongly inhibits LPS-induced proinflammatory cytokine release, while only delaying the release of the anti-inflammatory cytokines soluble TNF receptor type I and IL-1 receptor antagonist. Atibuclimab can be used for the research of amyotrophic lateral sclerosis, sepsis, community-acquired pneumonia, or acute lung injury[1][2].

  

• HY-143216A

  Ensitrelvir fumarate	2757470-18-9	99.99%
  Ensitrelvir (S-217622) fumarate is the first orally active non-covalent, non-peptidic, SARS-CoV-2 3CL protease inhibitor (IC50=13 nM)[1][2].

  

• HY-B0847

  Propiconazole	60207-90-1	99.92%
  Propiconazole is an orally active N-substituted triazole used as a fungicide. Propiconazole is a mouse liver hepatotoxicant and a hepatocarcinogen that has adverse reproductive and developmental toxicities in experimental animals[1][2].

  

• HY-B1359

  Methylene blue trihydrate	7220-79-3
  Methylene blue trihydrate (C.I. Basic Blue 9 trihydrate) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue trihydrate is a vasopressor and is often used as a dye in several medical procedures. Methylene blue trihydrate has antinociception, antimalarial, antidepressant and anxiolytic activity effects. Methylene Blue trihydrate has the potential for methemoglobinemias, neurodegenerative disorders and ifosfamide-induced encephalopathytreatment[1][2][3].

  

• HY-B1415

  Clofibric acid	882-09-7	99.99%
  Clofibric acid (Chlorofibrinic acid) is an orally active PPARα agonist. Clofibric acid inhibits the fimbriation of Escherichia coli. Clofibric acid increases SOD activity. Clofibric acid lowers blood lipids and prevents experimental pyelonephritis. Clofibric acid has anticancer activity against ovarian cancer. Clofibric acid is also a herbicide. Clofibric acid is used in ovarian cancer, liver cancer, obesity, and urinary tract infection research[1][2][3][4][5][6][7][8][9].

  

• HY-B1693

  Levomepromazine	60-99-1	99.98%
  Levomepromazine (Methotrimeprazine) is an orally active antipsychotic compound and Ca2+ release inducer. Levomepromazine inhibits SERCA pump and induces an increase in cytoplasmic Ca2+ levels. Levomepromazine has antagonistic effects on a variety of neurotransmitter receptors, including dopamine, cholinergic, serotonin, and histamine receptors. Levomepromazine can induce adaptive ER stress and autophagy. In addition, Levomepromazine has antiviral, anti-inflammatory, neuroprotective and analgesic, sedative and anti-injurious activities. Levomepromazine can be used in the study psychiatric disorders and relieving nausea and vomiting[1][2][3][4].

  

• HY-N0655

  D-Pinitol	10284-63-6
  D-pinitol (3-O-Methyl-D-chiro-inositol) is a natural compound presented in several plants, like Pinaceae and Leguminosae plants. D-pinitol exerts hypoglycemic activity and protective effects in the cardiovascular system[1][2]. D-pinitol has antiviral and larvicidal activities[3].

  

• HY-N0840

  Bruceantin	41451-75-6
  Bruceantin ((-)-Bruceantin) is a quassinoid found in B. javanica. Bruceantin activates caspase signaling pathway, causes the mitochondrial dysfunction, inhibits cell proliferation, induces cell differentiation and apoptosis. Bruceantin exhibits anti-leukemia and antiprotozoal activities[1][2][3].

  

• HY-N1181

  Tamarixetin	603-61-2	99.31%
  Tamarixetin (4'-O-Methyl Quercetin) is an orally active natural flavonoid derivative of quercetin and caseinolytic protease p (ClpP) inhibitor with anti-inflammatory, antioxidant and antitumor effects. Tamarixetin inhibits the hydrolytic activity of ClpP to the fluorescent substrate Suc-LY-AMC with an IC50 of 49.73 μM, which can be used for the study of Staphylococcus aureus infection. Tamarixetin inhibits tumor cell growth, induces apoptosis, and cell cycle arrest. Tamarixetin prevents cardiac hypertrophy by inhibiting the NFAT and AKT pathways[1][2][3][4].

  

• HY-N4283

  Coniferyl alcohol	458-35-5	99.94%
  Coniferyl alcohol is an orally active lignin biosynthesis intermediate and antifungal agent. Coniferyl alcohol specifically inhibits the growth of fungi (Verticillium longisporum). Coniferyl alcohol inhibits the growth of Nicotiana benthamiana seedlings. Coniferyl alcohol improves cardiac dysfunction in renovascular hypertension and cardiac inflammation[1][2][3][4].

  

• HY-N6715

  Tenuazonic acid	610-88-8
  Tenuazonic acid is a nonhost-selective mycotoxin belonging to the tetramic acids family. Tenuazonic acid inhibits protein biosynthesis on ribosomes by suppressing the release of new protein. Tenuazonic acid is acutely toxic, and oral LD50 is set between 81-186 mg/kg in rats and mice. Tenuazonic acid blocks electron transport beyond the primary quinone receptor (QA) by interacting with the D1 protein and is a photosystem II (PSII) inhibitor. In addition, Tenuazonic acid has antiviral effects on measles virus, enterovirus, respiratory virus and so on. Tenuazonic acid has an inhibitory effect on skin cancer[1][2][3][4][5][6][7].

  

• HY-N7015

  Zerumbone	471-05-6	99.87%
  Zerumbone is an orally active natural cyclic sesquiterpene and can be isolated from Zingiber zerumbet. Zerumbone has anti-proliferative, anti-inflammation, anti-cancer, anti-bacterial and anti-mutagenic activity[1][2][3][4].

  

• HY-N8440

  Gibberellin A4	468-44-0	98.02%
  Gibberellin A4 is a natural compound that can be isolated from Sphaceloma manihoticola. Gibberellin A4 is a causal agent of cassava superelongation disease[1].

  

• HY-P0270

  Magainin 2	108433-95-0	98.92%
  Magainin 2 (Magainin II) is an antimicrobial peptide (AMP) isolated from the skin of the African clawed frog Xenopus laevis. Magainin 2 displays antibiotic activity against numerous gram-negative and gram-positive bacteria. Magainin 2 also is active against protozoa[1]. Magainin 2 exerts its cytotoxicity effects by preferential interactions with anionic phospholipids abundant in bacterial membranes[2].

  

• HY-Y0148

  10-Hydroxydecanoic acid	1679-53-4
  10-Hydroxydecanoic acid (10-HDAA) is a saturated fatty acid derived from 10-hydroxy-trans-2-decenoic acid, which can be isolated from royal jelly. 10-Hydroxydecanoic acid exhibits various biological activities, including anti-inflammatory, insecticidal, anti-malarial, and anti-Leishmania properties, as well as enhancing antigen-specific immune responses. The anti-inflammatory effects of 10-Hydroxydecanoic acid are primarily mediated by inhibiting the activation of NF-κB and the translation of interferon regulatory factor 1 (IRF-1), which reduces the production of interleukin 6 (IL-6) and nitric oxide (NO) in inflammatory cells. Additionally, 10-Hydroxydecanoic acid alleviates neuroinflammatory responses through the p53-autophagy pathway and the p53-NLRP3 pathway. Finally, 10-Hydroxydecanoic acid enhances antigen-specific immune responses by promoting the effective uptake of antigens by microfold cells[1][2][3][4][5].

  

• HY-108511

  PB28 dihydrochloride	172907-03-8
  PB28 dihydrochloride, a cyclohexylpiperazine derivative, is a high affinity and selective sigma 2 (σ2) receptor agonist with a Ki of 0.68 nM. PB28 dihydrochloride is also a σ1 antagonist with a Ki of 0.38 nM. PB28 dihydrochloride is less affinity for other receptors. PB28 dihydrochloride inhibits electrically evoked twitch in guinea pig bladder and ileum with EC50 values of 2.62 μM and 3.96 μM, respectively. PB28 dihydrochloride can modulate SARS-CoV-2-human protein-protein interaction. PB28 dihydrochloride induces caspase-independent apoptosis and has antitumor activity[1][2][3][4][5].

  

• HY-116144

  Picaridin	119515-38-7
  Picaridin (Lcaridin) is a broad spectrum arthropod repellent. Picaridin interacts with mosquito and tick olfactory receptor proteins. Picaridin repels Aedes aegypti. Picaridin exhibits considerable antibacterial, anticandidal and antifungal properties[1][2][3][4].

  

• HY-116683

  116-9e	831217-43-7	98.55%
  116-9e (MAL2-11B) is a Hsp70 co-chaperone DNAJA1 inhibitor. 116-9e inhibits Simian Virus 40 (SV40) replication and DNA synthesis. 116-9e inhibits tumor antigen (TAg)’s endogenous ATPase activity and the TAg-mediated activation of Hsp70[1][2].

  

• HY-128204

  AN3661	1268335-33-6	99.89%
  AN3661, a potent antimalarial lead compound, targets a Plasmodium falciparum cleavage and polyadenylation specificity factor homologue subunit 3 (PfCPSF3). AN3661 inhibits Plasmodium falciparum laboratory-adapted strains (mean IC50=32 nM), Ugandan field isolates (mean ex vivo IC50=64 nM), and murine P. berghei and P. falciparum infections[1].

  

• HY-141519

  PI-55	1122579-42-3	98.89%
  PI-55 is a specific cytokinin receptor inhibitor. PI-55 is structurally related to 6-benzylaminopurine (BAP) and was shown to inhibit competitively BAP binding on Arabidopsis-specific receptors CRE1/AHK4 and AHK3. PI-55 inhibits cytokinins induced haustorium formation and increased parasite aggressiveness[1].

  

• HY-148394

  UCK2 Inhibitor-1	902289-98-9
  UCK2 Inhibitor-1 (Compound 20874830-2) is a non-competitive UCK2 inhibitor with an IC50 of 4.7 µM[1].

  

• HY-P10368

  P110 heptapeptide	1411976-18-5	99.84%
  P110 heptapeptide, a peptide inhibitor of Drp1-Fis1 interaction, reduces pathology in numerous models of neurodegeneration, ischemia, and sepsis without blocking the physiological functions of Drp1[1].

  

• HY-W017316

  Terpinen-4-ol	562-74-3
  Terpinen-4-ol (4-Carvomenthenol) is a naturally occurring monoterpene, and can be extracted from a variety of aromatic plants. Terpinen-4-ol is a potent bactericidal agent which possess antifungal , anti-inflammatory and antitumor properties as well, suggesting Terpinen-4-ol to be used for relevant research[1][2].

  

• HY-B1864B

  Kasugamycin hydrochloride hydrate	200132-83-8	99.93%
  Kasugamycin (Ksg) hydrochloride hydrate is an antibiotic that binds to 30s and 70s ribosomes but not to the 50s subunit, and has anti-infective activity. Kasugamycin hydrochloride hydrate mimics mRNA nucleotides, disrupts tRNA binding and inhibits canonical translation initiation. Kasugamycin hydrochloride hydrate increases the sensitivity of mycobacteria to Rifampicin (HY-B0272) in vitro and in mouse infection models[1][2][3].

  

• HY-13582

  Carbendazim	10605-21-7	99.85%
  Carbendazim is a potent and orally active broad-spectrum benzimidazole fungicide and can be acts as a pesticide for fungal diseases research, such as Seproria, Fusarium and Sclerotina[1][3]. Carbendazim is a benzimidazole (HY-Y1825) derivative with antitumor activity and used for cancer research, especially advanced solid tumors and lymphoma[3].

  

• HY-103017

  JH-X-119-01 hydrochloride	2591344-30-6
  JH-X-119-01 hydrochloride is a potent and selective interleukin-1 receptor-associated kinases 1 (IRAK1) inhibitor. JH-X-119-01 hydrochloride ameliorates LPS-induced sepsis in mice[1].

  

• HY-111139

  MS417	916489-36-6	99.79%
  MS417 is a selective BET-specific BRD4 inhibitor, binds to BRD4-BD1 and BRD4-BD2 with IC50s of 30, 46 nM and Kds of 36.1, 25.4 nM, respectively, with weak selectivity at CBP BRD (IC50, 32.7 μM).

  

• HY-19806A

  Ceftolozane sulfate	936111-69-2	99.69%
  Ceftolozane (CXA-101) sulfate is an antipseudomonal cephalosporin. Ceftolozane binds to P. aeruginosa essential PBPs (1b, 1c, 2 and 3) with high affinity. Ceftolozane inhibits cell wall synthesis by binding the PBPs. Ceftolozane sulfate inhibits P. aeruginosa and Enterobacteriaceae[1][2][3][4][5][6][7].

  

• HY-P99028

  Ibalizumab	680188-33-4	99.27%
  Ibalizumab (TMB-355) is a humanised IgG4 monoclonal antibody that prevents HIV cell entry by binding to CD4 receptor. Ibalizumab has the potential for HIV-1 infection research[1].

  

• HY-12828

  KH-CB19	1354037-26-5	99.31%
  KH-CB19 is a potent CLK (cdc2-like kinase) inhibitor (CLK1 IC50=19.7 nM; CLK3 IC50=530 nM). KH-CB19 shows antiviral activity and inhibits influenza virus replication (IC50=13.6?μM)[1][2].

  

• HY-B0454A

  Miconazole nitrate	22832-87-7	99.97%
  Miconazole nitrate (R18134 nitrate) is an imidazole antifungal agent. Miconazole nitrate also has antibacterial effects[2].

  

• HY-P99666

  Interferon alfa
  Albinterferon alfa-2b is a type I interferon that activates novel genes and exerts potent antiviral and antiproliferative activity on target cells. Signaling by Albinterferon alfa-2b requires receptor-dependent activation of Stat1 and Stat2 to form a heterodimeric STAT that binds to the DNA-binding protein IRF-9 (p48) and forms ISGF-3 (IFN-stimulated gene factor 3). The driver genes are then further activated by ISGF-3 to achieve antiviral function[1].

  

• HY-14430

  Cipargamin	1193314-23-6
  Cipargamin (NITD609) is an potent antimalarial compound, with an IC50 of appr 1 nM against P. falciparum.

  

• HY-17593

  Solithromycin	760981-83-7	99.85%
  Solithromycin (CEM-101) is an orally bioavailable, effective antimicrobial agent, with IC50s for inhibition of cell viability, protein synthesis, and growth rate are 7.5 ng/mL, 40 ng/mL, and 125 ng/mL for Streptococcus pneumonia, Staphylococcus aureus, and Haemophilus influenzae, respectively. Solithromycin binds to the large 50S subunit of the ribosome and inhibits protein biosynthesis[1].

  

• HY-18979

  Lactimidomycin	134869-15-1
  Lactimidomycin is a glutarimide-containing compound isolated from Streptomyces. Lactimidomycin is a potent inhibitor of eukaryotic translation elongation. Lactimidomycin has a potent antiproliferative effect on tumor cell lines and selectively inhibit protein translation. Lactimidomycin inhibits protein synthesis with an IC50 value of 37.82 nM. Lactimidomycin is also a potent and non-toxic inhibitor of dengue virus 2 and other RNA viruses. Anticancer and antiviral activities[1][2].

  

• HY-50001

  Nucleozin	341001-38-5	99.66%
  Nucleozin, a potent inhibitor of influenza A virus infection, induces the formation of nucleoprotein (NP) aggregates and antagonizes its nuclear accumulation, leading to cessation of viral replication. Nucleozin impedes influenza A virus replication in vitro with a nanomolar EC50[1].

  

• HY-B0119

  Risedronic acid sodium	115436-72-1
  Risedronic acid (Risedronate) sodium, a bisphosphonate, is a potent anti-resorption agent that inhibits osteoclast-mediated bone resorption and changes the bone metabolism. Risedronic acid sodium suppresses osteoblast differentiation and induced caspase- and isoprenoid depletion-dependent apoptosis. Risedronic acid sodium inhibits blood stages of Plasmodium falciparum (IC50 of 20.3 μM). Risedronic acid sodium inhibits the transfer of the farnesyl pyrophosphate group to parasite proteins[1][2][3].

  

• HY-B0136

  Cefdinir	91832-40-5	99.50%
  Cefdinir (FK-482) is a semi-synthetic, broad-spectrum antibiotic in the third generation of the cephalosporin class, which is proved to be effective for infections caused by several Gram-negative and Gram-positive bacteria. Cefdinir can be used for the research of common bacterial infections of the ear, sinus, throat, and skin[1][2].

  

• HY-B0263

  Thiabendazole	148-79-8
  Thiabendazole is an orally available benzimidazole fungicide with repellent and anticancer activities. Thiabendazole can result in developmental malformations. Thiabendazole can be used for modeling[1][2][3][4][5].

  

• HY-B0293

  Butoconazole nitrate	64872-77-1	99.62%
  Butoconazole nitrate (RS 35887), an imidazole antifungal agent, is active against Candida spp. and effective against vaginal infections due to Candida albicans. Butoconazole nitrate is presumed to function as other imidazole derivatives via inhibition of steroid synthesis[1][2].

  

• HY-B0323

  Sulfisoxazole	127-69-5	99.90%
  Sulfisoxazole (Sulfafurazole) is an orally active endothelin receptor antagonist with IC50 values of 0.60 μM and 22 μM against endothelin receptor A and endothelin receptor B, respectively. Sulfisoxazole is a sulfonamide antibacterial agent with an oxazole substituent. Sulfisoxazole inhibits breast cancer exosome release by targeting endothelin receptor A[1][2].

  

• HY-B0535

  Ethambutol	74-55-5
  Ethambutol is an antimycobacterial compound that prevents cell wall formation by inhibiting arabinosyltransferase activity. Ethambutol can be used to establish animal models of hyperuricemia and optic neuropathy.

  

• HY-B0608

  Chlorhexidine digluconate (20% in water)	18472-51-0
  Chlorhexidine digluconate (20% in water) is a orally active cationic antimicrobial agent that targets microbial cell membranes. Chlorhexidine digluconate (20% in water) binds to cell membrane phospholipids non-specifically, destroys membrane structure and induces leakage of cell contents. Chlorhexidine digluconate (20% in water) has broad-spectrum bactericidal activity against both Gram-positive and Gram-negative bacteria. Chlorhexidine digluconate (20% in water) can interfere with membrane permeability, cause protein precipitation and energy metabolism disorders, such as rapid inhibition of microbial growth and induction of cell death (necrosis or apoptosis)[1][2][3].

  

• HY-B0751

  Fumagillin	23110-15-8
  Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.

  

• HY-B0848

  Tricyclazole	41814-78-2	98.64%
  Tricyclazole is a pentaketide-derived melanin biosynthesis inhibitor and a unique fungicide for control of Pyricularia oryzae on rice[1][2].

  

• HY-B1345

  Piroctone olamine	68890-66-4	99.91%
  Piroctone olamine is a pyridine derivate. It is known to have a fungicidal effect.

  

• HY-B1460

  Sulconazole mononitrate	61318-91-0
  Sulconazole mononitrate ((±)-Sulconazole mononitrate), an imidazole derivative, is a broad-spectrum fungicide. Sulconazole mononitrate can be used for the research of dermatomycoses, pityriasis versicolor, and cutaneous candidiasis[1][2].

  

• HY-B1484

  Moxalactam sodium salt	64953-12-4
  Moxalactam (Latamoxef) sodium salt is a synthetic oxa-β-lactam antibiotic. Moxalactam sodium salt has a broad spectrum of activity against Gram-positive and Gram-negative aerobic and anaerobic bacteria. Moxalactam sodium salt inhibits production of β-lactamases[1].

  

• HY-N0941

  beta-Mangostin	20931-37-7
  beta-Mangostin (β-Mangostin) is a xanthone compound present in Cratoxylum arborescens, with antibacterial and antimalarial activities. beta-Mangostin exhibits antimycobacterial activity against Mycobacterium tuberculosis with an MIC of 6.25 μg/mL. beta-Mangostin possesses in vitro antimalarial activity against Plasmodium falciparum, with an IC50 of 3.00 μg/mL. beta-Mangostin has potent anticancer activity against various cancers (such as hepatocellular carcinoma, leukaemic)[1][2][3][4].

  

• HY-N1469

  Kaurenoic acid	6730-83-2
  Kaurenoic acid is a diterpene derived from Sphagneticola trilobata. Kaurenoic acid has antibacterial, anti-inflammatory, anticonvulsant, analgesic, and aortic vasodilating effects[1][2][3][4].

  

• HY-N3544

  Caryophyllene oxide	1139-30-6	99.71%
  Caryophyllene oxide ((-)-Caryophyllene oxide) is a bicyclic sesquiterpene with anticancer effects. Caryophyllene oxide induces apoptosis of PC-3 cells. Caryophyllene oxide shows analgesic and anti-inflammatory activities. Caryophyllene oxide has insecticidal, antioxidant, antimicrobial, antifungal, and antiparasitic properties[1][2][3].

  

• HY-101525

  MBP146-78	188343-77-3	99.87%
  MBP146-78 is a potent and selective inhibitor of cGMP dependent protein kinases.

  

• HY-121241

  Dehydroemetine	4914-30-1	99.90%
  Dehydroemetine is an orally active antiparasitic agent. Dehydroemetine can inhibit parasites such as Entamoeba histolytica, and it can also be used in the research of parasitic diseases like visceral leishmaniasis[1][2][3].

  

• HY-133685

  N-Hexanoyl-L-homoserine lactone	147852-83-3
  N-Hexanoyl-L-homoserine lactone is a short-chained N-acyl homoserine lactone (AHL). N-hexanoyl-L-homoserine lactone is also a mediator of bacterial quorum-sensing regulation. N-hexanoyl-L-homoserine lactone promotes lipid accumulation in algae. AHL is an intercellular communication signal molecule in the quorum sensing system of Gram-negative bacteria and a medium for mediating information exchange between eukaryotic plants and prokaryotic bacteria. AHL can affect bacteria activities, such as biofilm formation, pigment synthesis, and antibiotic synthesis[1][2][3][4].

  

• HY-147349

  ANT3310 sodium	2410688-61-6	99.54%
  ANT3310 sodium is a broad-spectrum covalent Serine β-Lactamase inhibitor, with IC50 values ranging from 1 nM to 175 nM (a panel of Serine β-Lactamase). ANT3310 sodium potentiates activity of β-lactam antibiotics against Carbapenem-Resistant Enterobacterales (CRE) and Acinetobacter baumannii (CRAB). ANT3310 sodium can be used in the research of bacterial infection[1][2].

  

• HY-153225

  PYR01	2560576-15-8	98.95%
  PYR01 is a non-nucleoside reverse transcriptase inhibitor and a killing activator targeting HIV infected cells. PYR01 has cytokilling and antiviral properties of HIV-1 infection with the IC50 values of 27.5nM and 39.7nM, respectively. PYR01 leads to selective cytotoxicity by promoting HIV-1 Gag-Pol dimerization and HIV-1 protease intracellular activation. PYR01 can be used in the study of HIV[1].

  

• HY-B0529A

  Azlocillin sodium salt	37091-65-9	99.15%
  Azlocillin sodium salt (Sodium azlocillin), a semisynthetic penicillin, is a broad spectrum β-lactam antibiotic. Azlocillin sodium salt shows antipseudomonal activity, and also potent against the malarial parasite Plasmodium falciparum[1][2][3].

  

• HY-N0334A

  (+)-Magnoflorine iodide	4277-43-4	99.69%
  (+)-Magnoflorine iodide (Magnoflorine iodide), an aporphine alkaloid found in Acoruscalamus, reduces the formation of C. albicans biofilm[1]. (+)-Magnoflorine iodide has anti-fungal, anti-antidiabetic and anti-oxidative activity[2].

  

• HY-N0457A

  L-Chicoric Acid	70831-56-0	99.98%
  L-Chicoric Acid ((-)-Chicoric acid) is a dicaffeoyltartaric acid and a potent, selective and reversible HIV-1 integrase inhibitor with an IC50 of ~100 nM. L-Chicoric Acid inhibits HIV-1 replication in tissue culture[1][2][3].

  

• HY-N0674B

  Dehydrocorydaline (hydroxyl)		99.52%
  Dehydrocorydaline (13-Methylpalmatine) hydroxyl is an alkaloid that regulates protein expression of Bax, Bcl-2; activates caspase-7, caspase-8, and inactivates PARP. Dehydrocorydaline hydroxyl elevates p38 MAPK activation. Anti-inflammatory and anti-cancer activities. Dehydrocorydaline hydroxyl shows strong anti-malarial effects (IC50=38 nM), and low cytotoxicity (cell viability > 90%) using P. falciparum 3D7 strain.

  

• HY-135867E

  NHC-triphosphate tetraammonium
  NHC-triphosphate tetraammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form[1]. NHC-triphosphate tetraammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA[1][2].

  

• HY-W042191

  Oxychlororaphine	550-89-0
  Oxychloroaphine could be isolated from the bacterium Pantoea agglomerans naturally present in soil. Oxychloroaphine has broad-spectrum antifungal activity. Oxychloroaphine has cytotoxicity in a dose-dependent manner and induces apoptosis. Oxychloroaphine can be used in research of cancer[1][2].

  

• HY-B0837

  Emamectin Benzoate	155569-91-8
  Emamectin Benzoate (MK-244) is an orally active nervoussystem toxicant by binding g-aminobutyric (GABA) receptor in insects. Emamectin Benzoate is one of semi-synthetic derivative of Avermectin (HY-15311) with a broadspectrum of insecticidal and acaricidal activity. Emamectin Benzoate induces ROS-mediated DNA damage and cell apoptosis. Emamectin Benzoate, a mixture of the natural Emamectin B1a benzoate and Emamectin B1b benzoate, has the main component of Emamectin B1a benzoate[1][2].

  

• HY-13579

  BTZ043	1161233-85-7	99.51%
  BTZ043 is an inhibitor of decaprenyl-phosphoribose-epimerase (DprE1), with MICs of of 2.3 nM and 9.2 nM for M. tuberculosis H37Rv and Mycobacterium smegmatis, respectively.

  

• HY-B1358

  Lincomycin hydrochloride monohydrate	7179-49-9
  Lincomycin hydrochloride monohydrate is a narrow-spectrum antibiotic, has similar effects to erythromycin, which has a good effect on gram-positive coccus, mainly used to inhibit the synthesis of bacterial cell protein[1][2].

  

• HY-76260

  Faropenem sodium	122547-49-3	98.87%
  Faropenem sodium is an orally bioavailable penem antibiotic. Faropenem sodium regulates inorganic phosphate transporter Npt1. Faropenem sodium inhibits M. tuberculosis (MIC of 1.3 μg/mL) and B. anthracis[1][2].

  

• HY-19915

  Contezolid	1112968-42-9	99.37%
  Contezolid (MRX-I), a new and orally active oxazolidinone, is an antibiotic in study for complicated skin and soft tissue infections (cSSTI) caused by resistant Gram-positive bacteria. Contezolid (MRX-I) markedly reduces potential for myelosuppression and monoamine oxidase inhibition (MAOI)[1][2].

  

• HY-B2174

  Ethacridine lactate	1837-57-6	99.83%
  Ethacridine lactate (Acrinol) is a widely used antiseptic and abortifacient. Ethacridine lactate is effective against Staphylococcus aureus and other gram-positive cocci. Ethacridine lactate is also a poly(ADP-ribose) glycohydrolase (PARG) inhibitor[1][2][3].

  

• HY-P9929

  Bezlotoxumab	1246264-45-8
  Bezlotoxumab is a human monoclonal antibody directed against C. difficile toxin B. Bezlotoxumab binds to C. difficile toxin B preventing intestinal epithelial damage and colitis[1].

  

• HY-104029

  Olorofim	1928707-56-5	99.57%
  Olorofim (F901318) selectively inhibits fungal dihydroorotate dehydrogenase (DHODH), a key enzyme in the pyrimidine biosynthesis pathway. Olorofim (F901318). Olorofim exhibits excellent activity against A. fumigatus and other Aspergillus spp.[1].

  

• HY-139056

  SU0268	2210228-45-6	99.96%
  SU0268 is a potent and specific inhibitor of 8-Oxoguanine DNA glycosylase 1 (OGG1). SU0268 regulates inflammatory responses during Pseudomonas aeruginosa infection[1][2][3].

  

• HY-B0395C

  Sitafloxacin hydrate	163253-35-8	99.89%
  Sitafloxacin (DU6859a) hydrate is an orally active fluoroquinolone antibiotic (antibiotic) with in vitro activity against a wide range of Gram-positive and -negative bacteria, including anaerobic bacteria, as well as atypical pathogens. Sitafloxacin is used in the study of respiratory tract infections and urinary tract infections[1][2][3][4].

  

• HY-13678S

  Meropenem-d6	1217976-95-8
  Meropenem-d6 is the deuterium labeled Meropenem. Meropenem (SM 7338) is a carbapenem antibiotic with broad-spectrum antibacterial activity. Meropenem has activity against susceptible and resistant N. gonorrhoeae (MIC value of 0.02-0.06 mg/mL), H. influenzae (MIC value of 0.03-0.12 mg/mL), and H. ducreyi (MIC value of 0.015-0.12 mg/mL)[1][2].

  

• HY-13718

  Oglufanide	38101-59-6	98.97%
  Oglufanide (H-Glu-Trp-OH) is a dipeptide immunomodulator isolated from calf thymus. Oglufanide inhibits vascular endothelial growth factor (VEGF). Oglufanide can stimulate the immune response to hepatitic C virus (HCV) and intracellular bacterial infections. Oglufanide shows antitumor and anti-angiogenesis activities[1][2][3].

  

• HY-16696

  SN 2	823218-99-1	99.16%
  SN 2 is a potent activator of TRPML3 ion channel with an EC50 of 1.8 μM[1]. SN 2 also acts as a potent inhibitor of Dengue virus 2 (DENV2) and Zika virus (ZIKV)[2].

  

• HY-17396

  Butenafine Hydrochloride	101827-46-7	99.95%
  Butenafine Hydrochloride (KP363 Hydrochloride) is a synthetic benzylamine antifungal, works by inhibiting the synthesis of sterols by inhibiting squalene epoxidase.

  

• HY-17643

  Oteseconazole	1340593-59-0	99.46%
  Oteseconazole (VT-1161) is a potent and orally active anti-fungal agent. Oteseconazole potently binds to and inhibits Candida albicans cytochrome P45051 (CYP51) activity (Kd ≤39 nM), shows no obvious effect on human CYP51. Oteseconazole also can be used for the research of dermatophytes[1][2].

  

• HY-18337

  IOWH-032	1191252-49-9	99.63%
  IOWH-032 is a a synthetic anti-secretory molecule, is a potent CFTR inhibitor with an IC50 value of 8 μM. IOWH-032 also is a anti-diarrheal agent[1][2].

  

• HY-19910

  Acoziborole	1266084-51-8	99.94%
  Acoziborole (SCYX-7158) is an effective, safe and orally active antiprotozoal agent for the research of human african trypanosomiasis (HAT). In the T. b. brucei S427 strain, the MIC value for SCYX-7158 is 0.6 μg/mL[1].

  

• HY-B0177

  Tinidazole	19387-91-8
  Tinidazole, an orally available antibacterial agent, is a 5-nitroimidazole with selective activity against anaerobic bacteria and protozoa[1].

  

• HY-B0991

  Amoxapine	14028-44-5
  Amoxapine (CL-67772) is a norepinephrine reuptake blocker and a 5-HT2/5-HT3 antagonist. Amoxapine can be used for the research of depression. Amoxapine has antibacterial activity. Amoxapine can enhance the killing effect of macrophages on mycobacterium by inducing autophagy, while protecting the cells from death[1][2][3].

  

• HY-B1175

  (2S,5R,6R)-Ticarcillin disodium	4697-14-7
  (2S,5R,6R)-Ticarcillin disodium is a semisynthetic antibiotic with bactericidal activities. (2S,5R,6R)-Ticarcillin disodium is the (2S,5R,6R)-enantiomer of Ticarcillin (HY-139805)[1].

  

• HY-B1228

  Ribostamycin sulfate	53797-35-6	99.84%
  Ribostamycin sulfate (Vistamycin sulfate) is a broad-spectrum antimicrobial, inhibits bacterial protein synthesis at the level of 30S and 50S ribosomal subunit binding, also inhibits the chaperone activity of protein disulfide isomerase (PDI), used in pharmacokinetic and nephrotoxicity studies

  

• HY-B1794

  Thiethylperazine	1420-55-9	99.91%
  Thiethylperazine, a phenothiazine derivate, is an orally active and potent dopamine D2-receptor and histamine H1-receptor antagonist. Thiethylperazine is also a selective ABCC1activator that reduces amyloid-β (Aβ) load in mice. Thiethylperazine has anti-emetic, antipsychotic and antimicrobial effects[1][2][3].

  

• HY-B1805

  Triclocarban	101-20-2	99.00%
  Triclocarban (3,4,4′-Trichlorocarbanilide), a broad spectrum antibacterial compound, is widely used in a broad range of applications such as the production of soaps, skin creams, toothpastes and deodorants. Triclocarban is a potential endocrine-disrupting chemical with the capacity to modulate androgen and estrogen activities as well as other hormone-mediated biological processes[1][2][3].

  

• HY-B1839

  Fluazinam	79622-59-6	99.36%
  Fluazinam is an orally active dinitroaniline fungicide. Fluazinam induces phosphorylation of JNK, activates p38 pathway, decreases Bcl-2, activates caspase-3, decreases complex I activity, increases Autophagy and Apoptosis. Fluazinam has strong antifungal activity against F. fujikuroi and B. maydis. Fluazinam has a negative impact on Brachydanio rerio and worker bees[1][2][3][4][5][6][7].

  

• HY-D0841

  Guanidine thiocyanate	593-84-0
  Guanidine thiocyanate is a strong protein denaturant and potent inhibitor of nucleases. Guanidinium thiocyanate is a nucleic acid protector in the extraction of DNA and RNA from cells. Guanidine thiocyanate is a common component of buffers used for nucleic acid extraction[1].

  

• HY-N0222

  Avicularin	572-30-5
  Avicularin is an orally active flavonoid. Avicularin inhibits NF-κB (p65), COX-2 and PPAR-γ activities. Avicularin has anti-inflammatory, anti-infectious anti-allergic, anti-oxidant, hepatoprotective, and anti-tumor activities[1][3].

  

• HY-N0349

  Methyl paraben	99-76-3	99.86%
  Methyl Paraben is a standardized methyl paraben allergen isolated from Yunnan hemlock (Tsuga dumosa). Methyl Paraben is commonly used as a stable, non-volatile preservative. Methyl Paraben increases histamine release and cellular regulation of immunity, blocks sodium channels, and prevents ischemia-reperfusion injury[1][2][3][4].

  

• HY-N1029

  Norathyriol	3542-72-1	99.83%
  Norathyriol (Mangiferitin) is a natural metabolite of Mangifera. Norathyriol inhibits α-glucosidase in a noncompetitive manner with an IC50 of 3.12 μM[1]. Norathyriol inhibits PPARα, PPARβ, and PPARγ with IC50s of 92.8 µM, 102.4 µM, and 153.5 µM, respectively[2]. Antioxidant, anticancer, antimicrobial, anti-inflammatory, anti-bacterial activities.

  

• HY-N1422

  Hecogenin	467-55-0	99.96%
  Hecogenin is a steroid saponin isolated from Agave sisalana and is a selective inhibitor of human UDP-glucuronosyltransferases. Hecogenin has a wide spectrum of pharmacological activities, including anti-inflammatory, antifungal and gastroprotective effects[1].

  

• HY-N2493

  Lawsone	83-72-7
  Lawsone is an orally active naphthoquinone dye that can be isolated from the leaves of Lawsonia inermis. Lawsone can induce apoptosis. Lawsone has antibacterial, antitumor and antioxidant activities. Lawsone can be used in anti-tumor drug research[1][2][3][4][5].

  

• HY-N6779

  Patulin	149-29-1
  Patulin (Terinin) is a mycotoxin produced by fungi including the Aspergillus, Penicillium, and Byssochlamys species, causes chromosome breakage, mutation, teratogenic and cytotoxic. Patulin induces autophagy-dependent apoptosis through lysosomal-mitochondrial axis, and causes DNA damage[1][2][3][4].

  

• HY-P1102

  TC14012	368874-34-4	98.92%
  TC14012, a serum-stable derivative of T140, is a selective and peptidomimetic CXCR4 antagonist with an IC50 of 19.3 nM. TC14012 is a potent CXCR7 agonist with an EC50 of 350 nM for recruiting β-arrestin 2 to CXCR7. TC14012 has anti-HIV activity and anti-cancer activity[1][2].

  

• HY-P5712

  Gramicidin S	113-73-5	99.19%
  Gramicidin S (Gramicidin soviet) is a cationic cyclic peptide antibiotic that selectively targets bacterial cell membranes and has anticancer activity. Gramicidin S also exerts antibacterial activity by destroying membrane integrity and interfering with membrane protein function. Gramicidin S inserts into the phospholipid bilayer through hydrophobic amino acid residues, specifically binds to negatively charged membrane lipids and disrupts membrane structure, thereby inhibiting cell division and cell wall synthesis, and ultimately causing bacterial death. Gramicidin S also inhibits ion channels, with IC50s of 41 μM, 24 μM, and 3 μM for Na+/K+-ATPase, tobacco leaf plasma membrane Mg2+/K+-ATPase, and rat heart plasma membrane Ca2+-ATPase, respectively[1][2][3].

  

• HY-Y0073

  4-Hydroxyacetophenone	99-93-4	99.99%
  4-Hydroxyacetophenone (P-hydroxyacetophenone) is a major hepatoprotective and choleretic compound found in Artemisia and Illicium plants, exhibiting antiviral and anti-inflammatory effects against hepatitis B virus. Additionally, 4-Hydroxyacetophenone inhibits cancer cell adhesion, invasion, and migration by remodeling actin. 4-Hydroxyacetophenone holds promise for research in the fields of inflammatory diseases and cancer[1][2].

  

• HY-106228

  HLF1-11	183623-03-2	99.91%
  HLF1-11, a human lactoferrin-derived peptide, is a broad spectrum antimicrobial agent. HLF1-11 inhibits human MPO activity. HLF1-11 also directs GM-CSF-driven monocyte differentiation toward macrophages, and enhances immune responses[1][2].

  

• HY-119683

  Epoxiconazole	133855-98-8	98.75%
  Epoxiconazole, a fungicide, is a demethylation inhibitor of the Ergosterol biosynthesis pathway. Epoxiconazole exhibits strong inhibitory effects on both carbendazim-resistant and phenamacril-resistant isolates, and can be used for controlling many crop diseases[1].

  

• HY-128932

  Cefminox sodium	75498-96-3	99.83%
  Cefminox sodium (MT-141) is a semisynthetic cephamycin, which exhibits a broad spectrum of antibacterial activity[1]. Cefminox sodium (MT-141) also acts as a dual agonist of prostacyclin receptor (IP) and PPARγ, upregulates cAMP production and PTEN expression and inhibits Akt/mTOR signaling. Cefminox sodium (MT-141) also prevents pulmonary arterial hypertension[2].

  

• HY-136150

  Methyl carnosate	82684-06-8	98.47%
  Methyl camosate is a diterpene isolated from Salvia officinalis or Rosmarinus officinalis. Methyl camosate has potent antioxidant and anti-bacterial activity[1][2].

  

• HY-136767

  Cladosporin	35818-31-6
  Cladosporin is an antibiotic and an an antifungal metabolite that can be produced in good yield in the mycelium of Cladosporium cladosporioid. Cladosporin exhibits inhibitory activity against various dermatophytes, plant pathogens, and bacteria. Cladosporin also exhibits antimalarial activity through inhibition of cytoplasmic lysine-tRNA synthetase of Plasmodium (PfKrs1)[1][2].

  

• HY-138543

  NITD-688	2407227-31-8	99.00%
  NITD-688 is an orally active pan-serotype inhibitor of the dengue virus NS4B protein. NITD-688 can be used in the research of dengue virus (DENV)[1].

  

• HY-128554A

  N-Desethyl amodiaquine dihydrochloride	79049-30-2	99.45%
  N-Desethyl amodiaquine dihydrochloride is the biologically active metabolite of Amodiaquine (HY-B1322A). N-Desethyl amodiaquine dihydrochloride is an antiparasitic agent, has inhibitory for strains V1/S and 3D7 with IC50 values of 97 nM and 25 nM, respectively. N-Desethyl amodiaquine dihydrochloride can be used for the research of malaria[1][2].

  

• HY-W009156

  Citric acid tripotassium hydrate	6100-05-6
  Citric acid tripotassium hydrate (Potassium citrate monohydrate) is a natural preservative and food tartness enhancer. Citric acid tripotassium hydrate induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid tripotassium hydrate cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid tripotassium hydrate is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-W018555

  D-Cysteine	921-01-7
  D-Cysteine, the D-isomer of cysteine, is an orally active antibacterial agent and a regulator of neural progenitor cell proliferation. D-Cysteine can inhibit Escherichia coli, Streptococcus mutans, and Streptococcus sanguinis. The no-observed-adverse-effect level of D-Cysteine in rats should be less than 500 mg/kg/day[1][2][3][4].

  

• HY-13588

  Cefsulodin sodium	52152-93-9
  Cefsulodin (SCE-129) sodium is a third generation β lactam antibiotic and member of the cephems subgroup of antibiotics. Cefsulodin sodium inhibits cell wall synthesis by competitively inhibiting penicillin binding protein (PBP) cross-linking and transpeptidation of peptidogly. Cefsulodin sodium is a potent tyrosine phosphatase inhibitor against mPTPB, a virulent phosphatase from Mycobacterium tuberculosis, with an IC50 value of 16 μM[1][2][3][4].

  

• HY-14814

  Delafloxacin	189279-58-1	99.84%
  Delafloxacin (RX-3341; WQ-3034; ABT492) is a broad-spectrum fluoroquinolone antibiotic. Delafloxacin has a broad spectrum of activity that includes drug-resistant Staphylococcus aureus, Streptococcus pneumoniae, and Klebsiella pneumonia[1].

  

• HY-16565

  10-Deacetylbaccatin III	32981-86-5
  10-Deacetylbaccatin-III is an intermediate in the preparation process of paclitaxel. 10-Deacetylbaccatin III can be isolated from the dried needles and small branches of the European yew tree (Taxus baccata). 10-Deacetylbaccatin III exhibits antileishmanial activity[1][2][3][4][5][6].

  

• HY-15602A

  Ledipasvir (acetone)	1441674-54-9	99.94%
  Ledipasvir acetone (GS-5885 acetone) is the active ingredient of Ledipasvir. Ledipasvir is an inhibitor of the hepatitis C virus NS5A, with EC50 values of 34 pM against GT1a and 4 pM against GT1b replicon.

  

• HY-17506A

  Azithromycin hydrate	117772-70-0
  Azithromycin hydrate is a macrolide antibiotic useful for the treatment of a number of bacterial infections.

  

• HY-12983A

  Lumicitabine	1445385-02-3	99.93%
  Lumicitabine (ALS-008176) is an inhibitor of the respiratory syncytial virus (RSV) polymerase.

  

• HY-19750

  TBA-7371	1494675-86-3	99.91%
  TBA-7371 is an orally active and non-covalent inhibitor of Decaprenylphosphoryl-β-D-ribose oxidase (DprE1) of Mycobacterium tuberculosis (MIC=0.64 μg/mL). TBA-7371 can block the synthesis of arabinose in the bacterial cell wall, resulting in cell wall structural defects, thereby exerting an anti-tuberculosis effect. TBA-7371 can be used in the research of anti-tuberculosis drugs and has a synergistic bactericidal effect with Bedaquiline (HY-14881) and other drugs[1][2][3].

  

• HY-B0105B

  (-)-Ketoconazole	142128-57-2	99.39%
  (-)-Ketoconazole ((-)-R 41400) is one of the enantiomers of ketoconazole (HY-B0105). Ketoconazole is a racemic mixture of two enantiomers, levoketoconazole ((2S,4R)-(−)-ketoconazole) and dextroketoconazole ((2R,4S)-(+)-ketoconazole). Ketoconazole is an antifungal agent and a cytochrome P450 inhibitor.

  

• HY-B0465

  Oxacillin sodium monohydrate	7240-38-2	99.55%
  Oxacillin sodium monohydrate is an antibiotic similar to Flucloxacillin used in resistant staphylococci infections study[1].

  

• HY-102074

  ERDRP-0519	1374006-96-8	99.90%
  ERDRP-0519, an orally bioavailable small-molecule Measles virus (MeV) polymerase inhibitor, prevents measles disease in squirrel monkeys (Saimiri sciureus). ERDRP-0519 inhibits morbilliviruses with nanomolar potency.[1][2][3].

  

• HY-12643

  Eprinomectin	123997-26-2	98.02%
  Eprinomectin (MK-397) is a type of avermectin. Eprinomectin, as a broad-spectrum fungicide, has insecticidal, insecticidal and acaricidal activities. Eprinomectin induces apoptosis and autophagy in prostate cancer cells and has antitumor activity[1][2][3].

  

• HY-16468

  Squalamine	148717-90-2
  Squalamine (MSI-1256) is an aminosterol compound with broad-spectrum antiviral activity. Squalamine makes cells less conducive to certain viral replication by altering the electrostatic interactions in the inner membrane of host cells. Squalamine also has antibacterial and antitumor activities. Squalamine has broad-spectrum antibacterial activity against Gram-negative and Gram-positive bacteria, fungi and protozoa. Squalamine inhibits tumor-related angiogenesis and the growth of human breast cancer cells. Squalamine restores the function of enteric nervous system in Parkinson,s disease mouse models[1][2][3][4][5].

  

• HY-23155

  2-Phenylethyl isothiocyanate	2257-09-2	98.04%
  2-Phenylethyl isothiocyanate is a potent antifungal agent. 2-Phenylethyl isothiocyanate significantly inhibited spore germination and mycelial growth of Alternaria alternata, with a MIC (minimum inhibitory concentration) of 1.22 mM. The antifungal effect of 2-Phenylethyl isothiocyanate against Alternaria alternata might be via reduction in toxin content and breakdown of cell membrane integrity[1][2].

  

• HY-B0198

  Cefaclor	53994-73-3	99.61%
  Cefaclor is a well-absorbed orally active cephalosporin antibiotic. Cefaclor can specifically bind to specific for penicillin-binding protein 3 (PBP3). Cefaclor can be used for the research of depression and kinds of infections caused by bacteria, such as respiratory tract infections, bacterial bronchitis, pharyngitis and skin infections[1][2][3][4].

  

• HY-B0319

  Tioconazole	65899-73-2	99.90%
  Tioconazole (UK-20349) is a broad-spectrum antifungal imidazole derivative. Tioconazole inhibits several dermatophytes and yeasts, with MIC50 values of less than 3.12 mg/L and 9 mg/L, respectively. Additionally, Tioconazole exhibits anti-parasitic activity. Tioconazole exerts anticancer activity by inhibiting the PI3K/AKT/mTOR signaling pathway and blocking autophagy. Tioconazole is applicable for research in the fields of anti-infection and anticancer therapy[1][2][3][4][5].

  

• HY-B0986

  Hexylresorcinol	136-77-6	99.52%
  Hexylresorcinol (4-Hexylresorcinol) is a natural compound found in plants with antimicrobial, anthelmintic, antiseptic and antitumor activities. Hexylresorcinol can induce apoptosis in squamous carcinoma cells. Hexylresorcinol is a reversible and noncompetitive inhibitor of α-glucosidase. Hexylresorcinol has protective effects against oxidative DNA damage[1][2][3][4][5].

  

• HY-B1064

  Clindamycin phosphate	24729-96-2
  Clindamycin phosphate (Clindamycin 2-phosphate) is a broad-spectrum bacteriostatic lincosamide antibiotic. Clindamycin phosphate is the proagent of Clindamycin (HY-B1455) with no antimicrobial activity in vitro but can be rapidly converted in vivo to the active parent agent, Clindamycin, by phosphatase ester hydrolysis. Clindamycin phosphate can be used for researching acne and bacterial vaginosis[1][2][3].Clindamycin phosphate has no cytotoxicity. Combined with platelet rich fibrin (PRF), PRF-Clindamycin phosphate enhances antimicrobial properties[4].

  

• HY-B1212

  Broxyquinoline	521-74-4	99.89%
  Broxyquinoline (Dibromohydroxyquinoline) is an effective inhibitor of severe fever with thrombocytopenia syndrome virus (SFTSV) with an IC50 of 5.8 µM. Additionally, Broxyquinoline is an inhibitor of CpACBP1 with an IC50 of 64.9 μM. CpACBP1 is a fatty acyl-CoA binding protein of Cryptosporidium parvum, thus Broxyquinoline has the potential to inhibit parasite growth. Broxyquinoline shows promise for research in the field of infectious diseases[1][2].

  

• HY-B1289

  Cetylpyridinium chloride monohydrate	6004-24-6
  Cetylpyridinium chloride monohydrate is a cationic quaternary ammonium compound used in some types of mouthwashes, toothpastes, and throat and nasal sprays as an antiseptic that kills bacteria and other microorganisms. Effectively prevents plaque and reduces gingivitis.

  

• HY-N0841

  Bruceine A	25514-31-2
  Bruceine A (Dihydrobrusatol) is a natural quassinoid. Bruceine A is an inhibitor of parasites, NF-κB, and PFKFB4 (Kd: 44 nM). Bruceine A is an activator of P38α MAPK. Bruceine A has antiparasitic activity. Bruceine A has antitumor activity and inhibits cancer cell migration. Bruceine A blocks the cell cycle and induces apoptosis. Bruceine A can be used in parasites, pancreatic cancer, and breast cancer research[1][2][3][4][5].

  

• HY-N1499

  Nystose	13133-07-8
  Nystose is a tetrasaccharide with two fructose molecules linked via beta (1→2) bonds to the fructosyl moiety of sucrose. Nystose exhibits prebiotic, immunomodulatory, and metabolism regulating activities. Nystose promotes the bone mineralization by activating the Wnt/β-catenin signaling pathway[2].

  

• HY-N1984

  Artemisic acid	80286-58-4	99.74%
  Artemisinic acid (Qing Hao acid), an amorphane sesquiterpene isolated from Artemisia annua L., possesses a variety of pharmacological activity, such as antimalarial activity, anti-tumor activity, antipyretic effect, antibacterial activity, allelopathy effect and anti-adipogenesis effect[1].

  

• HY-N2116

  Ginkgolic acid C17:1	111047-30-4	99.90%
  Ginkgolic acid C17:1 is a fatty acid synthase (FAS) inhibitor with an IC50 of 10.5 µM. Ginkgolic acid C17:1 shows anti-tumor activity by inhibiting the phosphorylation of STAT3 and inducing apoptosis. Ginkgolic acid C17:1 can block the interaction between S-RBD and ACE2, and has anti-SARS-CoV-2-S pseudovirus activity. Ginkgolic acid C17:1 inhibits the biofilm formation of enterohemorrhagic Escherichia coli and Staphylococcus aureus[1][2][3][4][5].

  

• HY-N2532

  Diphyllin	22055-22-7	99.90%
  Diphyllin is an orally active V-ATPase inhibitor (IC50=17 nM) and HIV-1 inhibitor (IC50=0.38 μM). Diphyllin blocks the acidification of osteoclast lysosomes and bone resorption lacunas (IC50=0.6 nM for acid influx inhibition)， thereby inhibiting bone resorption. Diphyllin can effectively inhibit osteoclast-mediated bone resorption and has no effect on osteoblastic bone formation. Diphyllin can be used in the research of bone metabolism-related diseases and has the potential to inhibit diseases related to excessive bone resorption[1][2][3][4].

  

• HY-N7116

  Lawsone methyl ether	2348-82-5	99.16%
  Lawsone methyl ether (2-Methoxy-1,4-naphthoquinone), isolated from Impatiens balsamina L. and Swertia calycina, exhibits potent antifungal and antibacterial activities[1].

  

• HY-N8332

  Bile extract	8008-63-7
  Bile extract (Ox bile extract) is a complex mixture of substances, containing bile acids, cholesterol, and bilirubin. Bile extract has antimicrobial activity and can induce DNA damage and degrade viral and bacterial membranes. Bile extract can be used in bacterial culture media as a selective inhibitor for the isolation and identification of pathogens[1][2].

  

• HY-N9965

  2'-Fucosyllactose	41263-94-9	99.95%
  2'-Fucosyllactose (2'-FL) is an oligosaccharide that could be derived from human milk. 2'-Fucosyllactose regulates the expression of CD14, alleviates colitis and regulates the gut microbiome. 2'-Fucosyllactose stimulates T cells to increase IFN-γ production and decreases IL-6, IL-17, and TNF-α production of cytokines[1][2].

  

• HY-P0092

  Cecropin B	80451-05-4	99.00%
  Cecropin B has high level of antimicrobial activity and is considered as a valuable peptide antibiotic.

  

• HY-P1066

  Apelin-17(human, bovine)	217082-57-0	98.29%
  Apelin-17(human, bovine) is an endogenous orphan G protein-coupled receptor APJ agonist. Apelin-17(human, bovine) binds to human APJ receptors expressed in HEK 293 cells (pIC50=9.02). Apelin-17(human, bovine) inhibits the entry of some HIV-1 and HIV-2 into the NP2/CD4 cells expressing APJ[1][2][3].

  

• HY-P1940

  Maculosin	4549-02-4	99.59%
  Maculosin (Cyclo (Tyr-Pro)) is a host-specific phytotoxin for spotted knapweed from Alternaria alternata. Maculosin is a quorum-sensing molecule involved in cell-cell communication. Maculosin also acts as a signaling molecule regulating virulence gene expression. Maculosin shows antimicrobial, antifungal, antioxidant and anti-cancer properties[1][2][3][4][5][6][7][8][9].Maculosin (Cyclo (Tyr-Pro)) is a host-specific phytotoxin for spotted knapweed from Alternaria alternata. Maculosin is a quorum-sensing molecule involved in cell-cell communication. Maculosin also acts as a signaling molecule regulating virulence gene expression. Maculosin shows antimicrobial, antifungal, antioxidant and anti-cancer properties[1][2][3][4][5][6][7][8][9].

  

• HY-101984

  N6,N6-Dimethyladenosine	2620-62-4	99.95%
  N6,N6-Dimethyladenosine, a modified ribonucleoside, is an endogenous A3 adenosine receptor ligand. N6,N6-Dimethyladenosine is an AKT inhibitor with antitumor effects. N6, N6-Dimethyladenosine targets SARS-CoV-2 entry protein ADAM17. N6, N6-Dimethyladenosine robustly inhibits AKT signaling in a variety of non-small cell lung cancer cell lines[1][2].

  

• HY-103397

  Nanaomycin A	52934-83-5
  Nanaomycin A is the first selective DNMT3B inhibitor with an IC50 of 500 nM. Nanaomycin A, a quinone antibiotics, reactivates silenced tumor suppressor genes in human cancer cells[1]. Nanaomycin A inhibits in vitro growth of the human malaria parasite Plasmodium falciparum with an IC80 value of 33.1 nM[2].

  

• HY-110275

  RA839	1832713-02-6	98.54%
  RA839 is a selective Nrf2/ARE pathway agonist and non-covalent small molecule binder of Keap1 (Kd is approximately 6 μM). RA839 prevents inducible nitric oxide synthase expression and nitric oxide release. RA839 exerts anti-rotaviral and anti-inflammatory effects[1][2].

  

• HY-113074

  Glycolithocholic acid 3-sulfate	15324-64-8
  Glycolithocholic acid 3-sulfate (SLCG) is a cholic acid derivative and a metabolite of glycolithocholic acid. Glycolithocholic acid 3-sulfate inhibits replication of HIV-1 in vitro. Glycolithocholic acid 3-sulfate can be used for the research of HIV infection and gallbladder disease[1][2].

  

• HY-113365

  Cholestenone	601-57-0
  Cholestenone (4-cholesten-3-one) is an orally available antimicrobial agent that is metabolized primarily in the liver as an intermediate oxidation product of cholesterol. Cholestenone inhibits human dermal fibroblast migration and fights Helicobacter pylori infection in vitro and in mouse models by inhibiting cholesterol-α-D-glucopyranoside (CGL). Cholestenone also alleviates metabolic disorders caused by obesity in db/db mice[1][2][3][4].

  

• HY-116564

  Lotilaner	1369852-71-0	99.84%
  Lotilaner is a parasiticide, acts as a potent non-competitive antagonist of insects GABACl receptors, with an IC50 of 23.84 nM for Drosophila melanogaster GABA receptor. No effect on a dog GABAA receptor[1].

  

• HY-118448

  2,4-Diacetylphloroglucinol	2161-86-6	99.27%
  2,4-Diacetylphloroglucinol is a polyketide antibiotic produced by Pseudomonas fluorescens. 2,4-Diacetylphloroglucinol exhibits broad-spectrum toxicity against various organisms such as bacteria, fungi, oomycetes, and nematodes. 2,4-Diacetylphloroglucinol can also inhibit plant pathogens and affect the root development of tomato seedlings[1][2][3].

  

• HY-121389

  Hexadecanamide	629-54-9
  Hexadecanamide (Palmitamide), a fatty acid amide, has orally active anti-allergic, antioxidant, and neuroprotective effects. Hexadecanamide alleviate S. aureus-caused mastitis by depressing inflammatory response and maintaining blood-milk barrier integrity. Hexadecanamide depresses S. aureus-induced activation of the NF-κB pathway in mouse mammary epithelial cells (MMECs). Hexadecanamide activates PPARα. Hexadecanamide enhances sperm motility in vitro[1][2].

  

• HY-128525

  Enterobactin	28384-96-5
  Enterobactin is a siderophore produced by Gram-negative bacteria and has an extremely high affinity for iron. During the process of Salmonella typhimurium infecting macrophages, Enterobactin can not only help bacteria uptake iron but also reduce the antibacterial activity of macrophages. In addition, Enterobactin is also involved in the oxidative stress response of Escherichia coli. Enterobactin can be hydrolyzed by Fes in the cell and exert antioxidant effects by scavenging free radicals[1][2].

  

• HY-134809

  Cyclotriazadisulfonamide	182316-44-5	98.45%
  Cyclotriazadisulfonamide (CADA) is a specific CD4-targeted HIV entry inhibitors. Cyclotriazadisulfonamide (CADA) inhibits the co-translational translocation of human CD4 (huCD4) into the ER lumen in a signal peptide (SP)-dependent way. Cyclotriazadisulfonamide is also a Sec61 translocon inhibitor[1][2][3].

  

• HY-151473

  PIKfyve-IN-1	2857982-26-2	99.64%
  PIKfyve-IN-1 is a highly potent and cell-active chemical probe that inhibits phosphatidylinositol-3phosphate 5-kinase (PIKfyve) with IC50 value of 6.9 nM. PIKfyve-IN-1 can be used for the research of PIKfyve in virology[1]. PIKfyve-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-171006

  IRF1-IN-1	701225-07-2	99.72%
  IRF1-IN-1 (Compound I-2) is an IRF1 inhibitor. IRF1-IN-1 decreases the recruitment of IRF1 to the promoter of CASP1. IRF1-IN-1 inhibits cell death signaling pathway (i.e., cleavage of Caspase 1, GSDMD, IL-1 and PARP1). IRF1-IN-1 has a protective effect on ionizing radiation-induced inflammatory skin injury[1].

  

• HY-B0322A

  Sulfamethoxazole sodium	4563-84-2	99.79%
  Sulfamethoxazole (Ro 4-2130) sodium is a sulfonamide antibiotic with a widespread antibacterial activity. Sulfamethoxazole sodium inhibits bacterial folate metabolism by competing with 4-Aminobenzoic acid (HY-B1008) (PABA) to act on dihydropteroate synthetase and dihydropteroate reductase. Sulfamethoxazole sodium can be used for the study of urinary tract infections (UTIs), prostatitis, and bronchitis[1][2][3].

  

• HY-N6800A

  Netropsin dihydrochloride	18133-22-7	99.92%
  Netropsin dihydrochloride is a small-molecule MGB (minor-groove binder) and antibiotic, inhibits the catalytic activity of isolated topoisomerase and interferes with the stabilization of the cleavable complexes of topoisomerase II and I in nuclei. Netropsin dihydrochloride has antibacterial and antiviral activity[1][4][5].

  

• HY-P0281A

  TAT TFA		98.85%
  TAT TFA (YGRKKRRQRRR) is derived from the transactivator of transcription (TAT) of human immunodeficiency virus (HIV-1) and is a cell-penetrating peptide. TAT can increase the yields and the solubility of heterologous proteins[1].

  

• HY-P10373

  pJAK2(1001–1013)	1259928-08-9	99.80%
  pJAK2(1001-1013) is a SOCS1/3 antagonist. pJAK2(1001–1013) plays a positive role in antiviral immune response by inhibiting the negative regulatory effect of SOCS proteins and enhancing the JAK/STAT signaling pathway[1]

  

• HY-113469A

  Cyclic GMP sodium	40732-48-7	99.89%
  Cyclic GMP (cGAMP) sodium is an endogenous second messenger that triggers interferon production in response to cytoplasmic DNA. Cyclic GMP sodium can activate the stimulator of interferon genes (STING), activating the signaling cascade that leads to the production of type I interferons and other immune mediators. Cyclic-GMP-AMP, a conjugate of cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses. Cyclic GMP sodium may also activate PDE to degrade cAMP, inhibit myocardial calcium current ICa, and regulate myocardial contractility. The derivative of Cyclic GMP sodium, 8-Br-cGMP, has antiplatelet activity, and Cyclic GMP sodium can be used in the study of antiviral immunity and cardiovascular diseases[1][2][3][4].

  

• HY-131904A

  Hex	2004714-32-1	99.96%
  Hex is an enolase inhibitor and antimalarial agent with Ki values of 74.4 nM and 269.4 nM for ENO2 and ENO1, respectively. Hex is a NfENO and TbENO inhibitor with IC50s value of 0.14 μM and 2.1 μM, respectively. Hex has antimalarial activity against Plasmodium falciparum 3D7, Naegleria fowleri trophozoites and Plasmodium berghei ANKA strain. Hex has anti-tumor effects against intracranial tumors[1][2][3][4][5][6][7][8].

  

• HY-W013260

  2'-O-Methylguanosine	2140-71-8
  2'-O-Methylguanosine is a modified nucleoside produced in tRNAs by the action of tRNA guanosine-2’-O-methyltransferase. 2'-O-Methylguanosine results in apoptotic changes of cells[1][2].

  

• HY-W015490

  1,4-Naphthoquinone	130-15-4
  1,4-Naphthoquinone is an inhibitor with broad-spectrum inhibitory activity targeting DNA polymerase, NF-κB and monoamine oxidase (MAO-A/B), with antibacterial and anti-biofilm efficacy. 1,4-Naphthoquinone is a competitive inhibitor of MAO-B (Ki=1.4 μM) and a non-competitive inhibitor of MAO-A (Ki=7.7 μM). 1,4-Naphthoquinone inhibits DNA polymerase pol α, β, γ, δ, ε, λ with IC50 ranging from 5.57-128 μM. 1,4-Naphthoquinone inhibits tumor cell proliferation, induces apoptosis and necrosis, and has anti-angiogenic and anti-inflammatory activities by inducing oxidative stress, depleting glutathione (GSH), inhibiting DNA polymerase-mediated DNA synthesis and blocking NF-κB nuclear translocation. 1,4-Naphthoquinone can be used in anti-bacterial , anti-tumor and anti-inflammatory studies, including inhibition of melanoma and colon cancer cell growth and endothelial cell function, as well as LPS-induced inflammation models[1][2][3][4][5].

  

• HY-32865

  tert-Butyl 2,2,2-trichloroacetimidate	98946-18-0
  tert-Butyl 2,2,2-trichloroacetimidate is a tert-butylation reagent. tert-Butyl 2,2,2-trichloroacetimidate achieves mild, nonreversible tert-butylation of alcohols and phenols. tert-Butyl 2,2,2-trichloroacetimidate is used in the synthesis of antimicrobial agents[1][2].

  

• HY-N0253

  Hederacoside C	14216-03-6
  Hederacoside C (Kalopanaxsaponin B) is an ingredient that can be obtained mainly from ivy leaves. Hederacoside C mediates inflammation by inhibiting activation of MAPK/NF-κB and its downstream signaling pathway. Hederacoside C has anti-inflammatory and antibacterial activity[1][2][3].

  

• HY-Y0335

  1,3-Dihydroxyacetone	96-26-4
  1,3-Dihydroxyacetone (DHA), the main active ingredient in sunless tanning skin-care preparations and an important precursor for the synthesis of various fine chemicals, is produced on an industrial scale by microbial fermentation of glycerol (HY-B1659) in Gluconobacter oxydans. 1,3-Dihydroxyacetone is also used for synthesis of new biodegradable polymers by combining with lactic acid (HY-B2227)[1][2].

  

• HY-110012

  SCH-202676 hydrobromide	265980-25-4
  SCH-202676 hydrobromide is an allosteric modulator of G protein-coupled receptors (GPCRs) and adenosine receptor (AR). SCH-202676 hydrobromide has antiviral activity and inhibits 3CLpro in a time-dependent manner with an IC50 value of 0.655 μM[1][2][3][4].

  

• HY-N1428A

  Citric acid monohydrate	5949-29-1
  Citric acid monohydrate is a natural preservative and food tartness enhancer. Citric acid monohydrate induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid monohydrate cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid monohydrate is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-Y0569C

  D-Gluconic acid potassium	299-27-4
  D-Gluconic acid potassium is an orally active carboxylic acid by the oxidation with antiseptic and chelating properties[1].

  

• HY-B0977

  Dicloxacillin Sodium hydrate	13412-64-1
  Dicloxacillin Sodium hydrate (Dicloxacillin sodium salt monohydrate) is a narrow-spectrum β-Lactam antibiotic of the penicillin class, is used to treat infections caused by susceptible Gram-positive bacteria, active against beta-lactamase-producing organisms such as Staphylococcus aureus[1][2][3].

  

• HY-137958A

  Bemnifosbuvir	1998705-64-8	99.00%
  Bemnifosbuvir (AT-511) is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir has pangenotypic antiviral activity[1][2][3].

  

• HY-19840

  Voxilaprevir	1535212-07-7	99.92%
  Voxilaprevir (GS-9857) is a noncovalent, reversible inhibitor of HCV NS3/4A protease inhibitor (PI) with pangenotypic antiviral activity[1]. Voxilaprevir inhibits genotype 1b and 3a wild-type NS3 proteases with Ki values of 0.038 nM and 0.066 nM, respectively[1]. Voxilaprevir is an orally active direct-acting antiviral agent (DAA) and can be used for HCV infection research[2].

  

• HY-109008

  Nacubactam	1452458-86-4
  Nacubactam (OP0595 free acid) is a potent non-β-lactam-β-lactamase inhibitor with activity against class A and C β-lactamases. Nacubactam acts as a penicillin binding protein (PBP) 2-active antibacterial, and gives β-lactamase-independent potentiation of β-lactams targeting other PBPs. Nacubactam potentiates the antimicrobial activities of Piperacillin (HY-B1923), Cefepime (HY-B0692), and Meropenem (HY-13678) against CTX-M-15-positive Escherichia coli and KPC-positive Klebsiella pneumoniae[1][2][3][4][5][6].

  

• HY-137048

  PF-00835231	870153-29-0	98.23%
  PF-00835231 is a CoV-2 cysteine 3C-like protease (3CLpro) inhibitor, with IC50s of 0.27 nM and 4 nM for SARS CoV-2 and SARS CoV-1 3CLpro, respectively. PF-00835231 is developed for the research of anti-SARS-CoV-2/COVID-19. PF-00835231 can inhibit cell infections and also suppress infections in animal models[1][2][3].

  

• HY-17581

  Buparvaquone	88426-33-9	99.44%
  Buparvaquone is a hydroxynaphthoquinone antiprotozoal agent related to parvaquone and atovaquone.

  

• HY-77813

  Benzyl isothiocyanate	622-78-6	99.62%
  Benzyl isothiocyanate is an orally available isothiocyanate with bactericidal, anticancer, antiangiogenic and anthelmintic activities. Benzyl isothiocyanate exerts anticancer functions by regulating multiple signaling pathways, including apoptosis, cell proliferation, cell cycle arrest, metastasis, angiogenesis, and autophagy. In addition, Benzyl isothiocyanate can enhance muscle insulin sensitivity to improve obesity-induced hyperglycemia[1][2][3][4][5][6][7][8][9].

  

• HY-78726

  Fosamprenavir	226700-79-4
  Fosamprenavir (Amprenavir phosphate;GW 433908) is a phosphate ester proagent of the antiretroviral protease inhibitor Amprenavir, with improved solubility[1]. Anti-HIV infection[1].

  

• HY-B0295

  Chloroxine	773-76-2	99.79%
  Chloroxine is one of the important 8-hydroxyquinoline derivative. Chloroxine has effective antibacterial, antifungal, antiprotozoal and antiamoebic activities, especially used in treating the intestinal amebiasis. Chloroxine is also used in the treatment of dandruff and seborrheic dermatitis of the scalp[1][2].

  

• HY-B0301

  Bifonazole	60628-96-8	99.95%
  Bifonazole (Bay H-4502) is an imidazole antifungal agent.

  

• HY-B0453

  Econazole nitrate	24169-02-6
  Econazole nitrate is an imidazole class antifungal medication[1]. Econazole nitrate also has antibacterial activity[2].

  

• HY-B0508

  Ornidazole	16773-42-5	99.58%
  Ornidazole (Ro 7-0207) is a nitroimidazole derivative with anti-trichomonad activity and in vitro activity against a variety of anaerobic bacteria. Ornidazole inhibits Sonic hedgehog (Shh) signaling pathway, exhibits antitumor activity. Ornidazole can be used in research of Crohn’s disease[1][2][3].

  

• HY-B0565

  Ronidazole	7681-76-7
  Ronidazole is a potent and orally active antiprotozoal and anti-microbial agent. Ronidazole acts as a veterinary agent against Tritrichomonas foetus in cats models. Ronidazole can be used the research of forhistomoniasis and swine dysentery[1][2][3].

  

• HY-B0644

  Sucralfate	54182-58-0
  Sucralfate (Sucrose octasulfate-aluminum complex) is a potent and orally active gastroprotectant with no systemic effects. Sucralfate inhibits peptic activity and binds to negatively charged subepithelial proteins exposed during mucosal injury, forming a viscous layer that protects the vascular bed and proliferative zone. Sucralfate is used for prevention and research of several gastrointestinal diseases in vivo[1][2].

  

• HY-B0849

  Azoxystrobin	131860-33-8	99.00%
  Azoxystrobin is an orally active, broad-spectrum β-methoxyacrylate fungicide. Azoxystrobin inhibits mitochondrial respiration by binding to the Qo site of the cytochrome bc1 complex and inhibiting electron transfer. Azoxystrobin induces the production of reactive oxygen species (ROS) and induces cell apoptosis[1][2][3][4].

  

• HY-B0889

  Ethacridine lactate monohydrate	6402-23-9	99.97%
  Ethacridine lactate (Acrinol) monohydrate is a widely used antiseptic and abortifacient. Ethacridine lactate monohydrate is effective against Staphylococcus aureus and other gram-positive cocci. Ethacridine lactate monohydrate is also a poly(ADP-ribose) glycohydrolase (PARG) inhibitor[1][2][3].

  

• HY-B0900

  Anethole	104-46-1	99.81%
  Anethole is a type of orally active aromatic compound that is widely found in nature and used as a flavoring agent. Anethole possesses anticancer, anti-inflammatory, antioxidant, antibacterial, antifungal, anesthetic, estrogenic, central nervous system depressant, hypnotic, insecticidal, and gastroprotective effects. Anethole can be used in the study of oxidative stress-related skin diseases and prostate cancer[1][2][3][4][5].

  

• HY-B0963

  Cloxiquine	130-16-5
  Cloxiquine (5-Chloro-8-quinolinol) is an antibacterial, antifungal and antiamoebic agent. Cloxiquine can be used for the research of tuberculosis and dermatoses. Cloxiquine suppresses the growth and metastasis of melanoma cells through activation of PPARγ[1][2].

  

• HY-B1145

  Chlorhexidine dihydrochloride	3697-42-5	99.83%
  Chlorhexidine dihydrochloride is a orally active cationic antimicrobial agent that targets microbial cell membranes. Chlorhexidine dihydrochloride binds to cell membrane phospholipids non-specifically, destroys membrane structure and induces leakage of cell contents. Chlorhexidine dihydrochloride has broad-spectrum bactericidal activity against both Gram-positive and Gram-negative bacteria. Chlorhexidine dihydrochloride can interfere with membrane permeability, cause protein precipitation and energy metabolism disorders, such as rapid inhibition of microbial growth and induction of cell death (necrosis or apoptosis)[1][2][3].

  

• HY-B1366

  Meclocycline Sulfosalicylate Salt	73816-42-9	99.56%
  Meclocycline Sulfosalicylate Salt is a tetracycline antibiotic with broad-spectrum antibacterial activities, preventing skin bacterial infections such as acne vulgaris[1].

  

• HY-B1516

  Alovudine	25526-93-6	99.88%
  Alovudine (3'-Fluoro-3'-deoxythymidine) is a mtDNA synthesis inhibitor and a marker of DNA synthesis. Alovudine is less susceptible to inflammatory changes than 18F-Fluorodeoxyglucose (FDG) and thus is a better biomarker in pancreatic cancer. Alovudine shows anti-orthopoxvirus and anti-leukemic activity[1][2][3][4][5][6].

  

• HY-B2064

  Carboxin	5234-68-4
  Carboxin (Carboxine) is a systemic agricultural fungicide and seed protectant.

  

• HY-N0231

  Bavachalcone	28448-85-3	99.95%
  Bavachalcone is a potent inducer of apoptosis. Bavachalcone exerts anticancer activity by promoting autophagy and apoptosis in HepG2 cells. Bavachalcone acts as an anti-neuroinflammatory and antidepressant through the NF-κB pathway. Bavachalcone inhibits osteoclasts by interfering with ERK and Akt signaling pathways and the expression of c-Fos and NFATc1. Bavachalcone exhibits a significant inhibitory effect on baculovirus-expressed BACE-1 in vitro[1][2][3][4].

  

• HY-N0248

  Saikosaponin B2	58316-41-9	98.94%
  Saikosaponin B2 is an active component from Bupleurum chinensis root, acts as an entry inhibitor against HCV infection[1]. Anti-cancer activity[2].

  

• HY-N0589

  Dehydrodiisoeugenol	2680-81-1	99.98%
  Dehydrodiisoeugenol is isolated from Myristica fragrans Houtt, shows anti-inflammatory and anti-bacterial actions[1]. Dehydrodiisoeugenol inhibits LPS- stimulated NF-κB activation and cyclooxygenase (COX)-2 gene expression in murine macrophages[2].

  

• HY-N0849

  Dictamine	484-29-7	99.60%
  Dictamnine (Dictamine) exhibits cytotoxicity to human cervical and colon cancer cells and also has antibacterial and antifungal activities[1].

  

• HY-N2127

  Pinostrobin	480-37-5	99.98%
  Pinostrobin is a flavonoid with anti-cancer, antioxidant, antiviral and neuroprotective activities. Pinostrobin has oral activity. Pinostrobin is a potent PCSK9 inhibitor that inhibits the catalytic activity of PCSK9. Pinostrobin can be used in the research of viral infections, cancer, leukemia, cardiovascular and cerebrovascular diseases, cirrhosis, inflammation and neurological diseases[1][2][3][4][5][6][7][8].

  

• HY-N2343

  Procyanidin A2	41743-41-3	99.85%
  Procyanidin A2 is a flavonoid found in grapes, with anti-cancer, antioxidant, antimicrobial and anti-inflammation activity[1][2].

  

• HY-N2387

  Pinosylvin	22139-77-1	99.94%
  Pinosylvin is a?pre-infectious stilbenoid toxin?isolated from the heartwood of Pinus species, has anti-bacterial activities[1]. Pinosylvin is a resveratrol analogue, can induce cell apoptosis and autophapy in leukemia cells[2].

  

• HY-N3980

  Guaiol	489-86-1
  Guaiol is a sesquiterpenoid alcohol with oral activity found in various traditional Chinese medicines, exhibiting biological activities such as anti-proliferative, autophagy-promoting, insecticidal, anti-anxiety, anti-inflammatory, diuretic, and blood pressure-lowering effects. Guaiol induces apoptosis in non-small cell lung cancer cells by regulating the stability of RAD51 through autophagy modulation. Guaiol can also act directly on parasites, inhibiting their growth by affecting the kinetoplast, mitochondrial matrix and plasma membrane of the promastigotes. Guaiol kills amastigotes at an IC50 of 0.01 µg/mL. Guaiol can be used in research related to cancer, infections, cardiovascular diseases, and inflammatory conditions[1][2][3][4][5][6].

  

• HY-N4100

  Trilobatin	4192-90-9	99.00%
  Trilobatin, a natural sweetener derived from Lithocarpus polystachyus Rehd[1], Trilobatin is an HIV-1 entry inhibitor targeting the HIV-1 Gp41 envelope[2]. Neuroprotective effects[1]. Trilobatin is also a SGLT1/2 inhibitor that selectively induces the proliferation of human hepatoblastoma cells[3].

  

• HY-N6665

  Cefquinome sulfate	118443-89-3	98.63%
  Cefquinome sulfate is a broad-spectrum cephem antibiotic that has inhibitory effects on a variety of Gram-positive and Gram-negative bacteria, including Staphylococci, Streptococci, Pseudomonas, and Enterobacteriaceae[1][2][3].

  

• HY-P1034

  DAPTA	106362-34-9	99.85%
  DAPTA is a synthetic peptide, functions as a viral entry inhibitor by targeting selectively CCR5, and shows potent anti-HIV activities.

  

• HY-P1539

  Cecropin A	80451-04-3	99.54%
  Cecropin A is a linear 37-residue antimicrobial polypeptide, with anticancer and anti-inflammatory activity.

  

• HY-P4855

  CRAMP (mouse)	376364-36-2	98.33%
  CRAMP (mouse) is an antimicrobial peptide. CRAMP (mouse) can be used for the research of biofilm-associated infections[1].

  

• HY-Y0055

  Phenothiazine	92-84-2
  Phenothiazine is an antibiotic which has insecticidal, fungicidal, antibacterial and anthelmintic activities. Phenothiazine also can be used for the research of neurological diseases[1][2].

  

• HY-100436

  Cadazolid	1025097-10-2	98.76%
  Cadazolid (ACT-179811) is a new oxazolidinone antibiotic with potent activity against Clostridium difficile.

  

• HY-101795

  Larixyl acetate	4608-49-5	99.46%
  Larixyl acetate is a potent and selective TRPC6 inhibitor with IC50 values of 0.58 μM and 6.83 μM against hTRPC6-YFP and hTRPC3-YFP, respectively. Larixyl acetate prevents HPV and is effective in protecting against traumatic brain injury-induced systemic endothelial dysfunction[1][2][3][4][5].

  

• HY-105088

  Pexiganan	147664-63-9	99.78%
  Pexiganan (MSI 78 free base) is a synthetic analog of magainin 2. Pexiganan is a potent and orally active broad-spectrum antimicrobial peptide. Pexiganan can be used in the research of infections, such as diabetic foot ulcer infections[1].

  

• HY-108313

  T-00127_HEV1	900874-91-1
  T-00127_HEV1 is a phosphatidylinositol 4-kinase III beta (PI4KB) inhibitor with an IC50 of 60 nM.

  

• HY-108900

  Leu-AMS	288591-93-5	98.08%
  Leu-AMS (compound 6), a leucine analogue, is a potent inhibitor of leucyl-tRNA synthetase (LRS) with an IC50 of 22.34 nM, which inhibits the catalytic activity of LRS but did not affect the leucine-induced mTORC1 activation. Leu-AMS shows cytotoxicity in cancer cells and normal cells, and inhibits the growth of bacteria[1].

  

• HY-112589

  BRITE-338733	503105-88-2	98.93%
  BRITE-338733 is a RecA ATPase inhibitor, with an IC50 of 4.7 µM[1].

  

• HY-123295

  HDAC3-IN-T247	1451042-18-4	98.94%
  HDAC3-IN-T247 is a potent and selective HDAC3 (histone deacetylase 3) inhibitor, with an IC50 of 0.24 µM. HDAC3-IN-T247 induces a selective increase of NF-κB acetylation in HCT116 cells. HDAC3-IN-T247 shows anticancer and antiviral activity. HDAC3-IN-T247 inhibits growth of cancer cells, and activates HIV gene expression in latent HIV-infected cells[1].

  

• HY-136199

  SIRT1-IN-1	352554-02-0	98.15%
  SIRT1-IN-1 is a selective SIRT1 inhibitor with an IC50 of 0.205 μM. SIRT1-IN-1 inhibits SIRT2 with an IC50 of 11.5 μM[1]. SIRT1-IN-1, a indole, is a cytomegalovirus (CMV) inhibitors and has antiviral activity[2].

  

• HY-147429

  Zosurabalpin	2379336-76-0	99.09%
  Zosurabalpin is a polypeptide antibiotic targeting LPS transporter (LptB2FGC complex), which can block the transport of LPS and lead to endotoxin accumulation in cells, and has shown excellent antibacterial activity against Carbapenem-resistant Acinetobacter baumanni (CRAB) [1] [2].

  

• HY-16908A

  Lefamulin acetate	1350636-82-6	98.76%
  Lefamulin (BC-3781) acetate is an orally active antibiotic. Lefamulin acetate inhibits protein synthesis by binding to the peptidyl transferase center of the 50S bacterial ribosome. Lefamulin acetate has anti-inflammatory activity. Lefamulin acetate can be used in the research of bacterial infections, such as bacterial pneumonia[1].

  

• HY-17503B

  Metoprolol tartrate	56392-17-7	99.98%
  Metoprolol tartrate is an orally active, selective β1-adrenoceptor antagonist. Metoprolol tartrate shows anti-inflammation, antitumor and anti-angiogenic properties[1][2][3].

  

• HY-B0322S

  Sulfamethoxazole-d4	1020719-86-1
  Sulfamethoxazole-d4 (Ro 4-2130-d4) is a deuterium labeled Sulfamethoxazole (HY-B0322). Sulfamethoxazole (Ro 4-2130) is a sulfonamide antibiotic with a widespread antibacterial activity. Sulfamethoxazole inhibits bacterial folate metabolism by competing with 4-Aminobenzoic acid (HY-B1008) (PABA) to act on dihydropteroate synthetase and dihydropteroate reductase. Sulfamethoxazole can be used for the study of urinary tract infections (UTIs), prostatitis, and bronchitis[1][2][3].

  

• HY-B1278B

  (±)-α-Tocopherol acetate	7695-91-2
  (±)-α-Tocopherol acetate ((±)-Vitamin E acetate), is a orally active synthetic form of vitamin E. (±)-α-Tocopherol acetate is the ester of acetic acid and α-tocopherol. (±)-α-Tocopherol acetate can be used for the research of the susceptibility of farmed fish to infectious diseases[1].

  

• HY-N0110B

  Palmatine hydroxide	131-04-4	99.64%
  Palmatine hydroxide is an orally active and irreversible indoleamine 2,3-dioxygenase 1 (IDO-1) inhibitor with IC50s of 3 μM and 157μM against HEK 293-hIDO-1 and rhIDO-1, respectively. Palmatine hydroxide can also inhibit West Nile virus (WNV) NS2B-NS3 protease in an uncompetitive manner with an IC50 of 96 μM. Palmatine hydroxide shows anti-cancer, anti-oxidation, anti-inflammatory, neuroprotection, antibacterial, anti-viral activities[1][2][3][4][5].

  

• HY-N0592A

  Demethyleneberberine chloride	16705-03-6	98.93%
  Demethyleneberberine chloride is a natural mitochondria-targeted antioxidant. Demethyleneberberine chloride alleviates mice colitis and inhibits the inflammatory responses by inhibiting NF-κB pathway and regulating the balance of Th cells. Demethyleneberberine chloride could serve as a AMPK activator for researching non-alcoholic fatty liver disease (NAFLD)[1][2][3].

  

• HY-P0311A

  LAH4 TFA		99.17%
  LAH4 TFA, an alpha-helix of the designed amphipathic peptide antibiotic, exhibits potent antimicrobial, nucleic acid transfection and cell penetration activities. LAH4 TFA possesses high plasmid DNA delivery capacities. LAH4 TFA has a strong affinity for anionic lipids found in the outer membrane of bacterial membranes[1][2][3].

  

• HY-P1934A

  Cyclo(L-Phe-L-Pro)	3705-26-8	99.91%
  Cyclo(L-Phe-L-Pro), isolated from Pseudomonas fluorescens and Pseudomonas alcaligenes cell-free culture supernatants is an antifungal cyclic dipeptide[1]. Cyclo(L-Phe-L-Pro) inhibits IFN-β production by interfering with retinoic-acid-inducible gene-I (RIG-I) activation[2]. Cyclo(L-Phe-L-Pro) exhibits free-radical scavenging activity with the IC50 of 24 µM in the DPPH assay[3].

  

• HY-P4744A

  LL-37 amide TFA		99.38%
  LL-37 amide TFA is a positively charged antimicrobial peptide. LL-37 amide TFA has anticancer activity and can be used for cancer research[1][2].

  

• HY-P99103

  Bebtelovimab	2578319-11-4
  Bebtelovimab a humanized IgG1-λ2 antibody targeting to SARS-CoV-2, especially COVID-19. Bebtelovimab potently neutralizes SARS-CoV-2 variants, and inhibits COVID-19 with mild-to-moderate efficacy[1][2].

  

• HY-128780B

  SPR206 acetate	2408422-41-1	99.74%
  SPR206 acetate is a polymyxin analog with antibiotic activity against Gram-negative pathogens, including multidrug-resistant (MDR) variants. SPR206 acetate has an anti-bacterial infection effect by interacting with the bacterium’s outer membrane. The MIC values of SPR206 acetate against Pseudomonas aeruginosa Pa14 and Acinetobacter baumannii NCTC13301 are both 0.125 mg/L[1][2].

  

• HY-W004546

  Abametapir	1762-34-1	99.89%
  Abametapir is a metalloproteinase (MMP) inhibitor which is able to target metalloproteinases critical to egg hatching and louse development. Abametapir can inhibit hatching of both head and body louse[1][2].

  

• HY-W014589

  2,4-Di-tert-butylphenol	96-76-4	99.99%
  2,4-Di-tert-butylphenol (2,4-DTBP) is an orally active RXRα activator and a human estrogen receptor ligand with anti-inflammatory and antioxidant activities, which can induce apoptosis in tumor cells. 2,4-Di-tert-butylphenol can activate the RXRα subtype in LXRα/RXRα, PPARγ/RXRα, and hormone receptor β/RXRα. 2,4-Di-tert-butylphenol also has antiviral and antifungal activities and has the potential to inhibit Aβ-induced neurotoxicity. 2,4-Di-tert-butylphenol can be used as an intermediate in the preparation of antioxidants and UV stabilizers, and is also used in the manufacture of drugs and fragrances[1][2][3].

  

• HY-W133982

  Corn steep liquor	66071-94-1
  Corn steep liquor, a food industrial by-product, is a nutritional additive in the liquid culture medium of fungus. Corn steep liquor can increase the production of fairy chemicals and mycelia[1][2].

  

• HY-A0181S1

  Adenosine monophosphate-15N5 dilithium
  Adenosine monophosphate-15N5 dilithium is the 15N labeled Adenosine monophosphate (HY-A0181). Adenosine monophosphate is an adenosine A1 receptor agonist. Adenosine monophosphate has significant antiviral activity against HSV-1 and HSV-2. Adenosine monophosphate is a key cellular metabolite regulating energy homeostasis and signal transduction[1][2][3].

  

• HY-15592A

  Cabotegravir sodium	1051375-13-3	99.87%
  Cabotegravir (GSK-1265744) sodium is a orally active and long-acting HIV integrase strand transfer inhibitor and organic anion transporter 1/3 (OAT1/OAT3) inhibitor with IC50 values of 2.5 nM, 0.41 μM and 0.81 μM for HIVADA, OAT3 and OAT1, respectively. Cabotegravir sodium is primarily metabolized by uridine diphosphate glucuronosyltransferase (UGT) 1A1, with low potential to interact with other antiretroviral agents (ARVs). Cabotegravir sodium can be used to research AIDS[1][2].

  

• HY-10443

  Balapiravir	690270-29-2
  Balapiravir (Ro 4588161; R1626) is an orally active proagent of a nucleoside analogue inhibitor of the RNA-dependent RNA polymerase (RdRp) of HCV (R1479; 4'-Azidocytidine). Balapiravir has anti-HCV activity[1][2][3]. Balapiravir is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-104012

  Islatravir	865363-93-5	99.94%
  Islatravir (MK-8591) is a potent anti-HIV-1 agent, acting as a nucleoside reverse transcriptase inhibitor, with EC50s of 0.068 nM, 3.1 nM and 0.15 nM for HIV-1 (WT), HIV-1 (M184V), HIV-1 (MDR), respectively. Islatravir is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-19314A

  Azvudine hydrochloride	1333126-31-0
  Azvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains[1]. Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-B0502A

  Enrofloxacin monohydrochloride	93106-59-3	98.94%
  Enrofloxacin monohydrochloride (BAY Vp 2674 monohydrochloride) is an effective antibiotic with an MIC90 of 0.312 μg/mL for Mycoplasma bovis. Enrofloxacin monohydrochloride shows inhibitory activity against vaccinia virus (VV).

  

• HY-10468

  NM107	20724-73-6	99.23%
  NM107 (2'-C-Methylcytidine) is an nucleoside inhibitor of the hepatitis C virus (HCV) NS5B polymerase, the EC50 of NM107 in the wild-type replicon cells is 1.85 μM[1][2].

  

• HY-11097

  TMC353121	857066-90-1
  TMC353121 is a potent respiratory syncytial virus (RSV) fusion inhibitor with pEC50 of 9.9.

  

• HY-16349

  Nimorazole	6506-37-2	99.33%
  Nimorazole (K-1900), a 2-nitroimidazole, is a hypoxic cell-radiation sensitizer. Nimorazole has anti-infective and anti-protozoal against trichomoniasis. Nimorazole has the potential for head and neck cancer[1][2].

  

• HY-102038

  PC786	1902114-15-1	99.11%
  PC786 is an inhaled respiratory syncytial virus (RSV) L protein polymerase inhibitor. PC786 demonstrates potent antiviral activity against RSV-A (IC50 <0.09 to 0.71 nM) and RSV-B (IC50, 1.3 to 50.6 nM)[1].

  

• HY-17423A

  Abacavir sulfate	188062-50-2	99.88%
  Abacavir sulfate (Abacavir Hemisulfate) is a competitive, orally active nucleoside reverse transcriptase inhibitor. Abacavir sulfate can inhibits the replication of HIV. Abacavir sulfate shows anticancer activity in prostate cancer cell lines. Abacavir sulfate can trespass the blood-brain-barrier and suppresses telomerase activity[1][2][3].

  

• HY-12429

  Beclabuvir	958002-33-0	99.94%
  Beclabuvir is an allosteric inhibitor that binds to thumb site 1 of the hepatitis C virus (HCV) NS5B RNA-dependent RNA polymerase, and inhibits recombinant NS5B proteins from HCV genotypes 1, 3, 4, and 5 with IC50 of < 28 nM[1][2].

  

• HY-12638

  Dichlorophen	97-23-4	98.55%
  Dichlorophen (DDM) is an anticestodal agent. Dichlorophen is an antimicrobial agent shown to exert activity against cestodes, protozoa, fungi, and bacteria.

  

• HY-13231

  CDK9-IN-1	1415559-43-1	98.52%
  CDK9-IN-1 is a novel, selective CDK9 inhibitor for the treatment of HIV infection, with an IC50 of 39 nM for CDK9/CycT1, extracted from reference, compound 87.

  

• HY-50737

  DUB-IN-3	924296-17-3	98.41%
  DUB-IN-3 (compound 22c) is a potent and selective inhibitor of the deubiquitinating enzyme USP8 with an IC50 value of 0.56 μM. DUB-IN-3 is promising for research of cancer, neurodegenerative diseases, inflammation, viral infection and cardiovascular disease[1].

  

• HY-B0414

  Fleroxacin	79660-72-3	99.97%
  Fleroxacin (RO 23-6240) is a broad-spectrum antimicrobial fluoroquinolone.

  

• HY-B0455

  Lomefloxacin hydrochloride	98079-52-8	99.97%
  Lomefloxacin (SC47111A) hydrochloride is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin hydrochloride is used for the research of respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc.[1][2].

  

• HY-B1257

  Cefmetazole sodium	56796-39-5
  Cefmetazole sodium (Sodium cefmetazole) is a semisynthetic cephamycin antibiotic with broad-spectrum antibacterial activity, covering gram-positive, gram-negative, and anaerobic bacteria. Cefmetazole sodium binds to penicillin binding proteins (PBPs), resulting in interfering bacterial cell wall biosynthesis. Cefmetazole sodium is used for the research of gynecologic, intraabdominal, urinary tract, respiratory tract and skin and soft tissue infections[1][2][3].

  

• HY-B1290

  2-Phenylethanol	60-12-8	99.91%
  2-Phenylethanol (Phenethyl alcohol) is an aromatic alcohol with a rose-like odour. 2-Phenylethanol is a flavour and fragrance compound, and can be used as a preservative and anti-microbial agent. 2-Phenylethanol has antityrosinase and antimicrobial activities[1][2].

  

• HY-B1548

  Benznidazole	22994-85-0	99.90%
  Benznidazole (Ro 07-1051) is an antiparasitic medication, with an IC50 of 20.35 μM for Colombian T. cruzi strains, and has been used in the treatment of Chagas disease[1][2].

  

• HY-B1790

  Terconazole	67915-31-5	99.93%
  Terconazole is a broad-spectrum antifungal medication for the treatment of vaginal yeast infection.

  

• HY-D0896

  ANS	82-76-8
  ANS (8-Anilino-1-naphthalenesulfonic acid) is a competitive inhibitor targeting thyroxine binding globulin (TBG) (Ki=2.09×106 M-1). ANS is used in radioimmunoassay by displacing bound triiodothyronine (T3) to improve detection sensitivity. ANS can block the protein binding site of T3 and release free T3 for antibody recognition. As a fluorescent probe, ANS can specifically bind to the hydrophobic region of proteins (such as membrane proteins) and monitor the dynamics of protein conformation through changes in fluorescent signals. It is widely used in biochemical research and antibacterial material development[1][2].

  

• HY-N0078

  Ginkgolic Acid (C13:0)	20261-38-5	99.92%
  Ginkgolic Acid (C13:0) (Ginkgoneolic Acid) is an anti-cariogenic agent and a PI3Kδ inhibitor (IC50: 2.49 μM). Ginkgolic Acid (C13:0) exhibits antibacterial and anti-parasitic activities. Ginkgolic Acid (C13:0) can also inhibit mast cell degranulation (IC50: 2.40 μM)[1][2][3].

  

• HY-N0113

  Hordenine	539-15-1	99.88%
  Hordenine, an alkaloid found in plants, inhibits melanogenesis by suppression of cyclic adenosine monophosphate (cAMP) production[1].

  

• HY-N0535

  (+)-Magnoflorine chloride	6681-18-1	99.29%
  Magnoflorine chloride (Magnoflorine chloride), an aporphine alkaloid found in Magnolia or Aristolochia, reduces the formation of C. albicans biofilm[1]. Magnoflorine chloride has anti-fungal, anti-antidiabetic and anti-oxidative activity[2].

  

• HY-N1938

  D(+)-Raffinose pentahydrate	17629-30-0
  D(+)-Raffinose pentahydrate is an orally active inhibitor of LecA (Kd = 32 μM) and GtfC. D(+)-Raffinose pentahydrate reduces cyclic diguanylate (c-di-GMP) by increased activity of a c-di-GMP specific phosphodiesterase. D(+)-Raffinose pentahydrate interferes with GTF function. D(+)-Raffinose pentahydrate decreases IL-4 and IL-5 mRNA. D(+)-Raffinose pentahydrate exhibits biofilm-inhibitory activity against Pseudomonas aeruginosa and Streptococcus mutans and inhibits allergic airway eosinophilia[1][2][3].

  

• HY-N1944

  Nerolidol	7212-44-4
  Nerolidol has multiple natural membrane activities, possesses anti-cancer, anti-inflammatory, antibacterial and anti-insect activity. Nerolidol Suppresses parasitic activity, suppresses bloodsucking diseases, bloodworm diseases, and other diseases. Nerolidol can protect the cells from lipid and protein properties, damage to DNA, and protect the cells from damage.

  

• HY-N1952

  Isoeugenol	97-54-1
  Isoeugenol is an essential oil constituent of nutmeg, clove, and cinnamon. Isoeugenol inhibits growth of Escherichia coli and Listeria innocua with MICs of 0.6 mg/mL and 1 mg/mL, respectively[1].

  

• HY-N2026

  Propylparaben	94-13-3	99.74%
  Propylparaben (Propyl parahydroxybenzoate) is an antibacterial preservative that can be produced by plants and bacteria. Propylparaben is commonly used in cosmetics, pharmaceuticals and foods. Propylparaben disrupts follicular growth and steroidogenic function by altering cell cycle, apoptosis and steroidogenic pathways. Propylparaben also reduced sperm count and motility in rats[1][2][3][4][5][6].

  

• HY-N3075

  Phytol	150-86-7
  Phytol ((E)-Phytol) is an orally active diterpenoid alcohol that can be extracted from chlorophyll. Phytol has antioxidant, anti-inflammatory, anti-schistosomiasis and antibacterial activities[1][2][3].

  

• HY-N6807

  Elemicin	487-11-6	99.22%
  Elemicin is an orally active alkenylbenzene widely distributed in many herbs and spices. Elemicin inhibits Stearoyl-CoA Desaturase 1 (SCD1) by metabolic activation. Elemicin has anti-influenza activities, antimicrobial, antioxidant, and antiviral activities. Elemicin and its reactive metabolite of 1′-Hydroxyelemicin can induce hepatotoxicity[1][2][3][4].

  

• HY-N6977

  Ascr#3	946524-26-1	98.37%
  Ascr#3 is a type of pheromone found in the beautiful nematode, and when mixed with ascr#2, it can act as a male attractant and also induce the formation of dauer (the dormant larval stage). Ascr#3 can counteract the effects caused by male-enriched Ascr#10[1][2].

  

• HY-N6978

  Ascr#5	1086696-26-5
  Ascr#5 is a highly conserved ascaroside isolated from Caenorhabditis elegans.

  

• HY-N9480

  Vinaxanthone	133293-89-7	98.77%
  Vinaxanthone (SM-345431) is a potent and selective semaphorin3A, phospholipase C (PLC) and FabI inhibitor, with IC50s of 0.1-0.2 μM and 0.9 mM for semaphorin3A and FabI. Vinaxanthone inhibits the substrate (t-o-NAC thioester) and the cofactor (NADPH) with Kis of 3.1 μM and 1.0 μM, respectively. Vinaxanthone can be used to handle infections caused by multidrug-resistant pathogens[1][2][3].

  

• HY-Y1093

  Ethyl acetoacetate	141-97-9
  Ethyl acetoacetate (Ethyl acetylacetate) is an ester widely used as an intermediate in the synthesis of many varieties of compounds[1][2][3]. Ethyl acetoacetate is an inhibitor of bacterial biofilm[4].

  

• HY-100528

  Nanchangmycin	65101-87-3
  Nanchangmycin, a polyether antibiotic produced by Streptomyces nanchangensis NS3226, inhibits gram-positive bacteria[1]. Nanchangmycin is a broad spectrum antiviral active against Zika virus[2].

  

• HY-101867

  AU1235	1338780-86-1	99.90%
  AU1235, an adamantyl urea, is a potent MmpL3 inhibitor. The Mycobacterium tuberculosis protein MmpL3 performs an essential role in cell wall synthesis, since it effects the transport of trehalose monomycolates across the inner membrane[1][2].

  

• HY-105231

  Bryostatin 1	83314-01-6
  Bryostatin 1 is a natural macrolide isolated from the bryozoan Bugula neritina and is a potent and central nervous system (CNS)-permeable PKC modulator. Bryostatin 1 binds to the isolated C1 domain of Munc13-1 and the full-length Munc13-1 protein with Kis of 8.07 nM and 0.45 nM, respectively. Bryostatin 1 has anti-cancer, anti-inflammatory, neuroprotective, anti-HIV-1 infection properties[1][2][3][4].

  

• HY-105284

  Sulopenem	120788-07-0	99.70%
  Sulopenem (CP-70429) is an orally active, parenteral penem antibiotic with broad-spectrum activities against Gram-positive and Gram-negative bacteria. Sulopenem has the potential for urinary tract infections and intra-abdominal infections treatment. Sulopenem is inactive against Pseudomonas aeruginosa and Xanthomonas maltophilia[1][2][3].

  

• HY-113291

  5'-Deoxyadenosine	4754-39-6
  5'-Deoxyadenosine is an oxidized nucleoside found in the urine of normal subjects. 5'-Deoxyadenosine shows anti-orthopoxvirus activity[1].

  

• HY-113362

  Petroselinic acid	593-39-5
  Petroselinic acid, a positional isomer of oleic acid, is isolated from the vegetable oil of Coriandrum sativum fruits. Petroselinic acid is used as substrate for sophorolipid fermentation. Petroselinic acid inhibits the biofilm formation in microorganisms, exhibits antibacterial and antifungal activities. Petroselinic acid is orally active[1][2][3][4.

  

• HY-116872

  MAC13772	4871-40-3	99.76%
  MAC13772 is a potent inhibitor of the enzyme BioA (IC50=250 nM), the antepenultimate step in biotin biosynthesis. MAC13772 is a novel antibacterial compound[1].

  

• HY-121477

  Resorantel	20788-07-2	99.80%
  Resorantel is an anthelmintic[1]. Resorantel is used in the research of paramphistomiasis in cattle and sheep and has also been used for the research of G. aegypticus[2].

  

• HY-125254

  LEI110	2313525-90-3	99.72%
  LEI110 is a potent, selective and cell-permeable pan-inhibitor of the HRASLS family of thiol hydrolases. LEI110 inhibits PLA2G16, HRASLS2, RARRES3 and iNAT, with pIC50 values of 7.0, 6.8, 6.8, and 7.6, respectively. LEI110 reduces cellular arachidonic acid levels and oleic acid-induced lipolysis in HepG2 cells[1].

  

• HY-125471

  VK-1727		99.06%
  VK-1727 is a selective small molecule inhibitor of EBNA1. VK-1727 can reduce EBNA1 DNA binding activity. VK-1727 selectively blocks the proliferation and metabolic activity of EBV+ cells, instead of EBV- cells. VK-1727 is used in multiple sclerosis research[1].

  

• HY-128965

  N-Glycolylneuraminic acid	1113-83-3
  N-Glycolylneuraminic acid is a nonhuman sialic acid molecule synthesized in pigs but not in humans. N-Glycolylneuraminic acid works as a decoy receptor of N-Glycolylneuraminic acid-binding influenza A viruses (IAVs)[1].

  

• HY-139411

  White mineral oil	8042-47-5
  White mineral oil is the highly refined mineral oil, and is composed of saturated aliphatic and alicyclic nonpolar hydrocarbons. White mineral oil is biologically and chemically stable, and doesn’t support pathogenic bacterial growth. White mineral oil can resist moisture, extend, soften, smoothen, and lubricate[1].

  

• HY-149906

  Trecovirsen	153021-75-1	98.83%
  Trecovirsen (GEM91) is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.

  

• HY-152219

  CLK1-IN-2	3029431-68-0	98.73%
  CLK1-IN-2 is metabolically stable Clk1 inhibitor. CLK1-IN-2 has selectivity for Clk1 with an IC50 value of 1.7 nM. CLK1-IN-2 can be used for the research of tumour, Duchenne's muscular dystrophy and viral infections such as HIV-1 and influenza[1].

  

• HY-B0187A

  Doripenem monohydrate	364622-82-2	99.91%
  Doripenem (S 4661) monohydrate, a 1β-methyl parenteral carbapenem, has very broad-spectrum activity against Gram-positive and Gram-negative aerobic bacteria[1][2].

  

• HY-B1888A

  Bromfenac sodium	91714-93-1	99.92%
  Bromfenac sodium is a potent and orally active inhibitor of COX, with IC50s of 5.56 and 7.45 nM for COX-1 and COX-2, respectively. Bromfenac sodium can be used in ocular inflammation research[1].

  

• HY-N7114A

  Chloramphenicol succinate sodium	982-57-0
  Chloramphenicol succinate sodium is a proagent of Chloramphenicol, with Haemotoxicity. Chloramphenicol succinate is a competitive substrate and inhibitor of succinate dehydrogenase (SDH) that is the possible reason for its toxicity[1][2][3].

  

• HY-114621A

  DB772 hydrate		99.89%
  DB772 hydrate is a bovine viral diarrhoea virus (BVDV) inhibitor. DB772 also has anti-prion activity[1].

  

• HY-W021040

  Fludioxonil	131341-86-1
  Fludioxonil (CGA-173506) is a phenylpyrrole-type fungicide with oral activity that can inhibit the growth of S. sclerotiorum. Fludioxonil promotes tumor growth and metastasis, and induces cardiac toxicity. Fludioxonil causes cytoskeletal disruption, DNA damage, and apoptosis in mouse glioma cells[1][2][3][4].

  

• HY-B2031

  Pyriproxyfen	95737-68-1	99.00%
  Pyriproxyfen is a juvenile hormone analog, preventing larvae from developing into adulthood and thus rendering them unable to reproduce.

  

• HY-N1434

  Methyl p-coumarate	3943-97-3
  Methyl p-coumarate (Methyl 4-hydroxycinnamate), an orally active esterified derivative of p-Coumaric acid (pCA), can be isolated from the flower of Trixis michuacana var longifolia. Methyl p-coumarate could inhibit the melanin formation in B16 mouse melanoma cells. Methyl p-coumarate also has strong in vitro inhibitory effect on A. alternata and other pathogens[1][2].

  

• HY-108964

  Carvone	99-49-0
  Carvone is a ketone monoterpene found mostly in the essential oils from plants of the genus Mentha. Carvone is widely used in the pharmaceutical industry, cosmetics and agriculture. Carvone has such effects as antimicrobial, antioxidant, anti-inflammatory, antispasmodic, antinociceptive, anticonvulsant[1].

  

• HY-113469

  Cyclic GMP	7665-99-8	99.43%
  Cyclic GMP (cGAMP) is an endogenous second messenger that triggers interferon production in response to cytoplasmic DNA. Cyclic GMP can activate the stimulator of interferon genes (STING), activating the signaling cascade that leads to the production of type I interferons and other immune mediators. Cyclic-GMP-AMP, a conjugate of cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses. cGMP may also activate PDE to degrade cAMP, inhibit myocardial calcium current ICa, and regulate myocardial contractility. The derivative of cyclic GMP (cGMP), 8-Br-cGMP, has antiplatelet activity, and cyclic GMP can be used in the study of antiviral immunity and cardiovascular diseases[1][2][3][4].

  

• HY-B0005A

  Toremifene	89778-26-7	99.86%
  Toremifene (Z-Toremifene) is a second-generation selective estrogen-receptor modulator (SERM) in development for the prevention of osteoporosis. Toremifene also potent inhibits infectious EBOV Zaire and Marburg (MARV) with IC50 of 0.07 µM and 2.6 µM, respectively[1][2].

  

• HY-18649

  Galidesivir hydrochloride	222631-44-9	99.89%
  Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM[1][2][3].

  

• HY-117684

  Cabamiquine	1469439-69-7	99.93%
  Cabamiquine (DDD107498) is a potent and orally active antimalarial agent, inhibits multiple life-cycle stages of the parasite, with an EC50 of 1 nM against P. falciparum 3D7. Cabamiquine inhibits protein synthesis by targeting eEF2/CaMKIII, with an EC50 of 2 nM for WT-PfeEF2[1].

  

• HY-18351

  Indotecan	915303-09-2
  Indotecan (LMP-400), an indenoisoquinoline derivative, is a potent Topoisomerase I inhibitor, with IC50s of 300, 1200, 560 nM for P388, HCT116, MCF-7 cell lines, respectively. Indotecan prevents the relaxation of supercoiled DNA and can be used for the research of visceral leishmaniasis[1][2].

  

• HY-N0106

  (Rac)-Salvianic acid A sodium	67920-52-9
  (Rac)-Salvianic acid A sodium is the racemic form of Salvianic acid A (HY-N1913). Salvianic acid A is an orally active phenolic compound that induces Nrf2/HO-1 activation and inhibits the NF-κB pathway, and it also activates the mitochondrial antioxidant defense system (Mitochondrial Metabolism). Salvianic acid A exhibits anti-inflammatory, antioxidant, and anti-apoptotic properties (Apoptosis), demonstrating potential for research into inflammation and cardiovascular diseases[1][2][3][4][5][6][7].

  

• HY-15440A

  Fostemsavir	864953-29-7	99.52%
  Fostemsavir (BMS-663068) is the phosphonooxymethyl prodrug of BMS-626529. Fostemsavir (BMS-663068) is a novel attachment inhibitor that targets HIV-1 gp120 and prevents its binding to CD4+ T cells.

  

• HY-P0282A

  TAT peptide TFA		99.65%
  TAT peptide (TFA) is a cell penetrating peptide (GRKKRRQRRRPQ) derived from the trans-activating transcriptional activator (Tat) from HIV-1[1][2].

  

• HY-10870

  RO-9187	876708-03-1
  RO-9187 is a potent inhibitor of HCV virus replication with an IC50 of 171 nM. RO-9187 is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-13337

  BMS-986094	1234490-83-5	99.88%
  BMS-986094 (INX-08189) is a potent inhibitor of hepatitis C virus (HCV) replication, with an EC50 of 35 nM at 24 h in Huh-7 cells. BMS-986094 is a phosphoramidate proagent of 6-O-methyl-2’-C-methyl guanosine. BMS-986094 can be used for the research of chronic HCV infection[1][2].

  

• HY-15997

  (-)-U-50488 hydrochloride	114528-79-9
  (-)-U-50488 hydrochloride ((-)-Trans-(1S,2S)-U-50488 hydrochloride) is a selective kappa-opioid receptor (KOR) agonist (b>Kd=2.2 nM) over μ-opioid receptor (MOR) (b>Kd=430 nM). (-)-U-50488 hydrochloride is a more active enantiomer than (+)?trans-(1R,2R) U-50488 (HY-15997A)?or the (±)?trans-racemic mixture U-50488 (HY-15997B). (-)-U-50488 hydrochloride has a potent and sustained anti-HIV effect in fected blood monocyte-derived macrophages (MDM)[1].

  

• HY-17598

  Rafoxanide	22662-39-1
  Rafoxanide is a poent, orally active halogenated salicylaniline agent with antiparasitic activity. Rafoxanide interferes with energy metabolism in trematodes by uncoupling oxidative phosphorylation. Rafoxanide is also found to be a potent inhibitor of the BRAF V600E mutant protein, which is important in colorectal cancer. Rafoxanide can be used for the control of infestation with Hemonchus species or Fasciola species in sheep and cattle as well as Oestrus ovis in sheep. Rafoxanide can also be used for cancer research[1][2][3].

  

• HY-141882

  DC-LC3in-D5	2868312-73-4	98.62%
  DC-LC3in-D5 acts as an autophagy inhibitor by attenuating LC3B lipidation. DC-LC3in-D5 binds with LC3B. DC-LC3in-D5 disrupts the LC3B-LBP2 interaction with an IC50 of 200 nM. DC-LC3in-D5 may contribute to anti-HCV or combination researchs in cancer through inhibiting autophagy[1].

  

• HY-153228

  Pomotrelvir	2713437-86-4
  Pomotrelvir (PBI-0451) is a selective, orally active SARS-CoV-2 3CL protease inhibitor. Pomotrelvir has antiviral activity and can be used in the research of novel coronavirus (COVID-19)[1].

  

• HY-P99252

  Itolizumab	1116433-11-4
  Itolizumab (Anti-Human CD6 Recombinant Antibody) is a humanized recombinant anti-CD6 monoclonal antibody (MAb) targeting the extracellular SRCR distal domain 1 of CD6. Itolizumab reduces T-cell proliferation and inhibits the production of pro-inflammatory cytokines, such as INF-γ, TNFα and IL-6. Itolizumab can be used in the research of psoriasis, rheumatoid arthritis (RA), COVID-19[1][2][3].

  

• HY-P99556

  Tixagevimab	2420564-02-7
  Tixagevimab (AZD8895) is a human monoclonal antibody that targets the SARS-CoV-2 receptor binding domain (RBD). It exhibits neutralizing activity against SARS-CoV-2 by binding to the RBD and the S-glycoprotein ectodomain and blocking S-glycoprotein-mediated binding to the receptor[1].

  

• HY-P99804

  Clesrovimab	2429913-18-6	99.62%
  Clesrovimab (MK1654) is a humanized IgG1 monoclonal antibody against the protein F of respiratory syncytial virus (RSV) with an extended half-life. Clesrovimab can bind to the conserved site IV of the RSV F glycoprotein and neutralize various strains containing RSV F. Clesrovimab can be used in the research of RSV diseases[1][2][3].

  

• HY-P99853

  Diridavumab	1393659-46-5	98.09%
  Diridavumab is a monoclonal anti-HA stalk antibody. Diridavumab stabilizes the prefusion HA structure and prevents pH-dependent fusion of cellular and viral membranes in endosomes. Diridavumab can be used in research of H2 influenza virus[1].

  

• HY-76200S

  Voriconazole-d3	1217661-14-7
  Voriconazole-d3 is the deuterium labeled Voriconazole. Voriconazole (UK-109496) is a second-generation, broad-spectrum triazole antifungal agent that inhibits fungal ergosterol biosynthesis. Voriconazole exerts its antifungal activity by inhibition of 14-α-lanosterol demethylation, which is mediated by fungal cytochrome P450 enzymes[1][2].

  

• HY-12820

  Sibofimloc	1616113-45-1	99.70%
  Sibofimloc (Antibiotic-202) is a first-in-class, gut-restricted, orally active FimH adhesion inhibitor extracted from patent WO2014100158A1, Compound Example 202. Sibofimloc has anti-bacterial infective activity. Sibofimloc is developed for inflammatory bowel disease (IBD)[1][2].

  

• HY-18702

  Targocil	1200443-21-5	98.84%
  Targocil functions as a bacteriostatic inhibitor of wall teichoic acid (WTA) biosynthesis which can inhibit the growth of methicillin-susceptible S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA) with MIC90s of 2 μg/ mL for both MRSA and MSSA.

  

• HY-19806

  Ceftolozane	689293-68-3
  Ceftolozane (CXA-101 free base; FR264205 free base) is a cephalosporin antibiotic with potent activity againstPseudomonas aeruginosa and strains Enterobacteriaceae, with MICs of 0.5 and 0.25-0.5 mg/L[1].

  

• HY-75247

  Coumaran	496-16-2
  Coumaran (2,3-Dihydrobenzofuran) is an AChE inhibitor with antileishmanial activity. Coumaran may acquire antiparasitic capabilities through activation of macrophages and exert immunomodulatory activity. Coumaran can be used as a biopesticide.[2].

  

• HY-B0175

  Toltrazuril	69004-03-1	99.64%
  Toltrazuril (BAY-i 9142) is an antiprotozoal agent that acts upon Coccidia parasites.

  

• HY-B0770

  Artemotil	75887-54-6
  Artemotil (β-Arteether) has antimalarial activity for the treatment of chloroquine-resistant Plasmodium falciparum malaria with an IC50 of 1.61 nM. Artemotil also has central nervous system (CNS) neurotoxicity and anorectic toxicity in rats, dogs and monkeys[1][2].

  

• HY-B0817

  Pyridaben	96489-71-3	99.27%
  Pyridaben is a mitochondrial electron transport inhibitor (METI) acaricide that promotes the formation of damaging oxygen and nitrogen radicals. Pyridaben selectively inhibits complex I (NADH dehydrogenase) with an IC50 value of 2.4 nM (assay sites: rat liver and bovine heart mitochondria). Pyridaben also significantly inhibits rat mitochondrial mtNOS function[1][2].

  

• HY-B0850

  Difenoconazole	119446-68-3	99.93%
  Difenoconazole is a sterol demethylation inhibitor, as a fungicide. Difenoconazole binds the heme portion of the fungal cytochrome P450 51, interferes the mycelial growth and inhibits the spore germination of pathogens, suppressing fungal growth[1].

  

• HY-B0883

  Proflavine hemisulfate	1811-28-5	98.45%
  Proflavine hemisulfate, an acridine dye, is a known DNA intercalating agent. Anti-microbial agent[1]. Proflavine hemisulfate behaves as a pore blocker for Kir3.2. Proflavine hemisulfate is a potential lead compound for Kir3.2-associated neurological diseases[2].

  

• HY-B1198

  Piperonyl butoxide	51-03-6
  Piperonyl butoxide (ENT-14250) is a pesticide synergist and food additive. Piperonyl butoxide has adverse effects on reproduction, development and behavior in mice. Piperonyl butoxide can activate c-Jun and ATF-2 in mouse hepatocytes. Piperonyl butoxide is a liver cancer carcinogen in rats and mice[1][2][3].

  

• HY-B1761

  Santonin	481-06-1	99.85%
  Santonin is an active principle of the plant Artemisia cina, which is formely used to treat worms[1].

  

• HY-B2060

  Tiamulin	55297-95-5
  Tiamulin (Thiamutilin) is a diterpenic antibiotic that is widely used in pigs and poultry for the control of infectious diseases. Tiamulin is effectively used in the study of airsacculitis, which is primarily caused by Mycoplasma spp[1].

  

• HY-N0084

  Betulinaldehyde	13159-28-9
  Betulinaldehyde (Betunal) Has anti-cancer and anti-staphylococcus aureus activity. Betulinaldehyde Suppressible Akt, MAPK sum STAT3 Signal path, increase self-transfer, Suppression A549 Cellular vitality, increase and transfer. Betulinaldehyde suppresses PLCγ1/Ca2+/MMP9 signal pathway, has a key effect on vascular plasticity, and is available for cardiovascular disease (CVD) research.

  

• HY-N1458

  Isoschaftoside	52012-29-0
  Isoschaftoside, a C-glycosylflavonoid from Desmodium uncinatum root exudate, can inhibit the growth of germinated S. hermonthica radicles. Isoschaftoside reduces reactive oxygen species (ROS) and induces proliferation in senescent cells. Isoschaftoside activates autophagy. Isoschaftoside can be used for anti-tumor, anti-inflammatory, antioxidant, antihypertensive, hepatoprotective and nematicidal study[1][2][3][4][5][6].

  

• HY-N2071

  Cedrol	77-53-2	99.76%
  Cedrol is a potent competitive inhibitor of cytochrome P-450(CYP) enzyme. Cedrol plays an anticancer role by inducing cell cycle arrest and Caspase-dependent apoptosis. Cedrol acts as a neutrophil agonist that can desensitize cells to subsequent stimulation of N-formyl peptides. Cedrol prevents neuropathic pain caused by chronic contractile injury by inhibiting oxidative stress and inflammation. In addition, Cedrol has antibacterial, hair loss prevention and anti-anxiety properties[1][2][3][4][5][6][7].

  

• HY-N2575

  Hypocrellin A	77029-83-5	99.73%
  Hypocrellin A is a PKC inhibitor that exerts antidiabetic activity by reversing the effects of high glucose on endothelin (ET-1) expression. Hypocrellin A is also a photosensitizer for photodynamic therapy (PDT) with anticancer, antibacterial and antiviral activities, especially against human immunodeficiency virus (HIV). In addition, Hypocrellin-A also possesses anti-Leishmania activity (IC50=0.27 μg/ml)[1][2][3][4][5][6][7][8][9].

  

• HY-N4104

  Agaric acid	666-99-9
  Agaric acid (Agaricinic Acid) is an orally active inhibitor of adenine nucleotide translocase found in specific fungi. Agaric acid can inhibit the biofilm formation of various bacteria such as Salmonella. Agaric acid can also induce mitochondrial permeability transition, prompting mitochondria to release Ca2+, disrupting the transmembrane potential, and causing mitochondrial swelling. In addition, Agaric acid can also inhibit citrate transport in liver mitochondria and participate in the inhibition of fatty acid synthesis, affecting multiple metabolic processes[1][2][3][4].

  

• HY-N4136

  Lonicerin	25694-72-8
  Lonicerin (Veronicastroside) is a flavonoid with multiple biological activities. Lonicerin inhibits xanthine oxidase with an IC50 of 37.4 µg/mL. Lonicerin inhibits alginate secretion protein (AlgE). Lonicerin inhibits P. aeruginosa and C. albicans. Lonicerin has anti-inflammatory, anti-arthritic, antioxidant, antifungal, anti-bacterial, and neuroprotective properties[1][2][3].

  

• HY-N6686

  Virginiamycin M1	21411-53-0	99.50%
  Virginiamycin M1 (Pristinamycin IIA; Ostreogrycin A), produced by Streptomyces virginiae, is an polyunsaturated macrocyclic lactone antibiotic and acts as a component of Virginiamycin (HY-112665)[1]. Virginiamycin M1 alone is against Staphylococcus aureus with a MIC of 0.25 μg/mL.

  

• HY-N6869

  Dehydroabietic acid	1740-19-8	99.75%
  Dehydroabietic acid is a diterpene resin acid that can be isolated from Pinus and Picea. Dehydroabietic acid has anti-bacterial, anti-fungal, anti-inflammatory, and anticancer activities. Dehydroabietic acid is a dual PPAR-α/γ agonist and PPAR-γ partial agonist, which can attenuate insulin resistance (IR) and hepatic steatosis induced by HFD-consumption in mice[1][2].

  

• HY-N7112

  Leucomycin	1392-21-8
  Leucomycin (Kitasamycin) is an orally active macrolide antibiotic produced by Streptomyces kitasatoensis. Leucomycin has broad-spectrum antibacterial activities against gram-positive and gram-negative bacteria, mycoplasma, leptospira, spirochaetes, rickettsiae and some larger viruses[1][2][3][4][5][6][7].

  

• HY-N7151

  Aurachin D	108354-13-8	99.62%
  Aurachin D is an antibiotic. Aurachin D inhibits Gram-positive bacteria and a few funguses. Aurachin D blocks NADH oxidation in beef heart submitochondrial particles[1].

  

• HY-N7266

  Obtusifoliol	16910-32-0
  Obtusifoliol is a specific CYP51 inhibitor, Obtusifoliol shows the affinity with Kd values of 1.2 μM and 1.4 μM for Trypanosoma brucei (TB) and human CYP51, respectively[1].

  

• HY-N9448

  Lacto-N-tetraose	14116-68-8
  Lacto-N-tetraose is the significant core structure of human milk oligosaccharides (HMOs) naturally existing in human milk. Lacto-N-tetraose is consist of galactose, N-acetylglucosamine, and glucose moieties. Lacto-N-tetraose has prebiotic effect, immune regulatory effect, anti-inflammatory effects, intestinal cell responses regulatory effect, antibacterial activity and antiviral activity. Lacto-N-tetraose has been widely added to infant formula[1].

  

• HY-100358

  AQ-13 dihydrochloride	169815-40-1	98.08%
  AQ-13 dihydrochloride is an aminoquinoline antimalarial agent that is effective against drug-resistant strains of Plasmodium falciparum.

  

• HY-101293

  VU0359595	1246303-14-9	98.06%
  VU0359595 (CID-53361951; ML-270) is a potent and selective pharmacological phospholipase D1 (PLD1) inhibitor with an IC50 of 3.7 nM. VU0359595 is >1700-fold selective for PLD1 over PLD2 (IC50 of 6.4 μM). VU0359595 can be used for the research of cancer, diabetes, neurodegenerative and inflammatory diseases[1][2][3][4].

  

• HY-10394S

  Linezolid-d3	1127120-38-0	99.80%
  Linezolid-d3 is a deuterium labeled Linezolid (PNU-100766). Linezolid is a synthetic antibiotic that acts by inhibiting the initiation of bacterial protein synthesis[1].

  

• HY-106662

  Chloroquinoxaline sulfonamide	97919-22-7	99.06%
  Chloroquinoxaline sulfonamide (Chloroquinoxaline), a structural analogue of sulfaquinoxaline, is a topoisomerase II alpha/beta poison. Chloroquinoxaline sulfonamide is used to control coccidiosis in poultry, rabbit, sheep, and cattle[1]. Antitumor activity[2].

  

• HY-118131

  PKR-IN-C51	1314594-23-4	99.79%
  PKR-IN-C51(compound 51) is an ATP-competitive double-stranded RNA-activated protein kinase (PKR) inhibitor with an IC50 of 9 μM. PKR-IN-C51 inhibits intracellular PKR activation in a dose-dependent manner in primary mouse macrophages[1].

  

• HY-120852

  JG26	1464910-32-4	98.01%
  JG26 is an ADAM inhibitor with IC50 values of 12 nM, 1.9 nM, and 150 nM for ADAM8, ADAM17, and ADAM10, respectively. JG26 inhibits MMP-12 with an IC50 value of 9.4 nM. JG26 inhibits AngII (HY-13948)-induced EGFR transactivation and ERK activation. JG26 increases the expression of ACE2, inhibits the cleavage of CD23, reduces the infection of SARS-CoV-2. JG26 inhibits colorectal cancer metastasis. JG26 can be used for research on Hodgkin lymphoma and vascular diseases[1][2][3][4][5][6].

  

• HY-125371

  2'-C-Methyladenosine	15397-12-3	99.50%
  2'-C-Methyladenosine is an inhibitor of hepatitis C virus (HCV) replication. 2'-C-Methyladenosine inhibits HCV replicon and NS5B-catalyzed RNA synthesis with IC50 values of 0.3μM and 1.9 μM, respectively. 2'-C-Methyladenosine also potently inhibits LRV1 in Leishmania guyanensis (Lgy) and Leishmania braziliensis[1][2].

  

• HY-12784A

  Cycloguanil hydrochloride	152-53-4	99.93%
  Cycloguanil hydrochloride, the active metabolite of Proguanil, acts on malaria schizonts in erythrocytes and hepatocytes[1].

  

• HY-129042

  Cibacron Blue 3G-A	84166-13-2
  Cibacron Blue 3G-A is an anthraquinone dye, inhibits the R46 β-lactamase with a Ki value of 1.2 uM[1].

  

• HY-137371

  Lactonic sophorolipid	148409-20-5
  Lactonic sophorolipid is a natural antimicrobial surfactant for oral hygiene[1]. Lactonic sophorolipid, a potential anticancer agent, induces apoptosis in human HepG2 cells through the caspase-3 pathway[1].

  

• HY-13858A

  Sarecycline hydrochloride	1035979-44-2	99.27%
  Sarecycline hydrochloride is an orally active narrow-spectrum tetracycline derivative antibiotic. Sarecycline hydrochloride has anti-inflammatory activity. Sarecycline hydrochloride inhibits the activity of Gram-positive bacteria and several types of keratobacterium acnes. Sarecycline hydrochloride interferes with tRNA accommodation and tethers mRNA to the 70S ribosome. Sarecycline hydrochloride can be used to study moderate to severe acne [1][2][3][4][5][6].

  

• HY-152956

  STING agonist-23	2361570-16-1	99.16%
  STING agonist-23 (CF502) is a non-nucleotide small-molecule STING agonist. STING agonist-23 activates STING, increases phosphorylation of STING, TBK1 and IRF3. STING agonist-23 promotes the levels of IFN-β, IL-6, CXCL-10, TNF-α, ISG-15, and CCL-5 in tumor cells. STING agonist-23 exhibits activity against SARS-CoV series strains[1].

  

• HY-16561A

  cis-Resveratrol	61434-67-1	98.79%
  cis-Resveratrol exhibits signifcant antiviral activity. cis-Resveratrol inhibits enteroviruses with IC50s of 12.2 µM and 37.6 µM for coxsackievirus B3 (CVB3) and enterovirus 71 (EV71), respectively. cis-Resveratrol is the inhibitor for NF-κB signaling pathway[1][2].

  

• HY-17589R

  Chloroquine (phosphate) (Standard)	50-63-5	99.67%
  Chloroquine (phosphate) (Standard) is the analytical standard of Chloroquine (phosphate). This product is intended for research and analytical applications. Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].

  

• HY-A0148A

  Halofantrine hydrochloride	36167-63-2
  Halofantrine hydrochloride (SKF-102886) is a blocker of delayed rectifier potassium current via the inhibition of human-ether-a-go-go-related gene (HERG) channel and a potent antimalarial compound[1][2].

  

• HY-B0736A

  Sertaconazole nitrate	99592-39-9	99.19%
  Sertaconazole nitrate (FI7056) is a broad-spectrum topical antifungal agent, exhibits anti-inflammatory activity via activation of a p38-COX-2-PGE2 pathway. Sertaconazole nitrate is also a microtubule inhibitor, shows antiproliferative effect, induces apoptosis and autophagy, and can also inhibit the migration of cells[1][2][3][4].

  

• HY-B0810A

  Pivmecillinam hydrochloride	32887-03-9	99.19%
  Pivmecillinam hydrochloride (FL-1039 hydrochloride) is an orally active proagent of mecillinam, an extended-spectrum penicillin antibiotic.

  

• HY-B1355A

  Oxyphenbutazone	129-20-4
  Oxyphenbutazone is a Phenylbutazone (HY-B0230) metabolite, with anti-inflammatory effect. Oxyphenbutazone is an orally active non-selective COX inhibitor. Oxyphenbutazone selectively kills non-replicating Mycobaterium tuberculosis[1][2].

  

• HY-B2072A

  Cephaloridine hydrate	102039-86-1	99.79%
  Cephaloridine hydrate is a broad-spectrum antibacterial antibiotic. Cephaloridine has certain dose-related nephrotoxicity[1][2].

  

• HY-N0216S

  Benzoic acid-d5	1079-02-3	99.16%
  Benzoic acid-d5 is a deuterium substitute for Benzoic acid. Benzoic acid is an aromatic alcohol that occurs naturally in many plants and is a common additive in food, beverages, cosmetics and other products. Benzoic acid can act as a preservative by inhibiting bacteria and fungi[1][2].

  

• HY-N0656A

  (+)-Usnic acid	7562-61-0
  (+)-Usnic acid is isolated from isolated from lichens, binds at the ATP-binding pocket of mTOR, and inhibits mTORC1/2 activity. (+)-Usnic acid inhibits the phosphorylation of mTOR downstream effectors: Akt (Ser473), 4EBP1, S6K, induces autophay, with anti-cancer and anti-inflammatory activity. (+)-Usnic acid possesses antimicrobial activity against a number of planktonic gram-positive bacteria, including Staphylococcus aureus, Enterococcus faecalis, and Enterococcus faecium[1][2][3].

  

• HY-N0926A

  Columbamine chloride	1916-10-5	98.63%
  Columbamine (Columbamin; Dehydroisocorypalmine) chloride is an organic heterotetracyclic alkaloid extracted from plants. Columbamine chloride is a metabolite of Berberine (HY-N0716). Columbamine chloride inhibits the cytochrome P450 (CYP) isoform CYP3A4 (IC50 = 30.6 µM). Columbamine chloride induces apoptosis in cancer cells. Columbamine chloride can be used for antioxidant, anti-inflammatory, antitumor, antifungal, antiparasite, hepatoprotective, neuroprotective, hypolipidemic and hypoglycemic study[1][2][3][4][5][6].

  

• HY-139165A

  AT-9010 tetrasodium	1621884-18-1	99.74%
  AT-9010 tetrasodium, a triphosphate active metabolite of AT-527, is a potent inhibitor of NiRAN (a function essential for viral replication). AT-9010 tetrasodium can inhibit SARS-CoV-2 replication[1].

  

• HY-N0470S3

  L-Lysine-13C6,15N2 hydrochloride	1200447-00-2
  L-Lysine-13C6,15N2 (hydrochloride) is the 13C- and 15N-labeled L-Lysine hydrochloride. L-lysine hydrochloride is an essential amino acid for humans with various benefits including treating herpes, increasing calcium absorption, reducing diabetes-related illnesses and improving gut health.

  

• HY-W012788

  Maltol	118-71-8
  Maltol, a type of aromatic compound, is an antioxidant agent. Maltol enhances neural function by mitigating oxidative stress and cell apoptosis. Maltol is an inhibitor of oxidative damage in nerve cells and is effective in preventing diabetic peripheral neuropathy (DPN). Maltol is used extensively as a safe flavoring agent and food preservative. Maltol is a metal ion chelator that can be used in the field of catalysis, cosmetics, and medicine[1][2].

  

• HY-W017212

  Methyl cinnamate	103-26-4	99.47%
  Methyl cinnamate (Methyl 3-phenylpropenoate), an active component of Zanthoxylum armatum, is a widely used natural flavor compound. Methyl cinnamate (Methyl 3-phenylpropenoate) possesses antimicrobial activity and is a tyrosinase inhibitor that can prevent food browning. Methyl cinnamate (Methyl 3-phenylpropenoate) has antiadipogenic activity through mechanisms mediated, in part, by the CaMKK2-AMPK signaling pathway[1].

  

• HY-B1467

  Domiphen bromide	538-71-6	99.61%
  Domiphen bromide is a cationic active quaternary ammonium salt and also an inhibitor of HERG channels (IC50: 9 nM), aminopeptidase-like enzymes, Escherichia coli alkaline phosphatase, and α-chymotrypsin. Domiphen bromide has multiple activities such as antibacterial, antimalarial, and disinfectant properties, and it is also a synergist of Colistin (HY-113678). Domiphen bromide can be used as a chemical preservative and a cationic surfactant, and it can also be used in the research of bacterial infectious diseases such as pharyngitis, thrush, and oral ulcers[1][2][3][4][5].

  

• HY-W007771

  Acridone	578-95-0	99.96%
  Acridone is an organic compound based on the acridine skeleton. Acridone has antibacterial, antimalarial, antiviral and anti neoplastic activities[1].

  

• HY-12903

  Macozinone	1377239-83-2	98.46%
  Macozinone (PBTZ169) is a bactericidal benzothiazinone and a potent DprE1 (decaprenylphosphoryl-β-d-ribose 2′-oxidase) inhibitor. Macozinone inhibits the essential flavoprotein DprE1 by forming a covalent bond with the active-site Cys387 residue. Macozinone has antituberculosis effect[1][2].

  

• HY-14879

  Avibactam free acid	1192500-31-4
  Avibactam (NXL-104) free acid is a covalent and reversible non-β-lactam β-lactamase inhibitor which inhibits β-lactamase TEM-1 and CTX-M-15 with IC50s of 8 nM and 5 nM, respectively[1].

  

• HY-17589B

  Chloroquine dihydrochloride	3545-67-3	99.10%
  Chloroquine dihydrochloride is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine dihydrochloride is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine dihydrochloride is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].

  

• HY-12993

  RSV604	676128-63-5	99.92%
  RSV604 (A-60444) is an inhibitor of respiratory syncytial virus (RSV) replication. RSV604 targets the nucleocapsid protein, with a Kd of 1.6 μM. RSV604 displays submicromolar activity against numerous clinical isolates of both the A and B subtypes of RSV (average EC50s=0.8 μM)[1][2].

  

• HY-A0241

  Dalfopristin	112362-50-2	99.67%
  Dalfopristin (RP54476) is a semisynthetic sulfone antibiotic. Dalfopristin alone has limited antibacterial activity, but synergistically with Quinupristin it has significant bactericidal activity against many pathogenic Gram-positive cocci[1].

  

• HY-B1907

  Rifamycin sodium	14897-39-3	99.56%
  Rifamycin sodium (Rifamycin SV monosodium) is an orally active ansamycin antibiotic. Rifamycin sodium inhibits DNA-dependent RNA synthesis. Rifamycin sodium has antibacterial activity against Mycobacterium tuberculosis. Rifamycin sodium interferes with hepatic bile acid metabolism. Rifamycin sodium has anti-inflammatory effects. Rifamycin sodium can be used in the study of Mycobacterium tuberculosis, Bacteroides fragilis infection, and Lipopolysaccharide (HY-D1056B3)-induced inflammation[1][2][3][4][5][6][7][8][9][10][11].

  

• HY-G0021

  N-Desmethylclozapine	6104-71-8	98.99%
  N-Desmethylclozapine is a major active metabolite of the atypical antipsychotic agent Clozapine. N-Desmethylclozapine is a potent, allosteric and partial M1 receptors agonist (EC50=115 nM) and is able to potentiate hippocampal N-methyl-d-aspartate (NMDA) receptor currents through M1 receptor activation. N-Desmethylclozapine is also a δ-opioid agonist[1][2].

  

• HY-111747

  TBAJ-587	2252316-16-6	98.01%
  TBAJ-587, a potent anti-tuberculosis agent, inhibits M.tb strain H37Rv growth with MIC90s of 0.006 and <0.02 μg/mL in MABA and LORA assay, respectively. TBAJ-587 inhibits hERG channel minimally, attenuates inhibition of the cardiac potassium channel protein coded by the hERG, which is important for cardiac repolarization[1].

  

• HY-121832

  DDX3-IN-1	1919828-83-3	99.67%
  DDX3-IN-1 (Compound 16f) is the inhibitor for DEAD box polypeptide 3 (DDX3) with an IC50 >100 μM. DDX3-IN-1 exhibits antiviral activity against HIV and HCV[1].

  

• HY-12648A

  FASN-IN-4 tosylate	2095432-57-6	98.55%
  FASN-IN-4 tosylate is a potent inhibitor of fatty acid synthase (FASN) with an IC50 of 10 nM (WO2012064642A1, compound 29)[1]. FASN-IN-4 tosylate also inhibits SARS-CoV-2 with an EC50 of 18.6?nM[2].

  

• HY-14860A

  1-Deoxynojirimycin hydrochloride	73285-50-4
  1-Deoxynojirimycin hydrochloride (Duvoglustat hydrochloride) is a potent and orally active α-glucosidase inhibitor. 1-Deoxynojirimycin hydrochloride suppresses postprandial blood glucose and is widely used for diabetes mellitus. 1-Deoxynojirimycin hydrochloride possesses antihyperglycemic, anti-obesity, and antiviral features[1][2].

  

• HY-B1256A

  Cefuroxime	55268-75-2
  Cefuroxime is an orally active second-generation cephalosporin antibiotic with increased stability to β-lactamase. Cefuroxime has a broad spectrum activity against Gram-positive and Gram-negative bacteria[1].

  

• HY-A0251

  Cefpodoxime	80210-62-4	98.75%
  Cefpodoxime (Cefpodoxime acid) is a potent antibiotic active against gram-positive and gram-negative bacteria. Cefpodoxime inhibits the majority of cells in microbial populations. Cefpodoxime can be used for acute otitis media, sinusitis and tosillopharyngitis research[1][2].

  

• HY-137958

  Bemnifosbuvir hemisulfate	2241337-84-6	99.38%
  Bemnifosbuvir hemisulfate (AT-527), a hemisulfate salt of AT-511, a guanosine nucleotide proagent, is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir hemisulfate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir hemisulfate has pangenotypic antiviral activity[1][2][3].

  

• HY-139481

  TL-895	1415823-49-2	99.86%
  TL-895 is a potent, orally active, ATP-competitive, and highly selective irreversible BTK inhibitor with an IC50 and a Ki of 1.5 nM and 11.9 nM, respectively[1]. TL-895 is used be for JAKi-relapsed/refractory myelofibrosis, acute myeloid leukemia, COVID-19 and cancer research[2][3][4].

  

• HY-147017

  GSK2556286	1210456-20-4	99.70%
  GSK2556286 (GSK286) is an orally active and cholesterol-dependent Mycobacterium tuberculosis inhibitor. GSK2556286 inhibits Mycobacterium tuberculosis inside infected macrophages (IC50 = 0.07 μM in THP-1 cells), in the presence of cholesterol. GSK2556286 acts via Rv1625c, a membrane-bound adenylyl cyclase in Mycobacterium tuberculosis. GSK2556286 is an Rv1625 agonist leading to increased cAMP and reduced cholesterol metabolism. GSK2556286 can be studied in research for antitubercular purposes[1][2][3].

  

• HY-147416

  Vipoglanstat	1360622-01-0	99.74%
  Vipoglanstat (BI 1029539), a carboxamide, is a potent and selective, non-peptide and orally active small molecular inhibitor of human prostaglandin E synthase 1 (mPGES-1). Vipoglanstat also has anti-inflammatory activity[1][2].

  

• HY-19519A

  Ladarixin sodium	865625-56-5	99.84%
  Ladarixin sodium (DF 2156A) is an orally active, allosteric non-competitive and dual CXCR1 and CXCR2 antagonist. Ladarixin sodium can be used for the research of COPD and asthma[1].

  

• HY-B0200B

  Cephalexin monohydrate	23325-78-2
  Cephalexin (Cefalexin) monohydrate is a potent, orally active new semisynthetic cephalosporin antibiotic with a broad antibacterial spectrum. Cephalexin (Cefalexin) monohydrate has antibacterial activity against a wide variety of gram-positive and gram-negative bacteria. Cephalexin (Cefalexin) monohydrate targets penicillin-binding proteins (PBPs) to inhibit bacterial cell wall assembly. Cephalexin (Cefalexin) monohydrate is used for the research of pneumonia, strep throat, and bacterial endocarditis, et al[1][2].

  

• HY-B0734A

  Cefotiam hydrochloride	66309-69-1
  Cefotiam (SCE-963) hydrochloride is a parenteral cephalosporin antibiotic. Cefotiam hydrochloride has broad-spectrum activity against Gram-positive and Gram-negative bacteria[1][2].

  

• HY-P99181

  Mupadolimab	2451856-97-4	99.43%
  Mupadolimab (CPI-006) is an IgG1κ humanized FcγR binding-deficient anti-CD73 monoclonal antibody (mAb) that activates CD73POS B cells[1].

  

• HY-P99342

  Imdevimab	2415933-40-1
  Imdevimab (REGN10987) is a human monoclonal antibody to target SARS-CoV-2 virus, which causes COVID-19. Imdevimab lacks efficacy against COVID-19 variants. Imdevimab can be used in combination with Casirivimab (HY-P99341), it reduces viral load and improves diseases[1].

  

• HY-P99344

  Bamlanivimab	2423943-37-5	99.97%
  Bamlanivimab (Anti-Human SARS-CoV-2) is the first COVID-19 monoclonal antibody (mAb) to be granted Emergency Use Authorization (EUA) in November 2020 by the U.S. Food and agent Administration (FDA). However, Bamlanivimab is withdrawn in April 2021 following the rise of SARS-CoV-2 virus variants resistant to Bamlanivimab[1].

  

• HY-19333

  OG-L002	1357302-64-7	99.81%
  OG-L002 is a potent and highly selective LSD1 inhibitor with an IC50 of 0.02 μM. OG-L002 is a potent monoamine oxidases (MAO) inhibitor with IC50s of 1.38 μM and 0.72 μM for MAO-A and MAO-B, respectively. OG-L002 potently inhibits the expression of HSV IE genes[1].

  

• HY-B0148

  Risedronic acid	105462-24-6
  Risedronic acid (Risedronate) is a bisphosphonate and potent antiresorptive agent. Risedronic acid induces Apoptosis. Risedronic acid inhibits the transfer of farnesyl pyrophosphate groups to parasite proteins. Risedronic acid inhibits osteoclast-mediated bone resorption and alters bone metabolism. Risedronic acid inhibits blood-stage Plasmodium falciparum (IC50 of 20.3 μM)[1][2][3].

  

• HY-B0226

  Nitrofurazone	59-87-0	99.86%
  Nitrofurazone (Nitrofural) is a broad spectrum antibiotic that has oral activity. Nitrofurazone is a nitro-aromatic drug. Nitrofurazone is active against both Gram-positive and Gram-negative bacteria[1][2][3][4][5].

  

• HY-B0242

  Sulfanilamide	63-74-1	99.93%
  ulfanilamide (Sulphanilamide) is a potent and orally active sulfonamide antibiotic and can be a major intermediate of sulfamethoxazole biodegradation. Sulfanilamide also is a carbonic anhydrase inhibitor. Sulfanilamide shows inhibition on virus of lymphogranuloma venereum[1][2][3][4].

  

• HY-B0278

  Bacitracin Zinc	1405-89-6	98.76%
  Bacitracin Zinc is a complex formed by the binding of Bacitracin (HY-107193) with zinc ions. Bacitracin Zinc is an orally active polypeptide antibiotic with bactericidal properties. Bacitracin Zinc can cause DNA and deoxyribose damage, as well as improve the gut microbiota of broiler and beef cattle[1][2].

  

• HY-B0370

  Tolnaftate	2398-96-1	99.87%
  Tolnaftate (NP-27) is a synthetic thiocarbamate used as an anti-fungal agent. .

  

• HY-B0512

  Sulfamerazine	127-79-7	99.82%
  Sulfamerazine (RP-2632) is a sulfonamide antibacterial.

  

• HY-B0935

  Benzyl benzoate	120-51-4	99.94%
  Benzyl benzoate (Phenylmethyl benzoate) is an orally active anti-scabies agent, acaricide (EC50= 0.06 g/m2) and fungicide. Benzyl benzoate is an angiotensin II (Ang II) inhibitor with antihypertensive effects. Benzyl benzoate can be used in perfumes, pharmaceuticals and the food industry[1][2][3][4][5].

  

• HY-B0978

  Diethyltoluamide	134-62-3	99.69%
  Diethyltoluamide (DEET) is the most common active ingredient in insect repellents. It is intended to provide protection against mosquitoes, ticks, fleas, chiggers, leeches, and many other biting insects. Diethyltoluamide is toxic to hepatocytes and can lead to many physiological, pharmacological, and behavioral abnormalities, particularly motor deficits and learning and memory dysfunction[1][2][3].

  

• HY-B1325

  Cefuroxime axetil	64544-07-6	99.53%
  Cefuroxime axetil is an orally effective broad-spectrum β-lactam antibiotic that targets bacterial penicillin-binding proteins (PBPs, such as PBP3 and PBP1). Cefuroxime axetil inhibits cell wall synthesis, leading to bacterial lysis and death, with a minimum inhibitory concentration (MIC) of 0.12-4 mg/L for non-typeable Haemophilus influenzae (NTHi). Cefuroxime axetil is hydrolyzed by esterase to the active ingredient Cefuroxime (HY-B1256A) after oral absorption. Topical administration of Cefuroxime via bioadhesive nanoparticles (BNPs) can prolong the drug's retention time in the middle ear (≥7 days). Cefuroxime axetil can be used in the study of otitis media (especially NTHi infection). Cefuroxime axetil can achieve precise antibacterial effects through oral or topical nano-delivery systems, reducing systemic exposure and the risk of antibiotic resistance[1][2][3].

  

• HY-B1336

  Furazolidone	67-45-8
  Furazolidone is a monoamine oxidase (MAO) inhibitor with antiproliferative, apoptosis-inducing and differentiation-promoting activities. Furazolidone may inhibit leukemia fusion protein-mediated bone marrow transformation by upregulating the stability of the tumor suppressor protein p53. Furazolidone exhibits anti-leukemic activity in acute myeloid leukemia (AML) cell lines and can be used for anti-AML research[1][2].

  

• HY-B2006

  Fenvalerate	51630-58-1	99.75%
  Fenvalerate is a potent protein phosphatase 2B (calcineurin) inhibitor with an IC50 of 2-4 nM for PP2B-Aα. Fenvalerate is a pyrethroid ester insecticide and acaricide[1].

  

• HY-I0447

  4-Aminosalicylic acid	65-49-6
  4-Aminosalicylic acid is an inhibitor for dihydrofolate reductase (DHFR) and an antituberculous agent. 4-Aminosalicylic acid exhibits anti-inflammatory activity and can be used in research of inflammatory bowel disease (IBD). 4-Aminosalicylic acid is orally active[1][1][3].

  

• HY-N0352

  Tuberostemonine	6879-01-2
  Tuberostemonine, an alkaloid, is an antimalarial agent that targets Plasmodium falciparum ferredoxin-NADP+ reductases (pfFNR)[1].

  

• HY-N1063

  Xanthoxylin	90-24-4	99.84%
  Xanthoxylin (Xanthoxyline) can be isolated from Zanthoxylum simulans. Xanthoxylin has antifungal and antioxidant effects. The MIC of Xanthoxylin against Toxoplasma neonatorum and Aspergillus fumigatus were 50 µg/mL and 75 µg/mL, respectively. Xanthoxylin can be used in the study of anti-epileptic diseases[1][2][3].

  

• HY-N2040

  (20R)-Protopanaxadiol	7755-01-3
  (20R)-Protopanaxadiol is a triterpenoid saponin metabolite of 20(R)-ginsenoside Rg3 in black ginseng. (20R)-Protopanaxadiol exhibits anti-tumor activity and cytotoxicity, and potently inhibits the growth of Helicobacter pylori[1][2][3].

  

• HY-N2230

  N-p-trans-Coumaroyltyramine	36417-86-4	98.94%
  N-p-trans-Coumaroyltyramine is a natural phenolic amide compound and an inhibitor of AChE (IC50: 122 μM) and α-glucosidase (IC50: 2.7 μM). N-p-trans-Coumaroyltyramine also has anti-trypanosomal activity, with an IC50 of 13.3 µM against T. brucei rhodesiense. N-p-trans-Coumaroyltyramine can be used in the research of diseases such as Alzheimer's disease[1][2][3].

  

• HY-N2253

  Neoruscogenin	17676-33-4	99.24%
  Neoruscogenin, a member of the steroidal sapogenin family, is a high-affinity agonist of the nuclear receptor RORα (NR1F1) (EC50 = 0.11 µM)[1].

  

• HY-N2392

  Kukoamine A	75288-96-9	99.88%
  Kukoamine A is a natural occurring spermine derivative, acts as a potent inhibitor of trypanothione reductase (Ki, 1.8 μM), with antihypertensive activity[1].

  

• HY-N3312

  Matairesinol	580-72-3
  Matairesinol confers anti-allergic effects in an allergic dermatitis mouse model. DfE-induced changes in IL-4 and IFN-γ mRNA expression in the ears of NC/Nga mice were reversed by matairesinol application[1].

  

• HY-N6051

  (-​)​-Maackiain	2035-15-6
  (-)-Maackiain is a pterocarpan phytoalexin produced from Sophora flavescens. (-)-Maackiain is toxic to several genera of fungal pathogens of legume and non legume hosts. (-)-Maackiain enhances the activation of NLRP3 inflammasome, inhibits the activation of NF-κB pathway, exhibiting thereby immunostimulatory and anti-inflammatory activities. (-)-Maackiain is orally active[1][2].

  

• HY-P1939

  Cyclo(L-Leu-L-Pro)	2873-36-1	99.84%
  Cyclo(L-Leu-L-Pro) is an inhibitory substance targeting to production of norsolorinic acid (NA，a precursor of aflatoxin)，which can be isolated from A. xylosoxidans NFRI-A1. Cyclo(L-Leu-L-Pro) inhibits accumulation of NA by A. parasiticus NFRI-95 and inhibits spore formation. Cyclo(L-Leu-L-Pro) inhibits aflatoxin production with an IC50 of 0.2 mg/mL in A. parasiticus SYS-4[1].

  

• HY-103645

  GW779439X	551919-98-3	99.85%
  GW779439X is a pyrazolopyridazine identified in an inhibitor of the S. aureus PASTA kinase Stk1. GW779439X potentiates the activity of β-lactam antibiotics against various MRSA and MSSA isolates, some even crossing the breakpoint from resistant to sensitive. GW779439X is an AURKA inhibitor and induces apoptosis by the caspases 3/7 pathway[1][2]. MRSA:methicillin-resistant S. aureus; MSSA: methicillin-sensitive S. aureus

  

• HY-105099

  Rifalazil	129791-92-0
  Rifalazil (KRM-1648; ABI-1648), a rifamycin derivative, inhibits the bacterial DNA-dependent RNA polymerase and kills bacterial cells by blocking off the β-subunit in RNA polymerase[1]. Rifalazil (KRM-1648; ABI-1648) is an antibiotic, exhibits high potency against mycobacteria, gram-positive bacteria, Helicobacter pylori, C. pneumoniae and C. trachomatis with MIC values from 0.00025 to 0.0025 μg/ml[3]. Rifalazil (KRM-1648; ABI-1648) has the potential for the treatment of Chlamydia infection, Clostridium difficile associated diarrhea (CDAD), and tuberculosis (TB)[2].

  

• HY-106339

  Lymecycline	992-21-2
  Lymecycline is a tetracycline derivative, with broad-spectrum antibacterial activity and also has anti-inflammatory property.

  

• HY-119976

  Boscalid	188425-85-6
  Boscalid is an anti-fungal agent. Boscalid is a succinate dehydrogenase (SDH) inhibitor[1].

  

• HY-125168

  EGA	415687-81-9
  EGA is an inhibitor that selectively targets the endosomal trafficking pathways. EGA targets the proteins involved in the endosomal trafficking pathways through which multiple toxins and viruses enter cells. EGA exerts its activity by inhibiting the trafficking from early endosomes to late endosomes, blocking the entry of multiple acid-dependent bacterial toxins and viruses into mammalian cells and delaying the lysosomal targeting and degradation of EGFR[1].

  

• HY-131093

  Enduracidin	11115-82-5
  Enduracidin (Enramycin) is a polypeptide antibiotic produced by Streptomyces fungicides[1].

  

• HY-136251

  BRD0539	1403838-79-8	98.03%
  BRD0539 is a Streptococcus pyogenes Cas9 (SpCas9) inhibitor with an IC50 of 22 μM in an in vitro DNA cleavage assay[1].

  

• HY-137335

  6'-Sialyllactose sodium	157574-76-0
  6'-Sialyllactose sodium promotes the growth of beneficial bacteria (such as Bifidobacterium and lactobacillus) and inhibits the proliferation of harmful bacteria. 6'-Sialyllactose sodium exhibits anti-inflammatory and anti-angiogenic activities. 6'-Sialyllactose sodium promotes the muscle health[1][2][3][4].

  

• HY-139983

  SDH-IN-1	2685795-52-0	99.95%
  SDH-IN-1 (compound 4i) is a succinate dehydrogenase (SDH) inhibitor with an IC50 of 4.53 μM. SDH-IN-1 has potent antifungal activities. SDH-IN-1 displays potent activity against S. sclerotiorum (EC50 of 0.14 mg/L)[1].

  

• HY-150217

  CpG ODN 10101	1234402-77-7
  CpG ODN 10101, a synthetic oligodeoxynucleotide (ODN),  is a toll-like receptor 9 (TLR9) agonist. CpG ODN 10101 is a potent inducer of cytokine/chemokine expression ex vivo when used in combination with HH2(VQLRIRVAVIRA-NH2). CpG ODN 10101 induces IFN- secretion from dendritic cells (DCs) and stimulates B-cells.CpG ODN 10101 has antiviral and immunomodulatory properties that can influence chronic infection with HCV[1][2].

  

• HY-15523A

  Braco-19 trihydrochloride	1177798-88-7
  Braco-19 trihydrochloride is a potent telomerase/telomere inhibitor, preventing the capping and catalytic action of telomerase. Braco-19 acts as G-quadruplex (GQ) binding ligand, stabilizing G-quadruplexes formation at the 3V telomeric DNA overhang and produce rapid senescence or selective cell death. Braco-19 is also a HAdV virus replication inhibitor[1][2].

  

• HY-156263

  LB Broth Base, powder
  LB Broth Base, powder (Luria-Bertani Base) is generally used to maintain the growth of E. coli. The composition of 1 liter of LB medium is: 10 g peptone, 5 g yeast extract and 10 g NaCl[1].

  

• HY-15745A

  PSI-7409 tetrasodium	1621884-22-7
  PSI-7409 tetrasodium is an active 5'-triphosphate metabolite of sofosbuvir (PSI-7977), inhibiting HCV NS5B polymerases, with IC50s of 1.6, 2.8, 0.7 and 2.6 μM for GT 1b_Con1, GT 2a_JFH1, GT 3a, and GT 4a NS5B polymerases, respectively.

  

• HY-157536

  SMT-738		98.47%
  SMT-738 is a small-molecule inhibitor of bacterial lipoprotein transport targeting Enterobacteriaceae[1].

  

• HY-B0338A

  Rimantadine hydrochloride	1501-84-4
  Rimantadine hydrochloride (Flumadine hydrochloride) is an orally active inhibitor for M2 protein, that blocks the hydrogen ion channel activity, prevents the entry and replication of the virus, and exhibits board-spectrum antiviral activity[1].

  

• HY-B0510S

  Trimethoprim-d9	1189460-62-5	98.81%
  Trimethoprim-d9 is the deuterium labeled Trimethoprim. Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for urinary tract infections, Shigellosis and Pneumocystis pneumonia treatment[1][2][3].

  

• HY-D0896A

  ANS ammonium	28836-03-5	99.94%
  ANS ammonium is a potent antibacterial agent and a textile dye. ANS ammonium can be used as fluorescence probe. ANS ammonium blocks the binding of triiodothyronine to thyroxine binding globulin in radioimmunoassay of triiodothyronine[1][2][3].

  

• HY-N7071A

  Maduramicin ammonium	84878-61-5
  Maduramicin ammonium (Maduramycin ammonium) is isolated from the actinomycete Actinomadura rubra. Maduramicin ammonium (Maduramycin ammonium) is an anticoccidial agent for the the treatment of Eimeria spp., E. adenoeides, E. gallopavonis, and E. dispersa infection[1]. Maduramicin ammonium (Maduramycin ammonium) induces cell apoptosis in chicken myocardial cells via intrinsic and extrinsic pathways[2].

  

• HY-P1116A

  PBP10 TFA		98.29%
  PBP10 is a cell permeable and selective gelsolin-derived peptide inhibitor of formyl peptide receptor 2 (FPR2) over FPR1[1]. PBP10 is a 10-AA peptide with rhodamine conjugated at its N terminus, exerts bactericidal activity against gram-positive and gram-negative bacteria and limits microbial-induced inflammatory effects[2].

  

• HY-111532B

  (3S,4S)-A2-32-01		98.15%
  (3S,4S)-A2-32-01 (compound 24(S,S)), a less active (S,S)-enantiomer of A2-32-01. A2-32-01 is a potent caseinolytic protein proteases (ClpP) inhibitor[1].

  

• HY-W011142

  2'-Deoxyuridine 5'-monophosphate disodium	42155-08-8
  2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis[1].

  

• HY-W015591

  Mandelic acid	90-64-2	99.92%
  Mandelic acid ((±)-Mandelic acid), an alpha-hydroxycarboxylic acid, has been widely used as an intermediate of pharmaceutical and fine chemicals. Mandelic acid shows antimicrobial activity and has been used for the research of urinary tract infections and vaginal trichomoniasis. Mandelic acid exhibits high sperm-immobilizing activity and low vaginal irritation[1][2].

  

• HY-W072009

  5,7-Dihydroxycoumarin	2732-18-5
  5,7-Dihydroxycoumarin is a coumarin isolated from the inflorescences of Macaranga triloba. 5,7-dihydroxycoumarin displays antibacterial characteristics with an MIC value in the range of 1000 mg/mL to >1000 mg/mL. Some 5,7-dihydroxycoumarin derivatives have antioxidant properties[1][2][3].

  

• HY-B0827

  Dinotefuran	165252-70-0	99.74%
  Dinotefuran is an orally active and competitive inhibitor and insecticide targeting insect nicotinic acetylcholine receptors (nAChRs). Dinotefuran blocks neural signaling and induces neural dysfunction in insects. Dinotefuran binds to [3H]epibatidine in the neural cord membrane of American cockroach with an IC50 of 890 nM and to [3H]α-bungarotoxin with an IC50 of 36.1 μM. Dinotefuran exhibits knockdown activity (KD50=0.351 nmol/g) and lethal activity (LD50=0.173 nmol/g) against German cockroach. Dinotefuran is mainly used for agricultural pest control, such as field control of piercing-sucking and chewing insects (e.g., aphids, planthoppers), while its environmental toxicological effects (e.g., oxidative stress and reproductive neurotoxicity on earthworms) are also a research focus to assess ecological risks[1][2][3].

  

• HY-B1824

  Cefpirome sulfate	98753-19-6	99.49%
  Cefpirome sulfate (HR-810 sulfate) is a fourth generation cephalosporin antibiotic.

  

• HY-N1487

  Oleanonic acid	17990-42-0
  Oleanonic acid (3-Oxooleanolic acid) is an orally available triterpene that has anti-inflammatory and insecticidal properties. In vitro, oleanonic acid can improve oxidative stress, autophagy defects, ferroptosis, mitochondrial damage, and endoplasmic reticulum stress induced by Amyloid-β, and in vivo, it can alleviate myocardial hypertrophy in rats[1][2][3][4][5].

  

• HY-111741

  M700F048	2056235-51-7	99.81%
  M700F048 is a major plant metabolite of fungicide Fluxapyroxad[1].

  

• HY-149648

  JNJ-8003		99.84%
  JNJ-8003 is a potent inhibitor of RSV Polymerase. JNJ-8003 inhibits nucleotide polymerization of RNA transcription and replication at the early stages[1].

  

• HY-145119AS

  Mindeudesivir hydrobromide	2779498-79-0	99.46%
  Mindeudesivir (JT001; VV116; GS-621763-d1) hydrobromide is a deuterated version of Remdesivir (HY-104077), a highly orally active nucleoside antiviral against SARS-CoV-2 and respiratory syncytial virus (RSV). Mindeudesivir hydrobromide retains the antiviral activity of Remdesivir against COVID-19, and is the first domestically produced deuterium targeting the COVID-19[1][2].

  

• HY-10244

  MK-0608	443642-29-3	99.81%
  MK-0608 is a potent and orally bioavailable inhibitor of HCV replication in vitro with an EC50 of 0.3 μM (EC90=1.3 μM) in the subgenomic-replicon assay[1].

  

• HY-18061

  Ochromycinone	111540-00-2	98.29%
  Ochromycinone ((Rac)-STA-21) is a natural antibiotic and a STAT3 inhibitor. Ochromycinone can inhibits STAT3 DNA binding activity, STAT3 dimerization. Ochromycinone has anticancer and antimicrobial activity[1][2].

  

• HY-A0162

  Quinupristin	120138-50-3	98.05%
  Quinupristin is a streptogramin antibiotic. Quinupristin blocks peptide bond synthesis to prevent the extension of polypeptide chains and promote the detachment of incomplete protein chains in the bacterial ribosomal subunits[1] [2].

  

• HY-P2076

  Dusquetide	931395-42-5	99.77%
  Dusquetide (SGX942) is a first-in-class innate defense regulator (IDR). Dusquetide modulates the innate immune response to both PAMPs and DAMPs by binding to p62. Dusquetide shows activity in both reducing inflammation and increasing clearance of bacterial infection[1]. DAMPs: damage-associated molecular patterns; PAMPs: pathogen-associated molecular patterns

  

• HY-145586

  Onradivir	2200336-20-3	99.95%
  Onradivir is a potent anti-influenza virus agent[1].

  

• HY-B0975

  Penicillin V Potassium	132-98-9	99.01%
  Penicillin V Potassium (Phenoxymethylpenicillin potassium salt) is an orally active antibiotic. Penicillin V Potassium inhibits the growth of Streptococci, C. difficile and S. aureus. Penicillin V Potassium can be used for the research of otitis, sinusitis, pharyngitis and tonsillitis[1][2][3][4].

  

• HY-109168

  Bersacapavir	1638266-40-6	99.24%
  Bersacapavir (JNJ-6379) is a novel Hepatitis B Virus capsid assembly modulator. Bersacapavir interferes with the assembly process of the hepatitis B virus nucleocapsid by binding to the hydrophobic pocket at the dimer-dimer interface of hepatitis B core protein (HBc) subunits. Bersacapavir inhibits the replication of HBV. Bersacapavir is mainly used in the research of chronic hepatitis B[1][2][3].

  

• HY-121268

  Demeclocycline	127-33-3
  Demeclocycline is an orally active tetracycline antibiotic. Demeclocycline impairs protein synthesis by binding to the 30S ribosomal subunit to inhibit binding of aminoacyl tRNA. Demeclocycline shows anti-bacterial activitise to a wide variety of bacterial infections[1][2].

  

• HY-139558

  Zapnometinib	303175-44-2	99.85%
  Zapnometinib (PD0184264), an active metabolite of CI-1040, is a MEK inhibitor, with an IC50 of 5.7 nM. Zapnometinib exhibits antiviral activity against influenza virus and antibacterial activities[1][2][3].

  

• HY-147217

  Bepirovirsen	1403787-62-1	98.44%
  Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

  

• HY-15298B

  Grazoprevir hydrate	1350462-55-3	99.99%
  Grazoprevir hydrate (MK-5172 hydrate) is a selective inhibitor of Hepatitis C virus NS3/4a protease with broad activity across genotypes and resistant variants, with Kis of 0.01 nM (gt1b), 0.01 nM (gt1a), 0.08 nM (gt2a), 0.15 nM (gt2b), 0.90 nM (gt3a), respectively[1][2]. Grazoprevir hydrate inhibits SARS-CoV-2 3CLpro activity[3].

  

• HY-A0294A

  Ertapenem disodium	153832-38-3
  Ertapenem (MK-0826) disodium is a broad spectrum and long acting β-lactam antibiotic. Ertapenem disodium has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem disodium can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract[1][2].

  

• HY-B0555A

  Nafcillin sodium monohydrate	7177-50-6
  Nafcillin sodium monohydrate, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin sodium monohydrate can be used for the research of staphylococcal infections[1][2].

  

• HY-P99341

  Casirivimab	2415933-42-3
  Casirivimab (REGN10933) is a human monoclonal antibody that targets the SARS-CoV-2 virus, which causes COVID-19. Casirivimab is ineffective against COVID-19 variants. Casirivimab can be used in combination with Imdevimab (HY-P99342), which alters the lung response of K18-hACE2 mice to the SARS-CoV-2 δ variant, effectively reducing viral load and improving symptoms[1][2].

  

• HY-12653

  LDC4297	1453834-21-3	98.25%
  LDC4297 is a selective inhibitor of CDK7 with an IC50 value of 0.13 nM. LDC4297 inhibits human cytomegalovirus (HCMV) replication with an EC50 value of 24.5 nM. LDC4297 shows broad antiviral activities to Herpesviridae, Adenoviridae, Poxviridae, Retroviridae and Orthomyxoviridae with EC50 value of 0.02-1.21 μM. LDC4297 can be used for the research of infection[1].

  

• HY-12930

  SPR719	1384984-18-2	99.50%
  SPR719 (VXc-486) is an orally active gyrase B inhibitor, with bactericidal activity. SPR719 potently inhibits multiple agent-sensitive isolates and drug-resistant isolates of Mycobacterium tuberculosis, with MICs of 0.03 to 0.30 μg/ml and 0.08 to 5.48 μg/ml, respectively. SPR719 is promising for research of lung disease caused by non-tuberculous mycobacteria (NTM)[1][2][3][4].

  

• HY-15660

  Efinaconazole	164650-44-6	99.84%
  Efinaconazole (KP-103) is a triazole antifungal agent and againsts T. mentagrophytes SM-110 and C. albicans ATCC 10231 with MICs of 0.0039 μg/mL and 0.00098 μg/mL, respectively[1]. Efinaconazole has a potent in vitro activity against fungal pathogens including dermatophytes, Candida and Malassezia species[1].

  

• HY-19900

  ITX5061	1252679-52-9	98.38%
  ITX5061 is a type II inhibitor of p38 MAPK and also an antagonist of scavenger receptor B1 (SR-B1).

  

• HY-B0035

  Sulfamethazine	57-68-1	99.66%
  Sulfamethazine (Sulfadimidine) is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections). In China and the European Commission, the maximum residue level for Sulfamethazine in animal product is set at 100 μg/kg[1][2].

  

• HY-B0238

  Amorolfine hydrochloride	78613-38-4	99.90%
  Amorolfine (Ro 14-4767/002) hydrochloride is a potent anti-fungal agent. Amorolfine hydrochloride inhibits ergosterol biosynthesis. Amorolfine hydrochloride has the potential for the research of Neoscytalidium dimidiatum onychomycosis[1][2].

  

• HY-B0526

  Flumequine	42835-25-6	99.89%
  Flumequine (R-802) is a quinolone antibiotic, and acts as a topoisomerase II inhibitor, with an IC50 of 15 μM (3.92 μg/mL).

  

• HY-B0845

  Prochloraz	67747-09-5	99.77%
  Prochloraz is an imidazole antifungal. Prochloraz is as an estrogen receptor (ER) and androgen receptor (AR) antagonist and an aromatase inhibitor with IC50 values of 25 μM, 4 μM and 0.3 μM, respectively. Prochloraz is able to activate the aryl hydrocarbon receptor (AhR) having an EC50 of 1 μM[1][2].

  

• HY-B0903

  Hexylene glycol	107-41-5
  Hexylene glycol is a low molecular weight surfactant with antimicrobial properties. Hexylene glycol is widely used in industrial chemicals and cosmetics[1][2].

  

• HY-B1075

  Fosfomycin calcium	26016-98-8
  Fosfomycin (MK-0955) calcium is a blood-brain barrier penetrating, broad-spectrum antibiotic by irreversibly inhibiting an early stage in cell wall synthesis. Fosfomycin calcium shows both in vivo and in vitro activity against a wide range of bacteria, including multidrug-resistant (MDR), extensively drug-resistant (XDR), and pan-drug-resistant (PDR) bacteria[1][2].

  

• HY-B1190

  Cefadroxil	50370-12-2
  Cefadroxil is a broad-spectrum antibiotic of the cephalosporin type, effective in Gram-positive and Gram-negative bacterial infections.

  

• HY-B1324

  Oxiconazole nitrate	64211-46-7
  Oxiconazole (Ro 13-8996) nitrate is a broad spectrum anti-fungal agent which can inhibit the growth of Candida, Aspergillus and Trichophyton. Oxiconazole nitrate is also a highly efficacious activator of CYP3A4 transactivation, which could be antagonized by Rifampicin (HY-B0272) in a competitive manner. Oxiconazole nitrate exhibits inhibitory effect against colorectal cancer (CRC) via peroxiredoxin-2 (PRDX2)-mediated autophagy arrest[1][2][3].

  

• HY-B1400

  Diiodohydroxyquinoline	83-73-8
  Diiodohydroxyquinoline (Iodoquinol, 5,7-Diiodo-8-hydroxyquinoline, 5,7-Diiodo-8-quinolinol) has an orally active and satisfactory antiparasitic properties. Diiodohydroxyquinoline exhibits mutagenic potential in mice and potent anti-SARS-CoV-2 activity with an EC50 value of 1.38 μM in VeroE6 cells. Diiodohydroxyquinoline's antimutagen is ascorbic acid. Diiodohydroxyquinoline is promising for research in inflammationin, testinal amebiasis, amebic liver abscess and chronic nonspecific diarrheas[1][2][3][4][5].

  

• HY-B1915

  Micronomicin	52093-21-7	99.92%
  Micronomicin (Gentamicin C2b) is an aminoglycoside antibiotic, with antibacterial and bactericidal activities[1].

  

• HY-B1916

  Acetylspiramycin	24916-51-6
  Acetylspiramycin (Spiramycin B) is an effective oral macrolide antibiotic produced by Streptomyces, It can inhibit the splenic lymphocyte transformation induced by phytohemagglutinin (PHA), LPS (HY-D1056) and antigen, reduce the procoagulant activity of macrophages, have good antibacterial effect on gram-positive bacteria, and is also an effective antigenic insect agent, which can be used to fight parasitic infection[1][2][3][4].

  

• HY-N0336

  3-Butylidenephthalide	551-08-6
  3-Butylidenephthalide (Butylidenephthalide) is a phthalic anhydride derivative identified in Ligusticum chuanxiong Hort, and has larvicidal activity (LC50 of 1.56 mg/g for Spodoptera litura larvae)[1].

  

• HY-N0699

  Daphnoretin	2034-69-7
  Daphnoretin (Dephnoretin), isolated from Wikstroemia indica, possesses antiviral activity[1]. Daphnoretin likes PMA, may direct activation of protein kinase C which in turn activated NADPH oxidase and elicited respiratory burst[2].

  

• HY-N1363

  Royal Jelly acid	14113-05-4
  Royal Jelly Acid ((E)-Queen Bee Acid) is a major fatty acid found in royal jelly with oral bioavailability, exhibiting anti-inflammatory, anticancer, antimalarial, antiprotozoal, and neuroregulatory activities. Royal Jelly Acid can be used for research in various fields, including cancer, infections, immune inflammation, and neurological diseases[1][2][3][4][5][6][7].

  

• HY-N1500

  Pulegone	89-82-7	98.80%
  Pulegone is a monoterpene ketone compound widely present in the essential oils of many plants. Pulegone can also be used as a bird repellent. Pulegone has multiple activities such as anti-inflammatory, antibacterial, antifungal, and anti-hyperalgesic effects. Pulegone is particularly effective against bacteria of the Salmonella species[1][2][3][4][5].

  

• HY-N2086

  Ethyl palmitate	628-97-7
  Ethyl palmitate (Ethyl hexadecanoate) is a CHIKV virus inhibitor with an EC50 value of 0.0068 μM. Ethyl palmitate can reduce levels of TNF-α, IL-6, and NF-κB in endotoxemic rats, showing anti-inflammatory activity[1][2].

  

• HY-N2189

  Swertisin	6991-10-2
  Swertisin is an oral adenosine A1 receptor antagonist and an SGLT2 inhibitor. Swertisin has anti-diabetic, antioxidant properties, inhibits HBV, and improves cognitive and memory impairments in mice[1][2][3].

  

• HY-N3617

  Coniferin	531-29-3	99.13%
  Coniferin (Laricin) is a glucoside of coniferyl alcohol. Coniferin inhibits fungal melanization. Coniferin inhibits the release of certain hormones from cells, including Prostaglandin E2 and Thromboxane B2[1][2][3].

  

• HY-N5060

  Estragole	140-67-0	98.58%
  Estragole (4-Allylanisole) is a relatively nontoxic volatile terpenoid ether and major component of the essential oil from many plants. Estragole significantly triggers Apoptosis, suppresses LPS-induced intracellular ROS production. Estragole activats Nrf-2 and regulates NF-κB. Estragole has anti-toxoplasma, anti-inflammatory, anti-edema, antioxidant and immunomodulatory properties. Estragole blocks DRG neuron excitability. Estragole has improves gastric ulcer activity[1][2][3][4][5][6][7][8][9][10][11][12][13].

  

• HY-N6263

  EGCG Octaacetate	148707-39-5	98.42%
  EGCG Octaacetate (AcEGCG) is a proagent of Green tea epigallocatechin-3-gallate (EGCG). EGCG Octaacetate decreases the proinflammatory mediator levels by down-regulating of PI3K/Akt/NFκB phosphorylation and p65 acetylation. EGCG octaacetate is the potential antibacterial compound for gram-positive bacteria (GPB) and gram-negative bacteria (GNB). EGCG Octaacetate exhibits antioxidant, anti-angiogenesis, anti-inflammatory and antitumor activities[1][2][3].

  

• HY-N7067

  Revaprazan hydrochloride	178307-42-1	99.98%
  Revaprazan hydrochloride is a novel acid pump antagonist (APA). Revaprazan hydrochloride reduces COX-2 expression and has significant anti-inflammatory actions activities in H. pylori infection[1].

  

• HY-N7610

  Acetylalkannin	34232-27-4	99.85%
  Acetylalkannin (Alkannin acetate) is an isohexenylnaphthazarin pigment isolated from Arnebia euchroma with antimicrobial and cytotoxic activities[1].

  

• HY-P2324

  Gramicidin A	11029-61-1
  Gramicidin A is a peptide component of gramicidin, an antibiotic mixture originally isolated from B. brevis. Gramicidin A is a highly hydrophobic channel-forming ionophore that forms channels in model membranes that are permeable to monovalent cations. Gramicidin A induces degradation of hypoxia inducible factor 1 α (HIF-1α)[1][2].

  

• HY-P5645

  LEAP-2	1683582-94-6
  LEAP-2 is an antimicrobial peptide derived from human blood[1].

  

• HY-Y0790

  Cuminaldehyde	122-03-2
  Cuminaldehyde is the main component of Cuminum cyminum and has multiple biological activities, including anti-inflammatory, anti-cancer, anti-diabetic, anti-injury, anti-neuropathy and antibacterial effects. Cuminaldehyde is an inhibitor of aldose reductase (IC50= 0.00085 mg/mL), α-glucosidase (IC50=0.5 mg/mL) and lipoxygenase (IC50=1370 μM). Cuminaldehyde also inhibits the fibrillation of α-synuclein and prevents its aggregation. Cuminaldehyde has potential application value in the research of neurodegenerative diseases, cancer, diabetes and neuropathic pain diseases[1][2][3][4][5][6][7].

  

• HY-Y1718

  Tridecanoic acid	638-53-9
  Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation[1].

  

• HY-100385

  Brevianamide F	38136-70-8	99.03%
  Brevianamide F (Cyclo(L-Pro-L-Trp)) is a mycotoxin isolated from Colletotrichum gloeosporioides, with antibacterial activity. Brevianamide F shows potent PI3Kα inhibitory activity with an IC50 of 4.8 μM[1][2].

  

• HY-100721

  GC376 sodium	1416992-39-6
  GC376 sodium is a 3CLpro inhibitor; inhibits the replication of viruses TGEV, FIPV and PTV with IC50 values of 0.15, 0.2 and 0.15 μM, respectively.

  

• HY-108137

  Z-LVG-CHN2	119670-30-3
  Z-LVG-CHN2 is a cell-permeable and irreversible inhibitor of cysteine proteinase. Z-LVG-CHN2 is a tripeptide derivative and mimics part of the human cysteine proteinase-binding center. Z-LVG-CHN2 displays an inhibition on HSV whereas no significant effect on poliovirus replication. Z-LVG-CHN2 effectively blocks SARS-COV-2 replication (EC50=190 nM) via inhibition of SARS-COV-2 3CL pro protease[3].

  

• HY-108675

  PPNDS tetrasodium	1021868-77-8
  PPNDS tetrasodium is a selective and competitive meprin β inhibitor (IC50: 80 nM, Ki: 8 nM), and also inhibits ADAM10 (IC50: 1.2 μM). PPNDS tetrasodium is also a P2X1 receptor antagonist. PPNDS is an agonist for the ATP receptor of Paramecium. PPNDS tetrasodium potently inhibits polymerases from viruses. PPNDS tetrasodium can be used in the research of infection and cancers[1][3][4].

  

• HY-111183

  Neocarzinostatin	9014-02-2
  Neocarzinostatin, a potent DNA-damaging, anti-tumor antibiotic, recognizes double-stranded DNA bulge and induces DNA double strand breaks (DSBs). Neocarzinostatin induces apoptosis. Neocarzinostatin has potential for EpCAM-positive cancers treatment [1][2].

  

• HY-111588

  Xanthoangelol	62949-76-2	99.88%
  Xanthoangelol, extracted from Angelica keiskei, suppresses obesity-induced inflammatory responses. Xanthoangelol possesses antibacterial activity. Xanthoangelol inhibits monoamine oxidases. Xanthoangelol induces apoptosis in neuroblastoma and leukemia cells[1][2][3][4].

  

• HY-113289

  Brassicasterol	474-67-9	98.71%
  Brassicasterol is a metabolite of Ergosterol and has cardiovascular protective effects. Brassicasterol exerts anticancer effects in prostate cancer through dual targeting of AKT and androgen receptor signaling pathways. Brassicasterol inhibits HSV-1 (IC50=1.2 μM) and Mycobacterium tuberculosis. Brassicasterol also inhibits sterol δ 24-reductase, slowing the progression of atherosclerosis. Brassicasterol is also a cerebrospinal fluid biomarker for Alzheimer's disease[1][2][3][4][5][6].

  

• HY-121075

  Alizarin complexone	3952-78-1
  Alizarin complexone is a calcium-tracer and a chelating agent. Alizarin complexone is Rous-associated virus 2 reverse transcriptase (RAV-2 RT) inhibitor[1][2].

  

• HY-121615

  α-Phellandrene	99-83-2
  α-Phellandrene (alpha-Phellandrene) is an orally active monoterpenoid and insecticide. α-Phellandrene can be isolated from plant essential oils. α-Phellandrene induces Apoptosis and Autophagy. α-Phellandrene promotes cAMP signaling pathway and increases NO production. α-Phellandrene has anti-inflammatory and anticancer (sarcoma) activities. α-Phellandrene shows insecticidal activity against Lucilia cuprina L3. α-Phellandrene reduces mechanical hyperalgesia[1][2][3][4][5][6][7][8][9][10][11].

  

• HY-121721

  Inz-5	1585214-21-6	98.82%
  Inz-5 is a fungal-selective mitochondrial cytochrome bc1 inhibitor. Inz-5 impairs fungal virulence and prevents the evolution of agent resistance[1].

  

• HY-122280

  Aerobactin	26198-65-2
  Aerobactin is a siderophore produced by bacteria. Aerobactin is a highly potent pathogenic factor[1].

  

• HY-124658

  G0507	1223998-29-5	99.85%
  G0507, a pyrrolopyrimidinedione compound, is a potent LolCDE ABC Transporter inhibitor. G0507 is a inhibitor of Escherichia coli growth and induces the extracytoplasmic σE stress response. G0507 acts as a chemical probe to dissect lipoprotein trafficking in Gram-negative bacteria[1].

  

• HY-125098

  Illudin S	1149-99-1	98.01%
  Illudin S, a cytotoxic Illudin, is a natural sesquiterpene with strong anti-tumour and antiviral activities. Illudin S has genotoxic activities. Illudin S blocks the G1-S phase interface of the cell cycle in human leukemia cells[1][2][3][4].

  

• HY-125130

  Hesperetin 7-O-glucoside	31712-49-9	98.08%
  Hesperetin 7-O-glucoside is a typical flavonoid monoglucoside, which is an anti-inflammatory agent and an antihypertensive with orally active. Hesperetin 7-O-glucoside is a commonly used food adjuvant. Hesperetin 7-O-glucoside inhibits human intestinal maltase and human HMG-CoA reductase with Ki of 1.8 mM and 9.8 μM, respectively. Hesperetin 7-O-glucoside has antibacterial activity and can regulate intestinal flora and metabolic homeostasis in mice[1][2][3].

  

• HY-128971

  LHVS	170111-28-1
  LHVS is a potent, non-selective, irreversible, cell-permeable cysteine protease and cathepsin inhibitor. LHVS decreases actin ring formation. LHVS inhibits T. gondii invasion with an IC50 of 10 μM[1][2][3].

  

• HY-131611

  6-Azuridine	54-25-1
  6-Azuridine (6-Azauridine) is an orally active purine nucleoside analogue. 6-Azuridine activates autophagic flux, induces Apoptosis that depends on AMPK and p53. 6-Azuridine exhibit both antitumor and antiviral activities[1][2][3][4][5][6].

  

• HY-133108

  Azadirachtin B	106500-25-8	99.17%
  Azadirachtin B is an limonoid isolated from seed kernels of Azadirachta indica. Azadirachtin B increases alkaline phosphatase (ALP) activity and stimulates osteoblast differentiation. Azadirachtin B is active against the Epstein-Barr virus early antigen (EBV-EA). Azadirachtin B has insecticidal, nematocidal, anticancer, anti-inflammatory, antiviral and osteogenic properties[1][2][3].

  

• HY-135336

  (R)-Verapamil hydrochloride	38176-02-2	99.48%
  (R)-Verapamil hydrochloride ((R)-(+)-Verapamil hydrochloride) is an orally active P-Glycoprotein inhibitor. (R)-Verapamil hydrochloride blocks MRP1 mediated transport. (R)-Verapamil hydrochloride induces Apoptosis and inhibits L-type calcium channels BZPcc, DHPcc and PLLcc. (R)-Verapamil hydrochloride has anti-septic shock and anti-diabetic effects[1][2][3][4][5][6][7].

  

• HY-138407

  Evixapodlin	2374856-75-2	98.14%
  Evixapodlin (GS-4224) is a human PD-1/PD-L1 protein/protein interaction inhibitor with an IC50 of 0.213 nM. Evixapodlin has anticancer and antiviral functions[1].

  

• HY-148286

  Gentamicin C1a	26098-04-4
  Gentamicin C1a is the precursor of the semi-synthetic antibiotic Etimicin, and has antibacterial activity. Gentamicin C1a is the major component of the Gentamicin complex[1][2].

  

• HY-153121

  Leritrelvir	2923310-64-7
  Leritrelvir (RAY1216) is an orally active SARS-CoV-2 main protease slow-tight inhibitor with a Ki of 8.6 nM[1].

  

• HY-15591A

  TMC647055 Choline salt		99.82%
  TMC647055 (Choline salt) is a potent nonnucleoside NS5B polymerase inhibitor of HCV replication. TMC647055 Choline salt has potent HCV combine activity with an IC50 value of 82 nM. TMC647055 Choline salt can be used for the research of Hepatitis C virus (HCV)[1][2].

  

• HY-B0117C

  Tigecycline tetramesylate
  Tigecycline tetramesylate (GAR-936 tetramesylate) is a broad-spectrum glycylcycline antibiotic. The mean inhibitory concentration (MIC) of Tigecycline for E. coli (MG1655 strain) is approximately 125 ng/mL[1]. MIC50 and MIC90 are 1 and 2 mg/L for Acinetobacter baumannii (A. baumannii), respectively[2].

  

• HY-B0275A

  Oxytetracycline hydrochloride	2058-46-0	98.92%
  Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity[1][2][3].

  

• HY-B0441A

  Tobramycin sulfate	49842-07-1
  Tobramycin sulfate (Nebramycin Factor 6 sulfate) is a parenterally administered, broad spectrum aminoglycoside antibiotic that is widely used in the treatment of moderate to severe bacterial infections due to sensitive organisms[1].

  

• HY-N0415S

  Trigonelline-d3 chloride		99.41%
  Trigonelline-d3 (chloride) is the deuterium labeled Trigonelline chloride. Trigonelline chloride, an alkaloid with potential antidiabetic activity, is present in considerable amounts in coffee. Trigonelline chloride has anti-HSV-1 , antibacterial, and antifungal activities.

  

• HY-N0492S

  α-Lipoic Acid-d5	1189471-66-6
  α-Lipoic Acid-d5 is the deuterium labeled α-Lipoic Acid. α-Lipoic Acid is an antioxidant, which is an essential cofactor of mitochondrial enzyme complexes. α-Lipoic Acid inhibits NF-κB-dependent HIV-1 LTR activation[1][2][3]. α-Lipoic Acid induces endoplasmic reticulum (ER) stress-mediated apoptosis in hepatoma cells[4].

  

• HY-N7701B

  L-Tetraguluronic acid	149511-37-5
  L-Tetraguluronic acid is a linear polysaccharide copolymer composed of four L-guluronic acid (G)[1].

  

• HY-P1291A

  PKI 14-22 amide,myristoylated TFA		99.38%
  PKI 14-22 amide, myristoylated TFA is a selective, cAMP-dependent, competitive PKA inhibitor with Ki=~36 nM. The myristoylation modification of PKI 14-22 amide, myristoylated TFA makes it more permeable to cell membranes and blood-brain barriers than the precursor molecule. PKI 14-22 amide, myristoylated TFA can block the phosphorylation of cAMP-dependent downstream targets (such as CREB). PKI 14-22 amide, myristoylated TFA can prevent the development of analgesic tolerance in mice, and also inhibits protein translation and negative-strand RNA synthesis of Zika virus. PKI 14-22 amide, myristoylated TFA can be used in research fields such as opioid tolerance mechanisms and antiviral drugs[1][2][3].

  

• HY-P5623B

  RVG TFA		98.25%
  RVG TFA is a peptide derived from Rabies Virus Glycoprotein that binds to the α-7 subunit of nicotinic acetylcholine receptors (AchR) of neuronal cells. RVG enhances delivery of Mycobacterium tuberculosis antigens to antigen-presenting cells[1].

  

• HY-106594A

  Prussian blue insoluble	14038-43-8
  Prussian blue soluble is a good adsorbent to be used as antidotes for poisoning with cesium or thallium ions. Prussian blue soluble has anticancerous and antibacterial properties. Prussian blue soluble can be used as a contrast agent in photoacoustic and magnetic resonance imaging (MRI)[1][2][3][4].

  

• HY-150217A

  CpG ODN 10101 sodium
  CpG ODN 10101 sodium, a synthetic oligodeoxynucleotide (ODN), is a toll-like receptor 9 (TLR9) agonist. CpG ODN 10101 sodium is a potent inducer of cytokine/chemokine expression ex vivo when used in combination with HH2(VQLRIRVAVIRA-NH2). CpG ODN 10101 sodium induces IFN- secretion from dendritic cells (DCs) and stimulates B-cells.CpG ODN 10101 sodium has antiviral and immunomodulatory properties that can influence chronic infection with HCV[1][2].

  

• HY-B0322S1

  Sulfamethoxazole-13C6	1196157-90-0	99.65%
  Sulfamethoxazole-13C6 (Ro 4-2130-13C6) is a 13C labeled Sulfamethoxazole (HY-B0322). Sulfamethoxazole (Ro 4-2130) is a sulfonamide antibiotic with a widespread antibacterial activity. Sulfamethoxazole inhibits bacterial folate metabolism by competing with 4-Aminobenzoic acid (HY-B1008) (PABA) to act on dihydropteroate synthetase and dihydropteroate reductase. Sulfamethoxazole can be used for the study of urinary tract infections (UTIs), prostatitis, and bronchitis[1][2][3].

  

• HY-W004282

  Undecanoic acid	112-37-8
  Undecanoic acid (Undecanoate) is a monocarboxylic acid with antifungal property. Undecanoic acid inhibits the production of exocellular keratinase, lipase and the biosynthesis of several phospholipids in T. rubrum[1][2].

  

• HY-W040022

  Cefcapene pivoxil hydrochloride hydrate	147816-24-8
  Cefcapene pivoxil hydrochloride hydrate, the pivalate ester prodrug form of Cefcapene, is an orally active third-generation cephalosporin with a wide spectrum of anti-bacterial activity. Cefcapene pivoxil hydrochloride hydrate has the potential for the palmoplantar pustulosis (PPP) research[1][2].

  

• HY-13465

  VCH-916	1200133-34-1	99.51%
  VCH-916 is a novel nonnucleoside HCV NS5B polymerase inhibitor.

  

• HY-B1295

  Lithium citrate tetrahydrate	6080-58-6
  Lithium citrate (Litarex) tetrahydrate is a natural preservative and food tartness enhancer. Lithium citrate tetrahydrate induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Lithium citrate tetrahydrate cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Lithium citrate tetrahydrate is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-B1444

  Isoconazole nitrate	24168-96-5
  Isoconazole nitrate is a broad-spectrum antimicrobial agent with a highly effective antimycotic and gram-positive antibacterial activity, exhibiting a rapid rate of absorption and low systemic exposure potential[1].

  

• HY-B1948

  Diniconazole	83657-24-3	99.12%
  Diniconazole is a newly developed fungicide strongly inhibited lanosterol 14 alpha-demethylation catalyzed by a yeast cytochrome P-450.

  

• HY-160202

  18:1 Cardiolipin disodium	115404-77-8	99.90%
  18:1 Cardiolipin disodium is a virulence regulator with two phosphate groups and four acyl chains.18:1 Cardiolipin disodium can be used in the study of the regulation and mechanism of bacterial infection[1].

  

• HY-W002198

  2-Hydroxyacetophenone	582-24-1
  2-Hydroxyacetophenone is a principal root volatile of the Carissa edulis. 2-Hydroxyacetophenone can be used as biulding block[1][2][3].

  

• HY-B0180B

  Imiquimod maleate	896106-16-4	99.25%
  Imiquimod maleate (R 837 maleate), an immune response modifier, is a selective toll like receptor 7 (TLR7) agonist. Imiquimod maleate exhibits antiviral and antitumor effects in vivo. Imiquimod maleate can be used for the research of external genital, perianal warts, cancer and COVID-19[1][2].

  

• HY-10353A

  Raltegravir potassium	871038-72-1	99.96%
  Raltegravir (MK 0518) potassium is a potent integrase (IN) inhibitor, used to treat HIV infection.

  

• HY-126428

  ZL0580	2377151-10-3	99.26%
  ZL0580, a structurally close analog of ZL0590, induces epigenetic suppression of HIV via selectively binding to BD1 domain of BRD4. ZL0580 induces HIV suppression by inhibiting Tat transactivation and transcription elongation as well as by inducing repressive chromatin structure at the HIV promoter[1][2][3].

  

• HY-10444

  R-1479	478182-28-4	99.60%
  R-1479 (4'-Azidocytidine), a nucleoside analogue, is a specific inhibitor of RNA-dependent RNA polymerase (RdRp) of HCV. R-1479 inhibits HCV replication in the HCV subgenomic replicon system (IC50=1.28 μM)[1][2][3]. R-1479 is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-12361

  PF 1022A	133413-70-4	99.12%
  PF 1022A is a cyclooctadepsipeptide with broadspectrum anthelmintic properties produced by fermentation of the fungus Mycelia sterilia. PF 1022A is a channel-forming ionophore. PF 1022A showes strong anthelmintic activities against Ascaridia galli in chickens. PF 1022A also can be used for angiostrongyliasis research[1][2][3].

  

• HY-B0396

  Tebipenem pivoxil	161715-24-8
  Tebipenem pivoxil (L084) is an orally active antibiotic against a variety of pathogenic bacteria. Tebipenem pivoxil binds penicillin-binding protein (PBP), thereby inhibiting cell wall synthesis[1].

  

• HY-B0466

  Cloxacillin sodium monohydrate	7081-44-9	99.37%
  Cloxacillin sodium monohydrate is an orally active antibacterial agent and β-lactamase inhibitor with an IC50 of 0.04 µM. Cloxacillin sodium monohydrate can suppress the S. aureus-induced inflammatory response by inhibiting the activation of MAPKs, NF-кB and NLRP3-related proteins[1][2][3].

  

• HY-B1118

  Secnidazole	3366-95-8	99.87%
  Secnidazole (RP-14539) is an orally active azole antibiotic and a imidazole mitigator of Serratia marcescens virulence. Secnidazole, as an analog of acylhomoserine lactones, effectively inhibits QS resulting in the attenuation of Pseudomonas aeruginosa pathogenesis. Secnidazole has antimicrobial activity against many anaerobic Gram-negative and Gram-positive bacterial species in vitro. Secnidazole can be used for the research of various diseases, such as amoebiasis and giardiasis, and bacterial vaginitis[1][2][3].

  

• HY-104074

  Pocapavir	146949-21-5	98.55%
  Pocapavir (SCH-48973) is an orally active capsid inhibitor. Pocapavir prevents virion uncoating upon entry into the cell. Pocapavir has antiviral activity against polioviruses. Pocapavir also inhibits enterovirus infections[1].

  

• HY-120435

  Tyrothricin	1404-88-2
  Tyrothricin is a polypeptide antibiotic mixture isolated from Bacillus brevis and consists of tyrocidines and gramicidins. Tyrothricin shows activity against bacteria, fungi and some viruses. Tyrothricin containing formulations are used in sore throat agents and in agents for the healing of infected superficial and small-area wounds[1].

  

• HY-124586

  Streptonigrin	3930-19-6
  Streptonigrin (Bruneomycin) is an orally active antibiotic and pan-PAD inhibitor, inhibiting PAD1, PAD2, PAD3 and PAD4 with IC50 of 48.3 μM, 26.1 μM, 0.43 μM and 2.5 μM, respectively. Streptonigrin inhibits SENP1 (IC50 of 0.518 μM) and reduces HIF1α. Streptonigrin increases p53 and Apoptosis. Streptonigrin shows antiviral activity against Rauscher murine leukemia virus. Streptonigrin has immunosuppressive effects. Streptonigrin has antitumor activity against osteosarcoma[1][2][3][4][5][6][7][8][9][10].

  

• HY-14818A

  Laninamivir octanoate	203120-46-1	98.57%
  Laninamivir octanoate (CS-8958), a proagent of Laninamivir, is a long-acting neuraminidase (NA) inhibitor with anti-influenza virus activity. Laninamivir octanoate shows anti-influenza activity against Oseltamivir-resistant viruses, and also against the pandemic influenza viruses[1][2].

  

• HY-B0522S

  Ampicillin-d5	1426173-65-0
  Ampicillin-d5 is the deuterium labeled Ampicillin. Ampicillin is a broad-spectrum beta-lactam antibiotic against a variety of gram-positive and gram-negative bacteria[1][2][3].

  

• HY-P99604

  Cilgavimab	2420563-99-9
  Cilgavimab (AZD-1061; COV2-2130) is a human SARS-CoV-2-neutralizing monoclonal antibody, can compose monoclonal-antibody combination AZD7442 with Tixagevimab (HY-P99556). Cilgavimab shows protective action on mouse models of SARS-CoV-2 infection[1].

  

• HY-12928

  ML336	1613465-33-0	99.09%
  ML336 is quinazolinone-based inhibitor against venezuelan equine encephalitis virus (VEEV), with IC50s of 32, 20, and 42 nM for VEEV TC-83 CPE , VEEV V3526 CPE, VEEV Wild Type CPE, respectively. ML336 potently inhibits a VEEV-induced cytopathic effect in three strains of the virus (TC-83, V3526, and wild type Trinidad donkey) in the low nanomolar range[1].

  

• HY-14932

  Pafuramidine	186953-56-0
  Pafuramidine (DB289) is an orally active proagent of Furamidine (HY-110137A). Pafuramidine is a potent anti-parasitic agent, can be used to research trypanosomiasis, Pneumocystis pneumonia and malaria[1][2][3].

  

• HY-15356

  BIO-acetoxime	667463-85-6
  BIO-acetoxime (BIA) is a potent and selective GSK-3 inhibitor, with IC50s of both 10 nM for GSK-3α/β. BIO-acetoxime has anticonvulsant and anti-infection activity.

  

• HY-17035

  Doramectin	117704-25-3	98.83%
  Doramectin is a derivative of Ivermectin (HY-15310). Doramectin is a potent antiparasitic antibiotic. Doramectin is an active compound against S.mansoni in an NMRI mouse infection model[1][2][3].

  

• HY-76691

  D-Ribonolactone	5336-08-3
  D-Ribonolactone is sugar lactone and an inhibitor of β-galactosidase of Escherichia coli with a Ki of 26 mM[1].

  

• HY-B0854

  Mancozeb	8018-01-7
  Mancozeb is a widely used fungicide that is effective against fungal diseases in most cereals, vegetables, fruits and ornamental plants. In addition, Mancozeb can cause liver damage in mice by activating the Keap1/Nrf2 signaling pathway. Mancozeb upregulates lactate dehydrogenase and cytochrome c to alter cell metabolism and induce cell death. Mancozeb has reproductive toxicity and can induce apoptosis in ovarian cells[1][2][3][4].

  

• HY-B1297

  Ceforanide	60925-61-3	99.23%
  Ceforanide is a second generation cephalosporin administered intravenously or intramuscularly. Ceforanide has a spectrum of in vitro antibacterial activity[1].

  

• HY-B1729

  Phenoxyethanol	122-99-6	99.49%
  Phenoxyethanol has a broad spectrum of antimicrobial agent. Phenoxyethanol is an uncouple agent in oxidative phosphorylation from respiration and competitively inhibits malate dehydrogenase. Phenoxyethanol is used as a preservative in cosmetic, vaccine, and textile, et al[1].

  

• HY-B1908

  Midecamycin	35457-80-8
  Midecamycin, an acetoxy-substituted macrolide antibiotic, is tested against gram-positive and gram-negative bacteria.

  

• HY-B2117

  Valpromide	2430-27-5
  Valpromide is an amide derivative of Valproic acid (HY-10585) and an orally active epoxide hydrolase inhibitor that can cross the blood-brain barrier. Valpromide has antiepileptic, anticonvulsant, and antipsychotic effects. Valpromide also exhibits antiviral activity and can inhibit the reactivation of the EBV lytic cycle[1][2][3][4].

  

• HY-D0958

  Methylene blue hydrate	122965-43-9
  Methylene blue (Basic Blue 9) hydrate is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue hydrate through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue hydrate is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue hydrate is a Tau aggregation inhibitor. Methylene blue hydrate reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation[1][2][3].

  

• HY-N0059

  D-Arabinose	10323-20-3
  D-Arabinose is is an orally active antidepressant and a growth inhibitor of C. elegans (IC50 is 7.5 mM). D-Arabinose can penetrate the blood-brain barrier, selectively interfere with the metabolism of D-ribose and D-fructose, and inhibit the growth of nematodes. D-Arabinose can also inhibit the synthesis of cell biofilm and exert antibacterial activity. D-Arabinose activates the ACSS2-PPARγ/TFEB-CRTC1 axis through the lysosomal AXIN-LKB1-AMPK pathway, inducing CRTC1 transcription, exerts antidepressant-like activity. D-Arabinose is the ring-opened form of the aldopentose D-?Arabinose (HY-N7082)[1][2][3][4].

  

• HY-N0676

  Dehydroandrographolide	134418-28-3	99.93%
  Dehydroandrographolide can be extracted from herbal medicine Andrographis paniculata Nees. Dehydroandrographolide reduces oxidative stress in LPS-induced acute lung injury by inactivating iNOS. Dehydroandrographolide has anti-infective activity[1][2][3].

  

• HY-N1549

  Prunin	529-55-5	99.92%
  Prunin is a potent inhibitor of human enterovirus A71 (HEVA71). Prunin shows strong inhibitory activity against protein tyrosine phosphatase 1B (PTP1B), with an IC50 of 5.5 μM[1][2].

  

• HY-N1887

  4-Allylcatechol	1126-61-0	99.73%
  4-Allylcatechol (4-Allylpyrocatechol) is a xylan which has oral activity and can be isolated from the root of Piper taiwanense. 4-Allylcatechol has a strong inhibitory activity against collagen-induced platelet aggregation (IC50 = 5.3 μM). In addition, 4-Allylcatechol has anti-tuberculosis activity against Mycobacterium tuberculosis H37Rv (MIC = 27.6 μg/mL)[1].

  

• HY-N2193

  Hirsutine	7729-23-9
  Hirsutine, an indole alkaloid of Uncaria rhynchophylla, exhibits anti-cancer activity. Hirsutine induces apoptosis and is a potent Dengue virus inhibitor exhibiting low cytotoxicity[1][2][3].

  

• HY-N2208

  4-Hydroxylonchocarpin	56083-03-5
  4-Hydroxylonchocarpin is a chalcone compound from an extract of Psoralea corylifolia. 4-Hydroxylonchocarpin increases phosphorylation of p38 MAPK, JNK and ERK. 4-Hydroxylonchocarpin has diverse pharmacological activities, including antibacterial, antifungal, anticancer, antireverse transcriptase, antitubercular, antimalarial, anti-inflammatory and antioxidant activities[1].

  

• HY-N2260

  Cephaeline dihydrochloride	5853-29-2
  Cephaeline dihydrochloride is a selective CYP2D6 inhibtor with an IC50 of 121 μM.

  

• HY-N2384

  Febrifugine	24159-07-7	99.98%
  Febrifugine is a quinazolinone alkaloid that inhibits P. falciparum and has antimalarial activity. Febrifugine inhibits bladder cancer by inhibiting DNA synthesis, inducing apoptosis, and reducing steroids[1][2][3].

  

• HY-N2554

  Osthenol	484-14-0	99.27%
  Osthenol (Ostenol) is a reversible, selective, competitive inhibitor of hMAO-A (IC50=0.74 μM, Ki=0.26 μM), with antifungal and antibacterial activity. Osthenol inhibits the oxidative deamination of hMAO-A and regulates the metabolism of monoamine neurotransmitters. Osthenol also inhibits the PI3K/AKT signaling pathway to induce apoptosis of colon cancer cells, arrest the cell cycle at the G1 phase, and inhibit cell proliferation. Osthenol is mainly used in the study of neurological diseases and cancer, especially depression-related MAO-A targeted intervention and colon cancer[1][2][3][4].

  

• HY-N4225

  Aaptamine	85547-22-4
  Aaptamine is an alkaloid that can be isolated from the sponge Aaptos suberitoides. Aaptamine is a competitive antagonist of the α-adrenergic receptor, as well as an inhibitor of the proteasome and cholinesterase. Aaptamine is cytotoxic to tumor cells and can induce apoptosis, cell cycle arrest of tumor cells, and the expression of p21 through a p53-independent pathway. Aaptamine has multiple activities such as anti-tumor, antioxidant, antibacterial, and analgesic effects[1][2][3][4][5][6][7].

  

• HY-N4247

  Kuwanon G	75629-19-5
  Kuwanon G is a flavonoid compound and an antagonist of the bombesin receptor. Kuwanon G has multiple activities such as bactericidal, anti-tumor, anti-inflammatory, antioxidant, anti-atherosclerotic, and neuroprotective effects. Kuwanon G exhibits strong antibacterial activity against oral pathogens, especially cariogenic bacteria and periodontal pathogens. Kuwanon G can induce apoptosis and inhibit proliferation, migration, and invasion of tumor cells. Kuwanon G can be used in the research of diseases such as gastric cancer and atherosclerosis[1][2][3][4][5].

  

• HY-N6013

  Aloin(mixture of A&B)	8015-61-0	99.91%
  Aloin (mixture of A&B) is anthraquinone derivative isolated from Aloe vera. Aloin (mixture of A&B) has diverse biological activities such as anti-inflammatory, immunity, antidiabetic, antioxidant, antibacterial, antifungal, and antitumor activities. Aloin (mixture of A&B) also an effective inhibitor of stimulated granulocyte matrix metalloproteinases (MMPs)[1][2].

  

• HY-N6625

  Chlorothalonil	1897-45-6	98.15%
  Chlorothalonil is a broad-spectrum foliar fungicide with oral activity. Chlorothalonil can be used to combat fungal diseases in vegetable and crop leaves. Chlorothalonil can alter the microbial community in the soil. Chlorothalonil inhibits spermatogenesis. Chlorothalonil can cause intestinal epithelial barrier dysfunction and fetal toxicity[1][2][3][4][5].

  

• HY-N6746

  Citrinin	518-75-2
  Citrinin (NSC 186) is a mycotoxin that causes food contamination and has different toxic effects. Citrinin is an effective oral anticancer agent. Citrinin has various regulatory effects on mouse immune system, including regulating the number of immune cells, inducing apoptosis and autophagy of immune cells, altering toll-like receptor expression and cytokine production. Citrinin can induce oxidative stress and lead to early apoptosis of oocytes. Low doses of Citrinin have neuroprotective effects against glutamate-induced excitotoxicity in rat cortical neurons. In addition, Citrinin also has antibacterial activity[1][2][3][4][5].

  

• HY-N6856

  4-Hydroxycoumarin	1076-38-6	99.96%
  4-Hydroxycoumarin is an orally active coumarin derivative, one of the most versatile heterocyclic scaffolds, often used in the synthesis of various organic compounds. 4-Hydroxycoumarin possesses both electrophilic and nucleophilic properties. 4-Hydroxycoumarin is an HIV protease inhibitor and tyrosine kinase inhibitor. 4-Hydroxycoumarin has anti-inflammatory, antibacterial and anti-tumor effects[1][2][3][4].

  

• HY-N6880

  Rabdosiin	263397-69-9	99.55%
  Rabdosiin is a tetramer of caffeic acid isolated from the stem of Ocimum sanctum. Rabdosiin possess anti-allergic activity, anti-HIV activity and inhibition on DNA topoisomerase[1].

  

• HY-N6962

  α-Spinasterol	481-18-5
  α-Spinasterol is an orally taken antagonist of transient receptor potential vanilloid 1 ( TRPV1), and it's also an inhibitor of COX-1 and COX-2, with IC50 values of 16.17 μM and 7.76 μM, respectively. α-Spinasterol exhibits antibacterial, anti-inflammatory, antidepressant, and antioxidant effects, has the ability to cross the blood-brain barrier, and can improve diabetes in mice[1][2][3][4][5][6].

  

• HY-N9386

  Tellimagrandin II	81571-72-4	98.81%
  Tellimagrandin II (Eugeniin), with oral activity, is the first intermediate of the ellagitannin series derived from 4C1-glucose. It inhibits the resistance of Staphylococcus aureus by disrupting the integrity of the cell wall, leading to the loss of cytoplasmic contents. Additionally, Tellimagrandin II exhibits anti-inflammatory effects and inhibits acetylcholinesterase (AChE) activity, improving memory impairment. Tellimagrandin II holds potential for research in the fields of antibacterial, anti-inflammatory, and neurodegenerative diseases[1][2][3][4].

  

• HY-P1575

  TAT (48-57)	253141-50-3	98.65%
  TAT (48-57) is a cell-permeable peptide, derived from HIV-1 transactivator of transcription (Tat) protein residue 48-57.

  

• HY-P4909

  Autoinducing Peptide I	200010-29-3	99.27%
  Autoinducing Peptide I is a cyclic octapeptide secreted by Staphylococcus aureus and can be used in vaccine research[1].

  

• HY-108251

  Methotrexate metabolite	19741-14-1	98.44%
  Methotrexate metabolite (DAMPA) is an active metabolite of Methotrexate. Methotrexate is a Folic acid (HY-16637) antagonist, widely used as an immunosuppressant. Methotrexate metabolite is an antimalarial agent that inhibits parasite growth under physiological folic acid conditions, with IC50 values of 446 nM and 812 nM against folic acid-sensitive strains and highly resistant strains, respectively. Methotrexate metabolite exhibits pharmacokinetic characteristics of rapid clearance and extensive metabolism, with a mean clearance rate of 1.9 l/kg/h and a mean terminal half-life of 51 minutes. Methotrexate metabolite is promising for research in the field of inflammation[2][3].

  

• HY-118694

  TAPI-0	163958-73-4	98.98%
  TAPI-0 is a TACE (TNF-α converting enzyme; ADAM17) inhibitor with an IC50 of 100 nM. TAPI-0 is a MMP inhibitor and also attenuates TNF-α processing[1][2].

  

• HY-119459

  Fluopyram	658066-35-4	99.33%
  Fluopyram is an orally active succinate dehydrogenase inhibitor, antifungal and nematicide. Fluopyram inhibits succinate dehydrogenase activity, activates CAR/PXR nuclear receptors, and increases caspase-3, TNF-α and NF-κB. Fluopyram inhibits the growth of F. virguliforme, Botrytis cinerea and Alternaria solani with EC50 values of 3.35, 5.389 and 0.244 µg/mL, respectively. Fluopyram induces liver and thyroid tumor formation. Fluopyram is nephrotoxic and embryotoxic[1][2][3][4][5][6][7][8].

  

• HY-121138

  1,8-Dihydroxy-4,5-dinitroanthraquinone	81-55-0	98.00%
  1,8-Dihydroxy-4,5-dinitroanthraquinone (ARDP0006; DHDNE) is a potent inhibitor of serine proteinase NS2B/3, the dengue viral protein. 1,8-Dihydroxy-4,5-dinitroanthraquinone has intermolecular proteinase activity and viral inhibition ability with IC50s of 432 μM and 4.2 μM, respectively. Meanwhile 1,8-Dihydroxy-4,5-dinitroanthraquinone inhibits NS2B/3 cleavage in BHK-21 cells at a dose ranging from 4.2 μM to 432 μM[1].

  

• HY-122920

  Soyasaponin II	55319-36-3	99.81%
  Soyasaponin II is a saponin with antiviral activity. Soyasaponin II inhibits the replication of HSV-1, HCMV, influenza virus, and HIV-1. Soyasaponin II shows potent inhibition on HSV-1 replication. Soyasaponin II serves as a inhibitor for YB-1 phosphorylation and NLRP3 inflammasome priming and could protect mice against LPS/GalN induced acute liver failure[1][2].

  

• HY-123777

  VT-1598	2089320-99-8	99.96%
  VT-1598 is an orally active and selective fungal inhibitor targeting CYP51. VT-1598 shows anti-fungal activity against Candida auris[1][2]. VT-1598 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-123905

  LIN28 inhibitor LI71	1357248-83-9	98.20%
  LIN28 inhibitor LI71 is a LIN28 inhibitor that effectively inhibits LIN28:let-7 binding (IC50: 7 μM). LIN28 inhibitor LI71 can abolish LIN28-mediated oligouridylation of let-7 precursor (IC50: 27 μM). LIN28 inhibitor LI71 has potential application value in LIN28-driven cancer research. LIN28 inhibitor LI71 inhibits the interaction of cold shock protein of Plasmodium falciparum (PfCoSP) with DNA and α/β tubulin and has an inhibitory effect on Plasmodium falciparum[1][2].

  

• HY-124366

  Slingshot inhibitor D3	1715076-35-9	99.46%
  Slingshot inhibitor D3 is a potent, selective, reversible and competitive inhibitor of Slingshot. The IC50 value for Slingshot 1 is 3 μM and the Ki value for Slingshot 2 is 3.9 μM. Slingshot inhibitor D3 has similar inhibitory activities toward both Slingshot 1 and Slingshot 2[1].

  

• HY-127032

  Polyquaternium-1	75345-27-6
  Polyquaternium-1 (Polidronium chloride; PQ-1) is an antimicrobial preservative and an activator of NF-κB. Polyquaternium-1 targets bacterial cell membranes, commonly used in ophthalmic surgery. Polyquaternium-1 adsorbs to the surface of microbial membranes through its polycationic properties, destroying membrane integrity and inducing potassium ion leakage, leading to bacterial death. Polyquaternium-1 exerts antimicrobial effects at a concentration of 0.001% and has low toxicity to mammalian cells. Polyquaternium-1 can be used to prepare products such as glaucoma eye drops (Travoprost preparations containing PQ-1), artificial tears, and contact lens solutions to reduce the ocular surface toxicity of traditional preservatives such as benzalkonium chloride (HY-B2232)[1][2][3].

  

• HY-129476

  L-Canaline	496-93-5
  L-Canaline is a nonprotein amino acid stored in many leguminous plants. L-Canaline is a cytotoxic metabolite catalyzed by L-canavanine and its arginase. L-Canaline is a potent and irreversible inhibitor of ornithine aminotransferase. L-Canaline inhibits the growth of the malaria parasite Plasmodium falciparum with an IC50 of 297 nM. L-Canaline has anticancer and antiproliferative effects[1][2][3].

  

• HY-135416

  Streptolysin O	98072-47-0
  Streptolysin O, a group A streptococcal toxin, is a well-characterized oxygen-labile prototype of a cholesterol-binding bacterial exotoxin. Streptolysin O causes both lysis of cells and cardiotoxicity. Streptolysin O is widely used for the controlled permeabilization of cell membranes. Streptolysin O exists in two forms, a reduced active state and an oxidized reversibly inactive state[1][2][3][4].

  

• HY-135909

  TH1217	1862212-48-3
  TH1217 (ZINC1775962367) is a potent and selective dCTPase pyrophosphatase 1 (dCTPase) inhibitor, with an IC50 of 47 nM. TH1217 enhances the cytotoxic effect of cytidine analogues in leukemia cells. TH1217 also could modulate SARS-Cov-2 interactors, so it shows activity of against COVID-19[1][2].

  

• HY-145295

  Flupyradifurone	951659-40-8	99.69%
  Flupyradifurone is a systemic nAChR agonist that interferes with signal transduction in the central nervous system of sucking pests. Flupyradifurone can be used as a butenolide insecticide[1].

  

• HY-14743B

  Golotimod hydrochloride	1029401-59-9	99.79%
  Golotimod hydrochloride (SCV 07 hydrochloride), an immunomodulating peptide with antimicrobial activity, significantly increases the efficacy of antituberculosis therapy, stimulates thymic and splenic cell proliferation, and improves macrophage function. Golotimod hydrochloride (SCV 07 hydrochloride) inhibits STAT3 signaling and modulates the duration and severity of oral mucositis in animal models that received radiation or a combination of radiation and Cisplatin. Golotimod hydrochloride (SCV 07 hydrochloride) is also a potential therapeutic for recurrent genital herpes simplex virus type 2 (HSV-2)[1][2][3].

  

• HY-150166

  ClpB-IN-1	1453172-23-0	98.00%
  ClpB-IN-1 (compound 7) is a potent ClpB inhibitor. ClpB-IN-1 is a potential antibacterial agents[1].

  

• HY-150736

  ODN 20844	1964506-29-3
  ODN 20844, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3'[1].

  

• HY-B0398A

  Nalidixic acid sodium salt	3374-05-8	99.83%
  Nalidixic acid sodium salt, a quinolone antibiotic, is effective against both gram-positive and gram-negative bacteria. Nalidixic acid acts in a bacteriostatic manner in lower concentrations and is bactericidal in higher concentrations. Nalidixic acid inhibits a subunit of DNA gyrase and topoisomerase IV and reversibly blocks DNA replication in susceptible bacteria[1][2].

  

• HY-B0518A

  Naftifine hydrochloride	65473-14-5	99.82%
  Naftifine hydrochloride is an antibiotic. Naftifine hydrochloride has antifungal activity against dermatophytes, aspergilli, Sporothrix schenckii, and yeasts of the genus Candida. Naftifine hydrochloride can be used for the research of superficial dermatomycoses inhibition[1].

  

• HY-B0724A

  Pazufloxacin mesylate	163680-77-1	99.90%
  Pazufloxacin (T-3761) mesylate is a fluoroquinolone antibiotic.

  

• HY-N10528

  3-Fucosyllactose	41312-47-4
  3-Fucosyllactose (3-Fucosyl-D-lactose) is one of the major fucosylated oligosaccharides found in human breast milk. 3-Fucosyllactose shows prebiotic, immunomodulator, neonatal brain development, and antimicrobial function[1].

  

• HY-P5601A

  Thanatin TFA		99.51%
  Thanatin TFA is an inducible cationic antimicrobial peptide. Thanatin TFA s a pathogen-inducible single-disulfide-bond-containing β-hairpin AMP. Thanatin TFA displays broad-spectrum activity against both Gram-negative and Gram-positive bacteria as well as against various species of fungi with MICs of 0.3-40 µM, 0.6-40 µM and 0.6-20 µM, respectively. Thanatin TFA has the property of competitive replacement of divalent cations from bacterial outer membrane (OM), leading to OM disruption[1][2].

  

• HY-107760A

  Decanoyl-RVKR-CMK TFA	2098497-25-5	98.04%
  Decanoyl-RVKR-CMK (DecRVKRcmk) TFA inhibits over-expressed gp160 processing and HIV-1 replication[1].

  

• HY-A0181BS

  Adenosine monophosphate-13C10,15N5 disodium
  Adenosine monophosphate-13C10,15N5 (AMP-13C10,15N5) disodium is 13C and 15N-labeled Adenosine monophosphate (HY-A0181). Adenosine monophosphate is an adenosine A1 receptor agonist. Adenosine monophosphate has significant antiviral activity against HSV-1 and HSV-2. Adenosine monophosphate is a key cellular metabolite regulating energy homeostasis and signal transduction[1][2][3].

  

• HY-N0470S6

  L-Lysine-d4 hydrochloride	284664-96-6
  L-Lysine-d4 (hydrochloride) is the deuterium labeled L-Lysine. L-lysine hydrochloride is an essential amino acid for humans with various benefits including treating herpes, increasing calcium absorption, reducing diabetes-related illnesses and improving gut health.

  

• HY-W010986

  Fmoc-N-Me-Phe-OH	77128-73-5
  Fmoc-N-Me-Phe-OH is a peptide inhibitor of Malaria Parasite[1].

  

• HY-W012550

  D-Carnitine	541-14-0
  D-Carnitine is an orally available isomer of the essential nutrient L-carnitine that promotes long-chain fatty acid transport into the mitochondrial matrix for beta-oxidation. D-Carnitine has antiparasitic activity[1][2][3].

  

• HY-W014612

  Eugenol acetate	93-28-7	99.76%
  Eugenol acetate (Eugenyl acetate) is an antibacterial, anticancer, anti-inflammatory and antioxidant. Eugenol acetate inhibits NF-κB and enhances the expression of p53 and p21 (WAF1). Eugenol acetate can prevent chemically induced skin cancer, inhibit cancer cell proliferation and induce apoptosis[1][2][3][4].

  

• HY-W016586

  Acivicin	42228-92-2
  Acivicin (AT-125), a natural product produced by Streptomyces sviceus is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin can across the blood-brain barrier and has anti-cancer, anti-parasitic properties[1][2].

  

• HY-W127770

  Pararosaniline hydrochloride	569-61-9
  Pararosaniline hydrochloride (Basic red 9) is a pH-responsive basic dye, as a biological stain to track certain proteins. The pH of the acidified Pararosaniline hydrochloride reagent has a significant effect on the color and the maximum absorption wavelength (λmax) of the reaction system, with its optimum pH 0.48 and a λmax at 549 nm. Pararosaniline hydrochloride is also a strong modifier of RNA splicing. Pararosaniline hydrochloride has been used in the analysis of SO2 and formaldehyde and staining of bacteria or other organisms. Pararosaniline hydrochloride is extensively used in industries like textile, printing, paper, cosmetic, and leather[1][2][3][4][5].

  

• HY-17578

  Pneumocandin B0	135575-42-7
  Pneumocandin B0 (L-688786), the precursor of the antifungal agent Caspofungin acetate, is an antifungal agent belonging to the echinocandin family. Pneumocandin B0, derived from the flamentous fungus Glarea lozoyensis, is a synthetic intermediate of Cancidas[1][2][3].

  

• HY-Y0278

  Chloranil	118-75-2
  Chloranil (Tetrachloro-p-benzoquinone), an orally active metabolite of pentachlorophenol and hexachlorobenzene, is a widely used fungicide. Chloranil can induce ROS production. Chloranil induces neutrophil extracellular traps through the ROS-JNK-NOX2 pathway. Chloranil induces ferroptosis and neuroinflammation. Chloranil induces apoptosis of mouse embryonic stem cells[1][2][3][4][5] .

  

• HY-W008662

  2'-Deoxy-5'-O-DMT-2'-fluorouridine	146954-74-7	99.94%
  2'-Deoxy-5'-O-DMT-2'-fluorouridine, a nucleoside analogue, is a 5’-O-DMTr-5-FUDR derivative with potent anti-yellow fever (YFV) activity[1].

  

• HY-W011834

  2'-O-Methylcytidine	2140-72-9
  2'-O-Methylcytidine is an orally active 2'-substituted nucleoside as a inhibitor of HCV replication with antiviral activity. 2'-O-Methylcytidine inhibits RNA-dependent RNA polymerase (NS5B)-catalyzed RNA synthesis in vitro, in a manner that is competitive with substrate nucleoside triphosphate[1][2][3].

  

• HY-12912

  KDU691	1513879-19-0	99.42%
  KDU691, an imidazopyrazine with potent anti-parasitic activity against blood stage schizonts, gametocytes and liver stages, is a Plasmodium PI4K inhibitor. KDU691 selectively inhibits dihydroartemisinin-pretreated Plasmodium falciparum ring-stage parasites[1].

  

• HY-19791

  N-Acetyl-Calicheamicin	108212-76-6
  N-Acetyl-Calicheamicin (N-Acetyl-Calicheamicin γ), an enediyne anti-tumor antibiotic, is an ADC cytotoxin. N-Acetyl-Calicheamicin can induce DNA damage, and can be used in the synthesis of ADC[1].

  

• HY-100584

  Davercin	55224-05-0
  Davercin (Erythromycin Cyclocarbonate), derivative of Erythromycin, which is active against Gram-positive and some Gram-negative microorganisms.

  

• HY-10367A

  Canertinib dihydrochloride	289499-45-2
  Canertinib dihydrochloride (CI-1033 dihydrochloride) is a potent and irreversible EGFR inhibitor; inhibits cellular EGFR and ErbB2 autophosphorylation with IC50s of 7.4 and 9 nM. Canertinib dihydrochloride is active against vaccinia virus respiratory infection in mice[1][2][3][4].

  

• HY-105048

  Omiganan	204248-78-2	98.64%
  Omiganan is a cationic antimicrobial peptide. Omiganan as an analogue of indolicidin shows activity against gram-positive and gram-negative bacteria but also Candida spp. isolates. Omiganan can be used for the research of alcohol nose and acne[1][2].

  

• HY-107813

  Amikacin sulfate	149022-22-0	99.11%
  Amikacin sulfate (BAY 41-6551 sulfate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin sulfate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin sulfate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin sulfate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria[1][2].

  

• HY-124625

  BI-4464	1227948-02-8	98.64%
  BI-4464 is a highly selective, ATP competitive PTK2/FAK protein kinase inhibitor with an IC50 value of 17 nM. BI-4464 can be used as a PTK2 ligand for constructing proteolysis targeting chimeras (PROTAC).

  

• HY-128337

  AN7973	1620899-32-2	99.37%
  AN7973 is the 6-carboxamide benzoxaborole, blocks intracellular parasite development and inhibits Cryptosporidium growth. AN7973 is orally active, possesses favorable safety, stability, and PK parameters, and is an exciting agent candidate for treating cryptosporidiosis.

  

• HY-13735

  Quinacrine	83-89-6	98.20%
  Quinacrine (Acriquine) is an antimalarial and anti-cancer agent. Quinacrine also inhibits human aldehyde oxidase (IC50: 3.3 μM). Quinacrine has affinity for nucleic acids, and stains DNA and RNA in fixed cells (Ex/Em: 436/525 nm)[1][2][3][4][7].

  

• HY-P9932

  Obiltoxaximab	1351337-07-9
  Obiltoxaximab (ETI 204) is the second and potent anti-protective antigen (PA) monoclonal antibody with immunogenicity. Obiltoxaximab plays a central role in anthrax toxin assembly and target cell intoxication, promoting survival, and inhibiting bacterial spread to the periphery in animal models. Obiltoxaximab can be used in the research of inhalational anthrax, bacteremia and toxemia[1][2][3][4].

  

• HY-10571A

  Delavirdine mesylate	147221-93-0	99.82%
  Delavirdine (U 90152) mesylate is a potent, highly specific and orally active non-nucleoside reverse transcriptase inhibitor (NNRTI). Delavirdine mesylate selectively inhibits HIV-1 reverse transcriptase (RT) (IC50=0.26 μM) over DNA polymerase α (IC50=440 μM) and polymerase δ (IC50>550 μM). Delavirdine mesylate is an inhibitor of HIV-1 replication and can can be used for the study of AIDs[1].

  

• HY-128357

  Ibezapolstat	1275582-97-2
  Ibezapolstat (ACX-362E) is a first-in-class, orally active DNA polymerase IIIC (pol IIIC) inhibitor, with a Ki of 0.325 μM for the DNA pol IIIC from C. difficile. Ibezapolstat is developed for the research of C. difficile infection(CDI)[1][2].

  

• HY-138078

  Lufotrelvir	2468015-78-1	99.87%
  Lufotrelvir (PF-07304814), a phosphate proagent of PF-00835231, acts as a potent 3CLpro protease (Mpro) inhibitor with SARS-CoV-2 antiviral activity. Lufotrelvir binds and inhibits SARS-CoV-2 3CLpro activity with a Ki of 174nM. Lufotrelvir is promising single antiviral agent and also can be used for the research of combination with other antivirals that target other critical stages of the coronavirus life cycle.

  

• HY-150168

  TH-Z145	2260887-57-6
  TH-Z145, a lipophilic bisphosphonate, is a FPPS inhibitor (IC50: 210 nM)[1].

  

• HY-17605A

  Bictegravir sodium	1807988-02-8	99.10%
  Bictegravir sodium is a potent inhibitor of HIV-1 integrase, with an IC50 of 7.5 nM. Bictegravir sodium exhibits potent and selective anti-HIV activity and low cytotoxicity[1].

  

• HY-P99277

  Actoxumab	1245634-25-6	99.52%
  Actoxumab (Anti-C. difficile Toxin A Recombinant Antibody) is a antitoxin antibody against C. difficile toxin A by neutralizing TcdA. Actoxumab prevents both the damage to the gut wall and the inflammatory response, which are associated with C. difficile. Actoxumab has synergy effect with Bezlotoxumab (HY-P9929) targeting TcdB[1].

  

• HY-P99520

  Vilobelimab	2250440-41-4	99.95%
  Vilobelimab (CaCP-29, IFX-1) is a monoclonal anti-C5a antibody to the allergen C5a, a pro-inflammatory complement division product that plays a central role in mediating organ dysfunction. Vilobelimab acts as a C5a inhibitor, inhibiting neutrophil activation, chemotaxis, and reducing inflammatory signalling, and may be used in studies related to sepsis, COVID-19, etc[1].

  

• HY-10447

  Terameprocol	24150-24-1	99.33%
  Terameprocol is an inhibitor targeting the Sp1 transcription factor, which can selectively inhibit the transcription of Sp1-dependent genes. Terameprocol exerts its effects by inhibiting Sp1-mediated gene transcription, such as reducing the expression of genes like CDC2, survivin and HMGB1, thereby arresting the cell cycle, inducing apoptosis, and suppressing the inflammatory response. Terameprocol exhibits anti-proliferative, pro-apoptotic, and anti-inflammatory activities and is currently mainly used in the research of diseases such as cancer and pulmonary arterial hypertension[1][2][3].

  

• HY-12642

  Diethylcarbamazine citrate	1642-54-2	99.95%
  Diethylcarbamazine citrate is an orally active anthropoidal compound. Diethylcarbamazine citrate is an inhibitor of arachidonic acid metabolism of filaria microfilaria. Diethylcarbamazine citrate has anti-inflammatory and antiparasitic activity[1][2][3].

  

• HY-14282

  Lanoconazole	101530-10-3	98.00%
  Lanoconazole is a potent and orally active imidazole antifungal agent, shows a broad spectrum of activity against fungi?in vitro?and?in vivo[1]. Lanoconazole interferes with ergosterol biosynthesis by inhibiting sterol 14-alpha demethylase and blocking fungal membrane ergosterol biosynthesis. Lanoconazole can be used for the investigation of dermatophytosis and onychomycosis[1][2].

  

• HY-16753

  Ridinilazole	308362-25-6	99.02%
  Ridinilazole is a novel antibacterial with MICs range of 0.06-0.25 µg/mL (MIC90=8 µg/mL) against C. difficile.

  

• HY-17426

  Famciclovir	104227-87-4	99.69%
  Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection[1].

  

• HY-17594

  Oxyclozanide	2277-92-1	98.68%
  Oxyclozanide is an orally active salicylanilide anthelmintic agent that mainly acts by uncoupling oxidative phosphorylation in flukes. Oxyclozanide shows good anti-adenovirus, anti-biofilm, antifungal, and antibacterial activity[1][2][3].

  

• HY-18219

  Walrycin B	878419-78-4	98.38%
  Walrycin B, an analogue of toxoflavin, is a potent SARS-CoV-2 3CLpro inhibitor with an IC50 of 0.26 μM. Walrycin B is a WalR response regulator inhibitor. Walrycin B has potent activity of inhibiting bacteria growth[1][2].

  

• HY-18944

  FIT-039	1113044-49-7
  FIT-039 is a selective, ATP-competitive and orally active CDK9 inhibitor with an IC50 of 5.8 μM for CKD9/cyclin T1. FIT-039 does not inhibit other CDKs and other kinases. FIT-039 inhibits replication of HSV-1 (IC50 of 0.69 μM), HSV-2, human adenovirus, and human CMV. FIT-039 is a promising antiviral agent for inhibiting drug-resistant HSVs and other DNA viruses.

  

• HY-A0214

  Colistin methanesulfonate sodium salt	8068-28-8
  Colistin methanesulfonate sodium salt exhibits MIC values ranged from 4 to 16 mg/liter against susceptible strains (P. aeruginosa)[1].

  

• HY-A0279

  Pristinamycin	270076-60-3	99.63%
  Pristinamycin, produced by Streptomyces pristinaespiralis, is an orally active streptogramin-like antibiotic consisting of two chemically unrelated components: Pristinamycin I (PI) and Pristinamycin II (PII). Pristinamycin is highly active against many antibiotic-resistant pathogens, particularly Gram-positive bacteria, including Methicillin-resistant Staphylococcus aureus (MRSA), Vancomycin-resistant S. aureus (VRSA) and Enterococcus faecium (VREF)[1].

  

• HY-B0337

  Sulfadimethoxine	122-11-2	99.80%
  Sulfadimethoxine (Sulphadimethoxine) is a sulfonamide antibiotic used to treat many infections[1][2].

  

• HY-B0439

  Sulfadoxine	2447-57-6	98.24%
  Sulfadoxine(Sulphadoxine) is a long acting sulfonamide that is used, usually in combination with other agents, for respiratory, urinary tract and malarial infections. Sulfadoxine inhibits HIV replication in peripheral blood mononuclear cells.

  

• HY-B0506

  Nadifloxacin	124858-35-1	99.88%
  Nadifloxacin(OPC7251) is a topical fluoroquinolone antibiotic for the treatment of acne vulgaris.

  

• HY-B1235

  Acetohydroxamic acid	546-88-3
  Acetohydroxamic acid is the inhibitor for bacterial and plant urease that can be used for chronic urinary tract infections. Acetohydroxamic acid selectively inhibits arachidonic acid 5-lipoxygenase that is useful in the research of asthma. Acetohydroxamic acid inhibits the formation of advanced glycation end products, and reduces oxidative stress and inflammatory responses. Acetohydroxamic acid exhibits antiviral activity against HIV[1][2][3].

  

• HY-B1275

  Cephalothin sodium	58-71-9	99.33%
  Cephalothin sodium is a first generation cephem antibiotic with a wide range antibacterial activity, is active against gram-positive and gram-negative bacteria.

  

• HY-B2033

  Pyrimethanil	53112-28-0	99.85%
  Pyrimethanil is an anilinopyrimidine and broad-spectrum contact fungicide for the control of Botrytis spp. on a wide variety of crops[1]. Pyrimethanil inhibits the biosynthesis of methionine and other amino acids in Botrytis cinerea. Pyrimethanil can be used for the research of fungal diseases prevention on fruit, vegetable and ornamental plants with mold infection[3].

  

• HY-B2234

  Povidone iodine	25655-41-8
  Povidone iodine (iodopovidone) displays excellent antibacterial activity which can against MRSA and MSSA strains with MICs of 31.25 mg/L and 7.82 mg/L, respectively.

  

• HY-D0162

  Malachite green hemioxalate	2437-29-8
  Malachite green hemioxalate (MCCK1) is a triphenylmethane dye which can be used to detect the release of phosphate in enzymatic reactions. Malachite green hemioxalate has antibacterial activity, which is attributed to inhibition of intracellular enzymes, insertion into DNA and/or interaction with cell membranes. Malachite green hemioxalate is also a potent and selective inhibitor of IKBKE, and inhibits its downstream targets such as IκBα, p65 and IRF3. Malachite green hemioxalate exhibits antitumor activity in vitro and in vivo[1][2][3].

  

• HY-D0955

  Thionin acetate	78338-22-4
  Thionin acetate (Thionine acetate) is a compound present in the seeds, stems, roots, and leaves of many plant species with antibacterial activity. Thionin acetate is a metachromatic cationic histological dye widely used in biological staining[1][2].

  

• HY-N0173

  Cinchonidine	485-71-2
  Cinchonidine (α-Quinidine) is a cinchona alkaloid found in Cinchona officinalis and Gongronema latifolium. A building block used in asymmetric synthesis in organic chemistry. Weak inhibitor of serotonin transporter (SERT) with Kis of 330, 4.2, 36, 196, 15 μM for dSERT, hSERT, hSERT I172M, hSERT S438T, hSERT Y95F, respectively. Antimalarial activities[1].

  

• HY-N0195

  Azomycin	527-73-1
  Azomycin (2-Nitroimidazole) is an antibiotic which can be active against aerobic Gram-positive and Gram-negative bacteria.

  

• HY-N0588

  Deapioplatycodin D	78763-58-3
  Deapioplatycodin D is a triterpenoid saponin isolated from Platycodon grandiflorum, with anti-HCV activity[1].

  

• HY-N1347

  Robinetin	490-31-3
  Robinetin (3,3',4',5',7-Pentahydroxyflavone), a naturally occurring flavonoid with remarkable ‘two color’ intrinsic fluorescence properties, has antifungal, antiviral, antibacterial, antimutagenesis, and antioxidant activity. Robinetin also can inhibit lipid peroxidation and protein glycosylation[1][2][3][4][5].

  

• HY-N1416

  Pogostone	23800-56-8	99.81%
  Pogostone is isolated from patchouli oil with anti-bacterial and anti-cancer activities. Pogostone inhibits both gram negative and gram positive bacteria, also show inhibitory effect on corynebacterium xerosis with a MIC value of 0.098 µg/ml [2]. Pogostone induces cell apoptosis and autophagy[2].

  

• HY-N1448

  Vincetoxicoside B	22007-72-3	99.90%
  Vincetoxicoside B shows antifungal activity[1].

  

• HY-N2381

  Menthone	10458-14-7
  Menthone, an orally active monoterpene that can be isolated from plants and Mentha oil with antibacterial, antitumor, antioxidation, and antivirus properties. Menthone is a main volatile component of the essential oil, and has anti-Inflammatory properties in Schistosoma mansoni infection and rheumatoid arthritis[1][2].

  

• HY-N2500

  Deoxypodophyllotoxin	19186-35-7	99.87%
  Deoxypodophyllotoxin (DPT), a derivative of podophyllotoxin, is a lignan with potent antimitotic, anti-inflammatory and antiviral properties isolated from Anthriscus sylvestris. Deoxypodophyllotoxin, targets the microtubule, has a major impact in oncology not only as anti-mitotics but also as potent inhibitors of angiogenesis[1]. Deoxypodophyllotoxin induces cell autophagy and apoptosis[2]. Deoxypodophyllotoxin evokes increase of intracellular Ca2+ concentrations in DRG neurons[3].

  

• HY-N3405

  Lariciresinol	27003-73-2
  Lariciresinol is an orally active ingredient. Lariciresinol can be isolated from Arabidopsis thaliana. Lariciresinol inhibits α-glucosidase activity (IC50 of 6.97 μM; Ki of 0.046 μM). Lariciresinol dereases Bcl-2, upregulates Bax and induces Apoptosis. Lariciresinol regulates TGF-β and NF-κB pathways. Lariciresinol has antitumor activity against liver cancer, gastric cancer, and breast cancer. Lariciresinol shows antifungal activity and anti-diabetic activity[1][2][3][4][5][6][7][8].

  

• HY-N3733

  Deoxylapachol	3568-90-9	99.26%
  Deoxylapachol is a major cytotoxic component of New Zealand brown alga, Landsburgia quercifolia. Deoxylapachol has antifungal and anti-cancer activity[1].

  

• HY-N5027

  Oxyberberine	549-21-3	99.85%
  Oxyberberine (Oxyberberin; Berlambine) is an orally effective heme oxygenase HO-1 agonist that can activate antioxidant mechanisms by regulating the PI3K/Akt/AMPK signaling pathway. Oxyberberine induces HO-1 expression, increases SOD and GSH-Px activity, inhibits NF-κB-mediated inflammatory responses, and improves insulin sensitivity and glucose metabolism. Oxyberberine has anti-diabetic, neuroprotective, anti-inflammatory and antioxidant effects, and can be used to study type 2 diabetes, traumatic brain injury (TBI) and inflammatory bowel disease[1][2][3].

  

• HY-N6725

  Sterigmatocystine	10048-13-2
  Sterigmatocystine is a precursor of aflatoxins and a mycotoxin produced by common mold strains from Aspergillus versicolor[1][2]. Sterigmatocystine, a inhibitor of G1 Phase and DNA synthesis, is used to inhibit p21 activity. Sterigmatocystine has teratogenic, and carcinogenic effects in animals[3].

  

• HY-N8146

  Bruceantinol	53729-52-5	98.89%
  Bruceantinol, a quassinoid isolated from Brucea javanica, inhibits pepper mottle virus in pepper[1]. Bruceantinol is a STAT3 inhibitor demonstrating potent antitumor activity in in vitro and in vivo human colorectal cancer (CRC) models. Bruceantinol strongly inhibits STAT3 DNA-binding ability (IC50=2.4 pM), blocks the constitutive and IL-6-induced STAT3 activation, and suppresses transcription of MCL-1, PTTG1, survivin and c-Myc[2].

  

• HY-P2193

  TAT-amide	697226-52-1	99.16%
  TAT-amide is a cell penetrating peptide. Cell-penetrating peptides (CPPs) are short amino acid sequences able to enter different cells[1][2].

  

• HY-Y0507

  DL-Serine	302-84-1
  DL-Serine, a fundamental metabolite, is a mixture of D-Serine and L-Serine. DL-Serine has antiviral activity against the multiplication of tobacco mosaic virus (TMV)[1].

  

• HY-Y0839

  Levulinic acid	123-76-2
  Levulinic acid is a precursor for the synthesis of biofuels, such as ethyl levulinate. Levulinic acid is also a 5-keto-pentanoic acid. Levulinic acid can be utilized by the cells as a cosubstrate for biopolymer synthesis. Levulinic acid can be used in antibacterial research[1][2][3].

  

• HY-Z0478

  (-)-Limonene	5989-54-8
  (-)-Limonene ((S)-(-)-Limonene) is orally active and can cause mild bronchoconstriction. (-)-Limonene alleviates cytosolic and mitochondrial oxidative stress by inhibiting the increase of calcium ions (Ca2+) and Ca2+/calmodulin-dependent protein kinase II (CaMKII). It also exerts anti-stress effects by inhibiting the activity of the hypothalamic-pituitary-adrenal (HPA) axis. Additionally, (-)-Limonene can be used as an antibacterial agent in aquaculture[1][2][3][4].

  

• HY-101905

  Moniliformin sodium salt	71376-34-6	99.50%
  Moniliformin sodium salt is a potent mycotoxin isolate from Fusarium moniliforme.

  

• HY-103081

  β-Glucuronidase-IN-1	484006-66-8	99.05%
  β-Glucuronidase-IN-1 is a potent, selective, uncompetitive, and orally active E. coli bacterial β-glucuronidase inhibitor, exhibiting an IC50 and a Ki of 283 nM and 164 nM, respectively[1].

  

• HY-107373

  β-Chloro-L-alanine	2731-73-9
  β-Chloro-L-alanine is a bacteriostatic amino acid analog which inhibits a number of enzymes, including threonine deaminase and alanine racemase.

  

• HY-108365

  Gamithromycin	145435-72-9	99.92%
  Gamithromycin is an antimicrobial agent which can inhibit the growth of MmmSC strains B237 and Tan8 with MICs of 0.00012 and 0.00006 μg/mL, respectively.

  

• HY-108818

  XZ426	1638504-52-5	99.81%
  XZ426 is a potent integrase strand transfer inhibitor with anti- HIV activity[1].

  

• HY-108940

  GlyRS-IN-1	112921-11-6	99.40%
  GlyRS-IN-1 is a glycyl-tRNA synthase (GlyRS) inhibitor extracted from patent WO 2017066459 A1. GlyRS-IN-1 can also inhibit the growth of bacteria[1].

  

• HY-109588

  NITD-349	1473450-62-2	98.98%
  NITD-349 is an MmpL3 inhibitor that shows highly potent anti-mycobacterial activity with MIC50 of 23 nM against virulent Mycobacterium tuberculosis H37Rv.

  

• HY-121388

  Ledol	577-27-5
  Ledol ((+)-Ledol) is an antifungal agent that can be isolated from the essential oil fractions of Rhododendron tomentosum. Ledol is also the expectorant and antitussive agent, which is simultaneously responsible for adverse reactions such as dizziness, nausea and vomiting[1].

  

• HY-121636

  Resolvin D2	810668-37-2
  Resolvin D2 is a metabolite of docosahexaenoic acid (DHA), with anti-inflammatory, anti-infective activities. Resolvin D2 is a potent regulator of leukocytes and controls microbial sepsis. Resolvin D2 is a remarkably potent inhibitor of TRPV1 (IC50 = 0.1 nM) and TRPA1 (IC50 = 2 nM) in primary sensory neurons[1][2][3].

  

• HY-122587

  AVG-233	2151937-80-1	98.87%
  AVG-233 is a potent, orally active RNA dependent RNA polymerase (RdRp) inhibitor. AVG-233 prevents initiation of the viral polymerase complex at the promoter. AVG-233 binding site is present in the L1-1749 fragment. AVG-233 has nanomolar activity against both RSV strains and clinical RSV isolates (EC50=0.14-0.31 μM). AVG-233 can be used for research of respiratory syncytial virus (RSV)[1][2].

  

• HY-124082

  Dodecyl gallate	1166-52-5	99.99%
  Dodecyl gallate (Lauryl gallate) has been widely used as an antioxidant in food manufacturing, as well as in the pharmaceutical and cosmetic industries. Dodecyl gallate also acts antibacterial activity specifically against Gram-positive bacteria. Dodecyl gallate also is active against a highly relevant animal virus such as African swine fever virus (ASFV)[1].

  

• HY-124806

  TTP-8307	950225-08-8
  TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC50=1.2 μM) and poliovirus by interfering with the synthesis of viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP)[1][2].

  

• HY-126490

  Phleomycin	11006-33-0
  Phleomycin is a copper-dependent DNA damaging agent and antibiotic with antitumor activity. Phleomycin binds to DNA and produces ROS in the presence of reducing agents (such as dithiothreitol and glutathione), inducing single-strand and double-strand breaks in DNA. Phleomycin can induce cell apoptosis or mutation and is widely used in cancer inhibition, microbial genetic transformation (as a screening marker to improve fungal transformation efficiency) and DNA repair mechanism research[1][2][3].

  

• HY-128382

  Brilliant Black BN	2519-30-4
  Brilliant black BN (E151) is an azo dye and a food colorant[1]. Brilliant black BN is a promising antiviral agent against EV71 infection via inhibiting the interaction between EV71 and its cellular uncoating factor cyclophilin A. Brilliant black BN has the potential for the investigation of contagious disease[2].

  

• HY-129034

  Ramoplanin	76168-82-6
  Ramoplanin is a broad-spectrum lipoglycodepsipeptide antibiotic derived from the Actinoplanes spp with with activity against gram-positive bacteria[1][2].

  

• HY-135190

  (-)-Cedrene	469-61-4
  (-)-Cedrene (α-cedrene) is a sesquiterpene constituent of cedarwood oils, with anti-leukemic, antimicrobial and anti-obesity activities[1].

  

• HY-136065

  bpV(phen)	42494-73-5
  bpV(phen), a insulin-mimetic agent, is a potent protein tyrosine phosphatase (PTP) and PTEN inhibitor with IC50s of 38 nM, 343 nM and 920 nM for PTEN, PTP-β and PTP-1B, respectively. bpV(phen) inhibits proliferation of the protozoan parasite Leishmania in vitro. bpV(phen) strongly induces the secretion of a large number of chemokines and pro-inflammatory cytokines, and it activates a Th1-type pathway (IL-12, IFNγ). bpV(phen) can also induce cell apoptosis, and has anti-angiogenic and anti-tumor activity[1][2][3][4][5].

  

• HY-136409

  N-Decanoyl-L-homoserine lactone	177315-87-6	99.43%
  N-decanoyl-L-homoserine lactone (C10-HSL) is a N-acyl-homoserine lactone (AHL) N-decanoyl-L-homoserine lactone can inhibit primary root growth in Arabidopsis. N-decanoyl-L-homoserine lactone triggers a transient and immediate increase in the concentrations of cytosolic free Ca2+ and reactive oxygen species (ROS), increases the activity of mitogen-activated protein kinase 6 (MPK6), and induces nitric oxide (NO) production in Arabidopsis roots[1].

  

• HY-144197

  CCR8 antagonist 1	723304-76-5	99.50%
  CCR8 antagonist 1 (compound 15) is a potente human CCR8 antagonist with a Ki of 1.6 nM[1].

  

• HY-145147

  AAA-10	2758171-70-7
  AAA-10 is an orally active gut bacterial bile salt hydrolases (BSH) inhibitor, with IC50s of 10 nM, 80 nM against B. theta rBSH and B. longum rBSH respectively[1].

  

• HY-14648R

  Dexamethasone (Standard)	50-02-2
  Dexamethasone (Standard) is the analytical standard of Dexamethasone. This product is intended for research and analytical applications. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.

  

• HY-148877

  AT-533	908112-37-8	98.86%
  AT-533 is a potent Hsp90 and HSV inhibitor. AT-533 suppresses tumor growth and angiogenesis by blocking the HIF-1α/VEGF/VEGFR-2 signaling pathway. AT-533 also inhibits the activation of the downstream pathways, including Akt/mTOR/p70S6K, Erk1/2 and FAK. AT-533 inhibits the tube formation, cell migration, and invasion of human umbilical vein endothelial cells (HUVECs)[1][2][3].

  

• HY-155048

  BDM91270	2892824-11-0	99.80%
  BDM91270 (compound 29) is an E. coli AcrAB-TolC efflux pump inhibitor with an EC90 of 0.6 μM for wild-type E. coli AcrB. BDM91270 can be used in the study of Escherichia coli drug resistance[1].

  

• HY-156048

  Trifluoromethyl-tubercidin	1854086-05-7	99.12%
  Trifluoromethyl-tubercidin (TFMT) is an inhibitor of 2'-O-ribose methyltransferase 1 (MTr1). Trifluoromethyl-tubercidin can inhibit the replication of influenza A and B viruses by interfering with the cap-snatching process of the influenza virus. Trifluoromethyl-tubercidin has antiviral activity and low toxicity[1].

  

• HY-A0153A

  Cephapirin sodium	24356-60-3
  Cephapirin sodium (Cefapirin sodium) is an ephalosporin antibiotic with broad-spectrum antimicrobial activity[1][2][3].

  

• HY-B0421A

  Mycophenolic acid sodium	37415-62-6	99.98%
  Mycophenolic acid sodium is a potent uncompetitive inosine monophosphate dehydrogenase (IMPDH) inhibitor with an EC50 of 0.24 µM. Mycophenolic acid sodium demonstrates antiviral effects against a wide range of RNA viruses including influenza. Mycophenolic acid sodium is an immunosuppressive agent. Antiangiogenic and antitumor effects[1][2].

  

• HY-B0466B

  Cloxacillin sodium	642-78-4
  Cloxacillin sodium is an orally active antibacterial agent and β-lactamase inhibitor with an IC50 of 0.04 µM. Cloxacillin sodium can suppress the S. aureus-induced inflammatory response by inhibiting the activation of MAPKs, NF-кB and NLRP3-related proteins[1][2][3].

  

• HY-B0497C

  Niclosamide olamine	1420-04-8	99.44%
  Niclosamide (BAY2353) olamine is an orally active antihelminthic agent used in parasitic infection research[1]. Niclosamide olamin is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells[4]. Niclosamide olamin has biological activities against cancer, and inhibits DNA replication in Vero E6 cells[2][3][5].

  

• HY-B0522B

  Ampicillin trihydrate	7177-48-2	99.93%
  Ampicillin trihydrate (D-(-)-α-Aminobenzylpenicillin trihydrate) is a broad-spectrum beta-lactam antibiotic against a variety of gram-positive and gram-negative bacteria.

  

• HY-B1896B

  Piperaquine tetraphosphate tetrahydrate	915967-82-7
  Piperaquine tetraphosphate tetrahydrate is a bisquinoline antimalarial agent. Piperaquine tetraphosphate tetrahydrate can be used in antimalarial research in combination with Artemisinin[1][2].

  

• HY-B2171A

  Carubicin hydrochloride	52794-97-5	98.33%
  Carubicin hydrochloride is a microbially-derived compound. Carubicin hydrochloride is an effective inhibitor of VHL-defective (VHL−/−) CCRCC cell proliferation. Carubicin hydrochloride also induces apoptosis by a mechanism independent of p53 or hypoxia-inducible factor HIF2. Carubicin hydrochloride has the potential for the research of cancer diseases[1][2].

  

• HY-I0447A

  Sodium 4-aminosalicylate dihydrate	6018-19-5	99.95%
  Sodium 4-aminosalicylate dihydrate (4-Aminosalicylic acid sodium salt dihydrate) is an inhibitor for dihydrofolate reductase (DHFR) and an antituberculous agent. Sodium 4-aminosalicylate dihydrate exhibits anti-inflammatory activity and can be used in research of inflammatory bowel disease (IBD). Sodium 4-aminosalicylate dihydrate is orally active[1][1][3].

  

• HY-N0086S

  N6-Methyladenosine-d3	139896-43-8	99.97%
  N6-Methyladenosine-d3 (6-Methyladenosine-d3; N-Methyladenosine-d3) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

  

• HY-N0346A

  (E)-Ethyl p-methoxycinnamate	24393-56-4	99.53%
  (E)-Ethyl p-methoxycinnamate is a natural product found in Kaempferia galangal with anti-inflammatory, anti-neoplastic and anti-microbial effects. (E)-Ethyl p-methoxycinnamate inhibits COX-1 and COX-2 in vitro with IC50s of 1.12 and 0.83 μM, respectively[1].

  

• HY-Y0507S

  DL-Serine-2,3,3-d3	70094-78-9	99.91%
  DL-Serine-2,3,3-d3 is the deuterium labeled DL-Serine. DL-Serine, a fundamental metabolite, is a mixture of D-Serine and L-Serine. DL-Serine has antiviral activity against the multiplication of tobacco mosaic virus (TMV)[1].

  

• HY-131596B

  Emtricitabine triphosphate tetrasodium salt	1188407-46-6	99.06%
  Emtricitabine triphosphate tetrasodium salt is the tetrasodium salt form of Emtricitabine triphosphate (HY-131596). However，Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427)，a nucleoside reverse transcriptase inhibitor，targeting to HIV and HBV[1].

  

• HY-P10208A

  RKH acetate		99.45%
  RKH acetate exerts protective effects against sepsis-induced death and organ damage. RKH acetate can directly bind to Toll-like receptor 4 (TLR4) and block TLR4 signal transduction in immune cells[1].

  

• HY-W013441

  2',3'-Dideoxyadenosine	4097-22-7
  2',3'-Dideoxyadenosine is an inhibitor of HIV replication[1]. Antiretroviral activity[1]. Antiviral efficacy[1].

  

• HY-W018397

  Tiliquinol	5541-67-3
  Tiliquinol (NSC 130828) is a non-absorbed anti-amoebic luminal agent. Tiliquinol is used in combination with tibroquinol. Tiliquinol can be used for the research of amebic liver abscess[1][2].

  

• HY-W034067

  Silver nitrite	7783-99-5
  Silver nitrite is an inorganic compound with the chemical formula AgNO2. Silver nitrite can inhibit cell division and bacterial growth by interfering with protein synthesis[1].

  

• HY-17437

  Mefloquine	53230-10-7	99.96%
  Mefloquine (Mefloquin), an orally active and potent quinoline antimalarial agent, is an anti-SARS-CoV-2 entry inhibitor. Mefloquine is also a K+ channel (KvQT1/minK) antagonist with an IC50 of ~1 μM. Mefloquine can be used for malaria, systemic lupus erythematosus and cancer research[1][2][3].

  

• HY-77036

  Furagin	1672-88-4	99.84%
  Furagin (Furazidine), an analogue of Nitrofurantoin (HY-A0090), is an antibiotic with antibacterial activity against ESKAPE pathogens with MIC values of 0-32 µg/mL. Furagin inhibits human Carbonic anhydrases . Furagin is promising for research of cancer and urinary tract infections (UTIs)[1][2][3][4][5].

  

• HY-B0338

  Rimantadine	13392-28-4	99.86%
  Rimantadine is an orally active inhibitor for M2 protein, that blocks the hydrogen ion channel activity, prevents the entry and replication of the virus, and exhibits board-spectrum antiviral activity[1].

  

• HY-B1300

  Cefonicid sodium	61270-78-8
  Cefonicid sodium is a broadspectrum cephalosporin antibiotic which inhibits the formation of the bacterial cell wall.

  

• HY-Y0493

  HODHBt	28230-32-2
  HODHBt (HOOBt) inhibits STAT5-SUMO interaction by blocking SUMOylation of phosphorylated STAT5. HODHBt enhances the magnitude of IL-15 signaling and significantly increases the natural killer (NK) cell cytotoxicity phenotype and function and the generation of cytokine-induced memory-like (CIML) natural killer (NK) cells. HODHBt can be used for research of HIV-infection and cancer[1].

  

• HY-Y0788

  Indoline	496-15-1
  Indoline is a derivative of Indole (HY-W001132). Indoline can used as the basic structure for CD4 mimetic compounds (CD4mcs), which triggers conformational changes of the HIV-1 envelope glycoprotein (Env) in advance, and causes viral inactivation[1]

  

• HY-12639A

  Bephenium (hydroxynaphthoate)	3818-50-6	99.91%
  Bephenium hydroxynaphthoate is an anthelmintic agent formerly used in the treatment of hookworm infections and ascariasis; B-type AChR activator.

  

• HY-128200

  Pseudomonas quinolone signal	108985-27-9
  Pseudomonas Quinolone Signal (Compound C), a signaling molecule produced by Pseudomonas aeruginosa, can activate lasB. Pseudomonas Quinolone Signal can be used in the study of virulence regulation in Pseudomonas aeruginosa[1].

  

• HY-153879

  C12-TLRa
  C12-TLRa is an ionized adjuvant lipid. C12-TLRa targets TLR7/8 receptors in endosomes. C12-TLRa enhances mRNA delivery as a structural component of LNPs. C12-TLRa enhances innate immune responses. C12-TLRa can be used for the research of SARS-CoV-2 mRNA vaccine[1][2].

  

• HY-Y0669S

  Pipecolic acid-d9	790612-94-1	99.59%
  Pipecolic acid-d9 is the deuterium labeled Pipecolic acid. Pipecolic acid is a metabolite of lysine and an important precursor for many useful microbial secondary metabolites. Pipecolic acid slows ferroptosis in diabetic retinopathy by inhibiting the YAP-GPX4 signaling pathway. In addition, Pipecolic acid can be used as a diagnostic marker for pyridoxine-dependent epilepsy[1][2][3].

  

• HY-W009274

  N-Acetylmuramic acid	10597-89-4
  N-acetylmuramic acid is a component of the bacterial cell wall peptidoglycan, essential for maintaining cell shape and integrity[1]. N-acetylmuramic acid inhibits spore germination by inhibiting a coat-associated hexosaminidase and a core enzyme[2]. N-acetylmuramic acid is required by Bacteroides forsythus for proliferation and the maintenance of its cell shape[3]. N-Acetylmuramic acid inhibits the p38 MAPK/NF-κB signaling pathway, and exhibits anti-inflammatory activity. N-Acetylmuramic acid is orally active[4].

  

• HY-W054064

  6-Chloro-7-deazapurine-β-D-riboside	16754-80-6
  Chloro-7-deazapurine-β-D-riboside is a nucleoside derivative and has antifungal activity[1].

  

• HY-19748

  LED209	245342-14-7	98.40%
  LED209 is a potent and orally active small molecule inhibitor of the bacterial receptor QseC and a potent prodrug with high selectivity for QseC. LED209 inhibits the binding of signaling molecules to QseC. LED209 has antibacterial activity[1].

  

• HY-17506S

  Azithromycin-d3	163921-65-1
  Azithromycin-d3 is the deuterium labeled Azithromycin. Azithromycin (CP-62993) is a macrolide antibiotic useful for the treatment of a number of bacterial infections[1][2].

  

• HY-14904

  Umifenovir	131707-25-0	98.00%
  Umifenovir is a potent, orally active broad-spectrum antiviral agent with activity against a number of enveloped and non-enveloped viruses. Umifenovir is used as an anti-influenza virus agent. Umifenovir could effectively inhibit the fusion of virus with host cells[1][2]. Umifenovir is an efficient inhibitor of SARS-CoV-2 in vitro[2]. Umifenovir shows anti-inflammatory activity[3].

  

• HY-15236

  PSI-6206	863329-66-2	99.89%
  PSI-6206 (RO 2433) is the deaminated derivative of PSI-6130, which is a potent and selective inhibitor of HCV NS5B polymerase. PSI-6206 low potently inhibits HCV replicon with EC90 of >100 μM.

  

• HY-100180

  Delpazolid	1219707-39-7	99.62%
  Delpazolid is a novel oxazolidinone antibiotic agent which can inhibit the growth of MSSA and MRSA with a MIC90 of 2 μg/mL for both of them.

  

• HY-126323

  TCMDC-135051	2413716-15-9	99.90%
  TCMDC-135051 is a highly selective and potent protein kinase PfCLK3 inhibitor with low off-target toxicity. TCMDC-135051 prevents trophozoite-to-schizont transition, disrupts transcription and reduces transmission to the mosquito vector. TCMDC-135051 has antiparasiticidal activity (EC50=320 nM)[1].

  

• HY-108024A

  Ganaplacide hydrochloride	2751586-94-2
  Ganaplacide (KAF156) hydrochloride is a first-in-class, orally active imidazolopiperazine antimalarial agent. Ganaplacide hydrochloride is active against a broad range of Plasmodium species, including drug-resistant parasites. Ganaplacide hydrochloride is parasiticidal against both asexual and sexual blood stages as well as the liver stages of the parasite[1][2].

  

• HY-16776

  Censavudine	634907-30-5	98.71%
  Censavudine (OBP-601; BMS-986001), a nucleoside analog, is a nucleoside reverse transcriptase inhibitor. Censavudine is a potent HIV inhibitor with EC50 ranges from 30 nM to 81 nM and 450 nM to 890 nM for HIV-2 and HIV-1, respectively[1][2]. Censavudine is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-B0299

  Oxibendazole	20559-55-1	99.89%
  Oxibendazole is an effective benzimidazole anthelmintic and is against nema-tode infections. Oxibendazole can induces apoptosis and has anti-cancer and anti-inflammation activities[1][2].

  

• HY-115440

  CRS3123 dihydrochloride	1013915-99-5	99.18%
  CRS3123 (REP-3123) dihydrochloride, a fully synthetic antibacterial agent, potently inhibits methionyl-tRNA synthetase (MetRS) of Clostridioides difficile, inhibiting Clostridioides difficile toxin production and spore formation. CRS3123 dihydrochloride is an oral agent for the research of Clostridioides difficile infection (CDI)[1].

  

• HY-147255

  Canocapavir	2137847-19-7	98.40%
  Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. [1].

  

• HY-147346

  Zelicapavir	2070852-76-3	99.10%
  Zelicapavir (RSV-IN-7) (example 253) is an orally active RSV inhibitor (EC50: < 0.4 μΜ)[1].

  

• HY-P99697

  Leronlimab	674782-26-4
  Leronlimab (PRO 140) is a humanized IgG4 anti-CCR5 monoclonal antibody. Leronlimab inhibits CCR5-mediated HIV-1 viral and lung metastasis in mouse tumor models. Leronlimab can be used for the research of HIV nonalcoholic steatohepatitis (NASH) and cancer[1].

  

• HY-13801

  Fexinidazole	59729-37-2	99.92%
  Fexinidazole (HOE 239) is an orally active, potent nitroimidazole antitrypanosomal agent. Fexinidazole shows trypanocidal activity against T. brucei subspecies and strains with IC50s of 0.7-3.3 μM (0.2-0.9 μg/ml). Fexinidazol has the potential for human sleeping sickness (HAT) caused by infection with T. brucei[1].

  

• HY-P2454

  CSP1	172889-49-5	98.26%
  CSP1 is a potent and selective ComD1 receptor agonist, with an IC50 of 10.3 nM. CSP1 is a major variants of competence-stimulating peptide (CSP), and it can regulate genetic transformation of S. pneumonia by modulating quorum sensing (QS). CSP1 can act as an antibacterial agent[1][2].

  

• HY-10571

  Delavirdine	136817-59-9	99.70%
  Delavirdine (U 90152) is a potent, highly specific and orally active non-nucleoside reverse transcriptase inhibitor (NNRTI). Delavirdine selectively inhibits HIV-1 reverse transcriptase (RT) (IC50=0.26 μM) over DNA polymerase α (IC50=440 μM) and polymerase δ (IC50>550 μM). Delavirdine is an inhibitor of HIV-1 replication and can can be used for the study of AIDs[1].

  

• HY-13784

  Pirodavir	124436-59-5	99.18%
  Pirodavir is a potent, broad-spectrum picornavirus inhibitor, and is highly active against both group A and group B rhinovirus serotypes. Pirodavir is very potent in a virus yield reduction assay (IC90=2.3 nM).

  

• HY-16730

  Sarolaner	1398609-39-6	99.19%
  Sarolaner (PF-6450567) is an orally active and broad-spectrum ectoparasiticide. Sarolaner is an isoxazoline compound which shows efficacy against fleas and ticks on dogs, with a LC80 value of 0.3 μg/mL against C. felis and a LC100 value of 0.003 μg/mL against O. turicata[1].

  

• HY-17431

  Fosamprenavir Calcium Salt	226700-81-8	99.88%
  Fosamprenavir Calcium Salt (GW433908G) is a phosphate ester proagent of the antiretroviral protease inhibitor Amprenavir, with improved solubility[1]. Anti-HIV infection[1].

  

• HY-17519

  Novaluron	116714-46-6	99.51%
  Novaluron is a chemical with insecticide properties, an insect growth regulator, and has adverse effects on mouse sperm[1][2].

  

• HY-17542

  PLpro inhibitor	1093070-14-4	99.88%
  PLpro inhibitor is a potent inhibitor of papain-like protease (PLpro) with an IC50 of 2.6 µM[1]. PLpro inhibitor inhibits SARS-CoV-2 PLpro with an IC50 of 5.0 µM and an EC50 of 21.0 µM[2].

  

• HY-18257

  Rolitetracycline	751-97-3
  Rolitetracycline, a derivative of tetracycline, is a broad-spectrum antibiotic[1][2]. Rolitetracyclin has a role as a protein synthesis inhibitor, an antiprotozoal agent and a proagent[3].

  

• HY-18684

  SIBA	35899-54-8	99.64%
  SIBA (5'-Isobutylthioadenosine) is a transmethylation inhibitor (SAH (HY-19528) analogue), with potent anti-proliferative activity. SIBA reversibly inhibits the production of HSV-1 by blocking methylation, specifically by blocking the 5' end-capping of viral mRNA. SIBA also inhibits the growth of tumour cells in vitro and metastatic spread in vivo. SIBA can be used in cancer, HSV-1 infection and anti-malaria studies[1][2][3].

  

• HY-40156

  5-Fluoroindole	399-52-0
  5-Fluoroindole is an antibacterial agent, that inhibits Mycobacterium tuberculosis with a MIC of 4.7 μM. 5-Fluoroindole exhibits metabolic stability in rat liver microsomes. 5-Fluoroindole exhibits anti-tuberculosis efficacy in mice[1].

  

• HY-A0208

  Rosoxacin	40034-42-2
  Rosoxacin (Acrosoxacin) is an orally active and broad-spectrum antibacterial quinolone antibiotic. Rosoxacin inhibits Gram-negative bacteria, including N. gonorrhoeae (MIC range=0.03-0.125 µg/mL).Rosoxacin can be used in studies of urinary tract infections and certain sexually transmitted diseases[1].

  

• HY-A0253

  Cefacetrile	10206-21-0	98.38%
  Cefacetrile (Cephacetrile) is a broad-spectrum antibiotic that is effective in gram-positive and gram-negative bacterial infection[1][2].

  

• HY-B0126

  Marbofloxacin	115550-35-1	99.79%
  Marbofloxacin is a third generation fluoroquinolone and orally active antimicrobial agent, which has a broad spectrum bactericidal activity and good efficacy. Marbofloxacin can be used for the research of infections by Gram-positive and Gram-negative bacteria and Mycoplasma[1][2][3].

  

• HY-B0359

  Fenticonazole Nitrate	73151-29-8	98.92%
  Fenticonazole Nitrate is an antifungal imidazole ring derivative. Fenticonazole Nitrate operates via hindering ergosterol integration, and sequentially destructing the cytoplasmatic outer membrane. Fenticonazole Nitrate is effective against Gram-positive bacteria, mycoses, and vaginal candidiasis[1][2].

  

• HY-B1085

  Cinoxacin	28657-80-9	99.99%
  Cinoxacin (Compound 64716), a synthetic antimicrobial related to the quinolone class of orally active antibacterial agent. Cinoxacin has antibacterial activity against many gram-negative aerobic bacteria and inhibits bacterial DNA synthesis. Cinoxacin can be used for the research of urinary tract infections and bacterial prostatitis[1][2].

  

• HY-B1194

  Tetramisole hydrochloride	5086-74-8	99.93%
  Tetramisole hydrochloride is an orally active, selective inward rectifier potassium channel agonist with an EC50 of approximately 30 μM for the Kir2.1 subunit. Tetramisole hydrochloride is also an anti-nematode agent that blocks neuromuscular transmission by non-competitive depolarization. Tetramisole hydrochloride promotes the forward transport of Kir2.1 channels, hyperpolarizes the resting potential (RP), shortens the action potential duration (APD), inhibits intracellular calcium overload and the PKA signaling pathway, and exerts anti-arrhythmic and anti-myocardial remodeling activities. Tetramisole hydrochloride can be used in cardiac electrophysiology research and research related to myocardial ischemia and heart failure[1][2].

  

• HY-B1263

  Chlorobutanol	57-15-8
  Chlorobutanol is an orally active and potent inhibitor of platelet aggregation and release and a pharmaceutical preservative with antibacterial activity. Chlorobutanol inhibits thromboxane B2 formation, ATP release, and elevation of cytosolic free calcium caused by collagen, ADP, epinephrine, arachidonic acid and thrombin. Chlorobutanol is active against a wide variety of Gram-positive and Gram-negative bacteria, and several mold spores and fungi. Chlorobutanol is widely used in food and cosmetic industry[1][2][3][4].

  

• HY-B1526

  Thiacetazone	104-06-3	99.73%
  Thiacetazone (Thioacetazone) is a thiourea-containing antitubercular agent and is an orally active antibiotic. Thiacetazone has antibacterial action, which inhibits growth of Mycobacterium tuberculosis H37Rv with a MIC value of 0.1 μg/mL[1].

  

• HY-B2140

  Multifungin	3679-64-9	99.19%
  Multifungin (Bromochlorosalicylanilide) is an antifungal that treats oral candidiasis[1]. Multifungin prevents the formation and accumulation of Zearalenone and reduces the fungal population in stored-crushed corn[2].

  

• HY-B2157

  Robenidine hydrochloride	25875-50-7
  Robenidine hydrochloride is an anticoccidial agent which is also active against MRSA and VRE with MIC50s of 8.1 and 4.7 μM, respectively.

  

• HY-N0397

  Harpagide	6926-08-5	99.97%
  Harpagide is a class of iridoid glycoside isolated from Scrophularia ningpoensis and has antiparasitic activity, which exhibits good in vitro trypanocidal activities against African trypanosomes (T.b. rhodesiense) with an IC50 of 21 μg/mL. Harpagide exerts significant antileishmanial activity against L. donovani with an IC50 value of 2.0 μg/mL. Harpagide also possess significant anti-inflammatory activities[1][2].

  

• HY-N0701

  (-)-Asarinin	133-04-0
  (-)-Asarinin is a tetrahydrofurofurano lignan with various biological activities. (-)-Asarinin induces apoptosis in cancer cells. (-)-Asarinin promotes mitochondrial ROS accumulation, inhibits the STAT3 signaling pathway and induces apoptosis in precancerous cells. (-)-Asarinin is a Src family kinase inhibitor that suppresses mast cell activation. (-)-Asarinin is a non-competitive Δ5-desaturase inhibitor with a Ki of 0.28 mM. (-)-Asarinin possesses pain relief, anti-viral, anti-allergic and anti-tuberculous bacilli, and anti-tumor effects[1][2][3][4].

  

• HY-N0802

  Tenuigenin	2469-34-3	99.24%
  Tenuigenin is a major active component isolated from the root of the Chinese herb Polygala tenuifolia. Tenuigenin protects against S.aureus-induced pneumonia by inhibiting NF-κB activation. Tenuigenin has anti-inflammatory effect[1].

  

• HY-N0818

  Chikusetsusaponin Iva	51415-02-2
  Chikusetsusaponin IVa is an orally active protein kinase activator. Chikusetsusaponin IVa binds to YAP with a KD value of 0.388 mM. Chikusetsusaponin IVa reduces inflammatory mediators (IL-6, IL-10, COX-2) expression, NO production, promotes ROS generation, induces Apoptosis, inhibits MAPK, TAZ, and regulates Nrf2, JAK/STAT. Chikusetsusaponin Iva has anti-H9N2 AIV and anti-endometrial cancer activities. Chikusetsusaponin Iva shows anti-inflammatory, hepatoprotective and osteoprotective effects[1][2][3][4][5][6][7][8][9][10].

  

• HY-N0842

  Bevirimat	174022-42-5
  Bevirimat (PA-457, MPC-4326, YK FH312) is an inhibitor of HIV-1 viral particle maturation.Bevirimat specifically inhibits the final rate-limiting step in Gag processing, preventing the release of the mature capsid protein (CA) from its precursor (CA-SP1), resulting in the production of immature non-infectious viral particles. Bevirimat can be used in HIV-1 infection studies[1][2][3][4].

  

• HY-N1198

  Strictosamide	23141-25-5
  Strictosamide is a compound that can be isolated from Nauclea officinalis. Strictosamide has various activities such as anti-inflammatory, analgesic, anti-Plasmodium, antifungal, and promoting wound healing[1][2][3][4][5].

  

• HY-N1394

  p-Anisic acid	100-09-4	99.76%
  p-Anisic acid (4-Methoxybenzoic acid) is an orally available tyrosinase inhibitor that has antioxidant, anti-anxiety, anti-inflammatory, anti-tumor, anti-diabetic, and preservative properties. p-Anisic acid can be used as a preservative in the cosmetics field[1][2][3][4].

  

• HY-N1673

  2,5-Dihydroxybenzaldehyde	1194-98-5
  2,5-Dihydroxybenzaldehyde (Gentisaldehyde) is a naturally occurring antimicrobial that inhibits the growth of Mycobacterium avium subsp. paratuberculosis. 2,5-Dihydroxybenzaldehyde is active against S. aureus strains with a MIC50 of 500 mg/L[1][2].

  

• HY-N2016

  Arteannuin B	50906-56-4
  Arteannuin B, No. 2000 can be jointly submitted with the blue material. Arteannuin B had anti-SARS-CoV-2 activity, EC50=10.28 μM[1][2][3].

  

• HY-N2150

  Psammaplin A	110659-91-1
  Psammaplin A is a marine metabolite. Psammaplin A is a selective HDAC1 (IC50: 45 nM), DNA methyltransferases (IC50: 18.6 nM) and aminopeptidase N (APN) (IC50: 18 μM) inhibitor. Psammaplin A also inhibits DNA topoisomerase and farnesyl protein transferase. Psammaplin A is a PPARγ activator and induces apoptosis. Psammaplin A has antitumor and anti-inflammatory activities. Psammaplin A has antibacterial activity against Gram-positive bacteria and inhibits DNA synthesis and DNA gyrase activity. Psammaplin A inhibits angiogenesis[1][2][3][4][5][6][7][8].

  

• HY-N3031

  Grosvenorine	156980-60-8	99.60%
  Grosvenorine is the major flavonoid compound of the fruits of Siraitia grosvenorii. Grosvenorine exhibits good antibacterial and antioxidant activities[1].

  

• HY-N6670

  Cefotetan	69712-56-7
  Cefotetan is a binding agent that targets human Raf1 kinase inhibitor protein (hRKIP). Cefotetan binds to hRKIP, reduces the binding space between hRKIP and Raf1 kinase, relieves hRKIP's inhibition of the Ras/Raf1/MEK/ERK signaling pathway, and enhances ERK phosphorylation. Cefotetan can be used to study diseases associated with dysregulated Ras/Raf1/MEK/ERK signaling pathways. Cefotetan is also a broad-spectrum antibacterial agent that disrupts cell wall synthesis by binding to bacterial penicillin-binding proteins (PBPs). It is used to study bacterial infections such as bone, skin, urinary tract, and lower respiratory tract[1][2][3].

  

• HY-N6694

  4-Bromo A23187	76455-48-6
  4-Bromo A23187 is a halogenated analog of the highly selective calcium ionophore A-23187. 4-Bromo A23187, a calcium modulator, induces apoptosis in different cells, including HL-60 cells[1].

  

• HY-N6950

  Hederacolchiside A1	106577-39-3
  Hederacolchiside A1, isolated from Pulsatilla chinensis, suppresses proliferation of tumor cells by inducing apoptosis through modulating PI3K/Akt/mTOR signaling pathway[1]. Hederacolchiside A1 has antischistosomal activity, affecting parasite viability both in vivo and in vitro[2].

  

• HY-N7030

  5,7,3',4'-Tetramethoxyflavone	855-97-0
  5,7,3',4'-Tetramethoxyflavone, an orally active polymethoxyflavones (PMFs) that can be isolated from M. exotica, possesses various bioactivities, including anti-fungal, anti-malarial, anti-mycobacterial, and anti-inflammatory activities. 5,7,3',4'-Tetramethoxyflavone exhibits chondroprotective activity by targeting β-catenin signaling[1].

  

• HY-N7059

  Lactobionic acid	96-82-2
  Lactobionic acid is a bionic acid naturally found in the Caspian Sea yogurt and chemically constituted of a gluconic acid bonded to a galactose. Lactobionic acid has antioxidant, antimicrobial, chelating, stabilizer, acidulant, and moisturizing properties[1].

  

• HY-N7063

  Nerol	106-25-2
  Nerol is a constituent of neroli oil. Nerol Nerol triggers mitochondrial dysfunction and induces apoptosis via elevation of Ca2+ and ROS. Antifungal activity[1][2].

  

• HY-N7476

  Colominic acid sodium salt	70431-34-4
  Colominic acid sodium salt (Polysialic acid sodium salt) could be naturally isolated from the cell wall of Escherichia coli and animals, gives a red color which has an absorption maximum at 530 nm. Colominic acid sodium salt (Polysialic acid sodium salt) possesses anti-bacterial activity[1][2].

  

• HY-N8290

  Lactupicrin	65725-11-3	99.97%
  Lactupicrin (Lactucopicrin) exhibits analgesic, sedative, antimalarial activities and atheroprotective effect. Lactupicrin inhibits acetylcholinesterase (AChE) with an IC50 of 150.3 μM. Lactupicrin is an orally active characteristic bitter sesquiterpene lactone[1][2][3][4][5].

  

• HY-P0269

  Magainin 1	108433-99-4	99.90%
  Magainin 1 (Magainin I) is an antimicrobial and amphipathic peptide isolated from the skin of Xenopus laevis. Magainin 1 exhibits antibiotic activity against numerous Gram-negative and Gram-positive bacteria[1][2][3].

  

• HY-P1064

  Apelin-36(human)	252642-12-9	98.05%
  Apelin-36(human) is an endogenous orphan G protein-coupled receptor APJ agonist, with an EC50 of 20 nM. Apelin-36(human) shows high affinity to human APJ receptors expressed in HEK 293 cells (pIC50=8.61). Apelin-36 has been linked to two major types of biological activities: cardiovascular and metabolic. Apelin-36(human) inhibits the entry of some HIV-1 and HIV-2 into the NP2/CD4 cells expressing APJ[1][2][3][4].

  

• HY-P1629

  Temporin A	188713-69-1	99.65%
  Temporin A is a short alpha-helical antimicrobial peptide isolated from the skin of the frog Rana temporaria. Temporin A is effective against a broad spectrum of Gram-positive bacteria. Temporin A interacts directly with the cell membrane of the microorganism and it is non-toxic to erythrocytes at concentrations that are antimicrobial. Temporin A also has antifungal activities (against yeast-like Candida albicans)[1][1][3].

  

• HY-P2124

  Cyclo(L-Trp-L-Trp)	20829-55-4	99.81%
  Cyclo(L-Trp-L-Trp) is an antibiotic, and shows antimicrobial activity. Cyclo(L-Trp-L-Trp) can inhibit A. baumannii, as well as Candida albicans, Bacillus subtilis, Micrococcus luteus, Saccharomyces cerevisiae, Aspergillus niger, Staphylococcus aureus. Cyclo(L-Trp-L-Trp) can be used in microbial infection research[1].

  

• HY-Y0079

  D-Phenylalanine	673-06-3
  D-Phenylalanine is an atypical D-amino acid and an inhibitor of bacterial biofilm formation. D-Phenylalanine mainly replaces D-alanine (D-Ala) by incorporating into the fourth and fifth positions of bacterial peptidoglycan (PG), changing the cell wall structure, enhancing bacterial acid resistance and affecting biofilm formation. D-Phenylalanine may promote the secretion of peptide tyrosine tyrosine (PYY) in mammals by activating the intestinal GPR109B receptor. D-Phenylalanine can inhibit the maturation of microbial biofilms and promote the release of specific hormones. It can be used for antibacterial preservation, improving the yield of probiotics in the food industry, and studying appetite regulation and blood sugar control in metabolic diseases such as diabetes[1][2][3][4].

  

• HY-100603

  GSK-F1	1402345-92-9
  GSK-F1 (Compound F1) is an orally active PI4KA inhibitor with pIC50 values of 8.0, 5.9, 5.8, 5.9, 5.9 and 6.4 against PI4KA, PI4KB, PI3KA, PI3KB, PI3KG and PI3KD, respectively. GSK-F1 can be used for HCV infection research[1].

  

• HY-100666

  Fosfluconazole	194798-83-9
  Fosfluconazole is a proagent of Fluconazole that is widely used as an antifungal agent.

  

• HY-107486

  Nosiheptide	56377-79-8
  Nosiheptide (Multhiomycin), a thiopeptide antibiotic produced by Streptomyces actuosus, inhibits bacterial protein synthesis and bears a unique indole side ring system and regiospecific hydroxyl groups on the characteristic macrocyclic core. Nosiheptide has been widely used as a feed additive for animal growth[1][2].

  

• HY-108939

  Aminoacyl tRNA synthetase-IN-1	219931-45-0	99.80%
  Aminoacyl tRNA synthetase-IN-1 is a bacterial aminoacyl tRNA synthetase (aaRS) inhibitor.

  

• HY-112861

  Gln-AMS	209543-57-7	99.21%
  Gln-AMS is an aminoacyl-tRNA synthetases (AARS) inhibitor, which binds the A-domain within the NRPS enzymes.

  

• HY-112862

  Arg-AMS	301351-95-1
  Arg-AMS (compound 24) is a potent nanomolar inhibitor of arginyl tRNA synthetase, which displays tightly bound inhibitory characteristics for the A-domains in non-ribosomal peptide synthetases (NRPS) enzymes[1].

  

• HY-113794

  DSHS00884	675104-49-1	99.76%
  DSHS00884 is a potent human papillomavirus E6 inhibitor with an IC50 of 10 μM[1].

  

• HY-120504

  N-Acetyltyramine	1202-66-0	98.90%
  N-Acetyltyramine is a quorum-sensing inhibitor (QSI) compound produced by V. alginolyticus M3-10. N-Acetyltyramine is capable of inhibiting the QS of C. violaceum ATCC 12472. N-acetyltyramine reverses resistance in Doxorubicin-resistant leukemia P388 cells[1][2].

  

• HY-123230

  Trifloxystrobin	141517-21-7	99.49%
  Trifloxystrobin (CGA 279202) is a type of fungicide. Trifloxystrobin has toxicity, antiparasitic activity and induce apoptosis, oxidative stress and DNA damage. Trifloxystrobin can be used for the reaesrch of fungal diseases[1][2][3][4][5].

  

• HY-124801

  ABMA	332108-65-3	98.68%
  ABMA is a broad-spectrum inhibitor of intracellular toxins and pathogens. ABMA efficiently protects cells against various toxins and pathogens including viruses, intracellular bacteria and parasite. ABMA selectively acts at host cell late endosomes rather than targeting toxin or pathogen itself. ABMA has broad-spectrum anti-infection activity[1][2].

  

• HY-125747

  Actinomycin X2	18865-48-0
  Actinomycin X2 (Actinomycin V)，produced by many Streptomyces sp.，shows strong inhibition of MRSA with a minimum inhibitory concentration (MIC) value of 0.25 μg/mL. Actinomycin X2 can be used for cancer and bacterial infection[1][2].

  

• HY-129578

  Asperphenamate	63631-36-7
  Asperphenamate, a fungal metabolite of Aspergillus flatiipes with anti-cancer effect, exhibits IC50 values of 92.3 μM, 96.5 μM and 97.9 μM in T47D, MDA-MB-231 and HL-60 cells, respectively[1][2].

  

• HY-131150

  Ristomycin sulfate	11140-99-1
  Ristomycin sulfate is a glycopeptide antibiotic isolated from Nocardia lurida[1].

  

• HY-131994

  STING agonist-16	652142-94-4
  STING agonist-16 (1a) is a specific stimulator of interferon genes (STING) agonist. STING agonist-16 (1a) can be used as a potential antiviral and antitumor tool[1].

  

• HY-144093

  HPK1-IN-26	2229042-24-2
  HPK1-IN-26 is a HPK1 and GLK inhibitor extracted from patent WO2021254118A1 compound 1. HPK1-IN-26 can be used for the research of animal pathogen infection[1].

  

• HY-150521

  Hispolon	173933-40-9	99.67%
  Hispolon, a polyphenol, can be isolated from Phellinus linteus. Hispolon possesses anticancer, antidiabetic, antioxidant, antiviral, hepatoprotective, anti-diabetic, and anti-inflammatory activities[1].

  

• HY-152117

  Acetyl-CoA Carboxylase-IN-1	179343-23-8	99.16%
  Acetyl-CoA Carboxylase-IN-1 is a potent acetyl-CoA carboxylase (ACC) inhibitor with an IC50 value of ＜5 nM. Acetyl-CoA Carboxylase-IN-1 has antibacterial activity[1].

  

• HY-160267

  iPAF1C	950403-60-8	99.59%
  iPAF1C is a potent inhibitor of polymerase-associated factor 1 complex (PAF1C). iPAF1C has anti-HIV activity[1].

  

• HY-161296

  TH6342		98.90%
  TH6342 is a SAMHD1 modulator that binds to pretetrameric SAMHD1 and prevents its oligomerization and allosteric activation. SAMHD1 is a dNTP triphosphohydrolase and an HIV-1 restriction factor. SAMHD1 can limit the replication of retroviruses and DNA viruses and has antiviral effects. The inhibitory mechanism of TH6342 does not occupy the SAMHD1 nucleotide-binding pocket, gently binds the target, and functions as a chemical probe[1].

  

• HY-171007

  IRF1-IN-2	708245-32-3	99.83%
  IRF1-IN-2 (Compound I-19) is an IRF1 inhibitor. IRF1-IN-2 decreases the recruitment of IRF1 to the promoter of CASP1. IRF1-IN-2 inhibits cell death signaling pathway (i.e., cleavage of Caspase 1, GSDMD, IL-1 and PARP1; inhibits the Pho of TKB1, upregulates GPX4 and downregulates FACL4). IRF1-IN-2 has a protective effect on ionizing radiation-induced inflammatory skin injury[1].

  

• HY-17596A

  Closantel sodium	61438-64-0	99.76%
  Closantel sodium is a halogenated salicylanilide with a potent anti-parasitic activity. Closantel sodium is a potent and highly specific Onchocerca volvulus chitinase (OvCHT1) inhibitor with an IC50 of 1.6 μM and a Ki of 468 nM. Closantel sodium inhibits the O. volvulus L3 to L4 molt of developing[1][2].

  

• HY-A0279A

  Pristinamycin IA	3131-03-1	98.91%
  Pristinamycin IA (Mikamycin B) is a cycle-peptidic macrolactone antibiotic. Pristinamycin IA is a substrate of P-glycoprotein and inhibits its function. Pristinamycin IA is active against StaphyloEoccus and Srreptococcus[1].

  

• HY-B0186B

  Cefoselis sulfate	122841-12-7	99.25%
  Cefoselis sulfate (FK-037), the fourth gen-eration of cephalosporin, is a β-lactam antibiotic. Cefoselis sulfate exhibits good activity against a wide range of Gram-positive and Gram-negative organisms. Cefoselis sulfate penetrates the blood-brain barrier[1][2][3].

  

• HY-B0260R

  Methylprednisolone (Standard)	83-43-2	99.67%
  Methylprednisolone (Standard) is the analytical standard of Methylprednisolone. This product is intended for research and analytical applications. Methylprednisolone is a synthetic corticosteroid with anti-inflammatory and immunomodulating properties. Methylprednisolone improve severe or critical COVID-19 by activating ACE2 and reducing IL-6 levels[3].

  

• HY-B0593A

  Ceftazidime pentahydrate	78439-06-2	99.87%
  Ceftazidime (GR20263) pentahydrate , an antibiotic, has a broad spectrum activity against Gram-positive and Gram-negative aerobic bacteria. Ceftazidime pentahydrate is also active against Enterobacteriaceae (including β-lactamase-positive strains) and is resistant to hydrolysis by most β-lactamases[1].

  

• HY-B0771A

  Cefozopran hydrochloride	113981-44-5
  Cefozopran (SCE-2787) hydrochloride is a semi-synthetic, parenteral, fourth-generation cephalosporin. Cefozopran hydrochloride, an antibiotic, has a broad spectrum of antibacterial activity, inhibiting most of the gram-negative and gram-positive organisms[1][2].

  

• HY-B1282A

  Sulfaquinoxaline sodium salt	967-80-6	99.72%
  Sulfaquinoxaline sodium salt is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections[1][2].

  

• HY-B1802A

  Tosufloxacin tosylate hydrate	1400591-39-0	99.95%
  Tosufloxacin tosylate hydrate (A-61827) is an orally active fluoroquinolone antibiotic. Tosufloxacin shows a broad spectrum of antibacterial activity against gram-positive and gram-negative bacteria[1][2].

  

• HY-B2144H

  Chitosan hydrochloride (80%-90% deacetylated)	70694-72-3
  Chitosan hydrochloride 80%-90% deacetylated (Chitosan HCl 80%-90% deacetylated) is the deacetylated, hydrocholoride form of chitosan. Chitosan hydrochloride 80%-90% deacetylated is a polysaccharide obtained by deacetylating chitin, and exhibits antimicrobial activity against various bacteria and fungi. Chitosan hydrochloride 80%-90% deacetylated is utilized in agriculture, water treatment and pharmaceutical aspects[1].

  

• HY-N1103A

  Vasicine hydrochloride	7174-27-8
  Vasicine hydrochloride (peganine hydrochloride) is a quinazoline alkaloid isolated from Justicia adhatoda. Vasicine hydrochloride activates PI3K/Akt signaling pathway, exhibits antioxidant, anti-inflammatory and antibacterial activities[1][2][3].

  

• HY-N1745A

  3-Deoxysappanchalcone	112408-67-0	99.26%
  3-Deoxysappanchalcone is a naturally-occurring chalcone compound isolated from Caesalpinia sappan L.

  

• HY-N2584A

  Isoxanthohumol	521-48-2	99.91%
  Isoxanthohumol is a prenylflavonoid from hops and beer. Isoxanthohumol exhibits an antiproliferative activity against several human cancer cell lines. Isoxanthohumol inhibits the development of lung metastatic foci in tumor-challenged animals. Isoxanthohumol shows an antiviral activity towards herpes viruses (HSV1 and HSV2) and bovine viral diarrhea virus (BVDV)[1][2].

  

• HY-P0323A

  GP(33-41) TFA		99.62%
  GP(33-41) TFA, a 9-aa-long peptide, is the optimal sequence of the GP1 epitope of lymphocytic choriomeningitis virus. GP(33-41) TFA can upregulate H-2Db molecules at the RMA-S (Db Kb) cell surface with a SC50 of 344 nM[1].

  

• HY-P1791B

  Lactoferrin (17-41) acetate	2828433-30-1	99.49%
  Lactoferrin 17-41 (Lactoferricin B) acetate, a peptide corresponding to residues 17-41 of bovine lactoferrin, has antimicrobial activity against a wide range of microorganisms, including Gram-positive and Gramnegative bacteria, viruses, protozoa, and fungi. Lactoferrin 17-41 acetate has antitumor activities[1][2].

  

• HY-126833A

  Myristoyl coenzyme A lithium	187100-75-0
  Myristoyl coenzyme A lithium is lithium-labeled myristoylated coenzyme A (CoA). Myristoylation is an essential process in viruses and is generally controlled by N-myristoyltransferase (NMT). And NMT is more active in colon epithelial tumors than in normal cells. Reduced Ccoenzyme A (CoA) is known to be a key regulator of NMT activity, whereas oxidized CoA does not allow NMT to promote myristoylation. Myristoyl coenzyme A blocks the demyristoylation process and has potential anticancer and antiviral mechanisms.

  

• HY-W001189

  1,3-Dithiane	505-23-7
  1,3-Dithiane is a protected formaldehyde anion equivalent that could serve as a useful labeled synthon[1]. 1,3-Dithiane is also a sulfur-containing Maillard reaction products (MRPs) found in boiled beef extracts. 1,3-Dithiane shows a potent direct-acting mutagenicity toward S. typhimurium TA98 and TA100[2].

  

• HY-W002116

  Methyl syringate	884-35-5
  Methyl syringate is a selective TRPA1 agonist. Methyl syringate regulates food intake and gastric emptying through a TRPA1-mediated pathway. Methyl syringate is an efficient phenolic mediator for bacterial and fungal laccases. Methyl syringate is a chemical marker of Asphodel monofloral honey. Methyl syringate contributes to the antibacterial activity of honey. Methyl syringate inhibits aflatoxin production. Methyl syringate can contribute to weight suppression. Methyl syringate can be studies for cancer prevention (e.g. lung cancer), suppression of hypoxia-induced inflammatory response and tumorigenesis[1][2][3][4].

  

• HY-W012572

  D-Histidine	351-50-8	99.98%
  D-Histidine is an anti-biofilm agent that targets bacterial quorum sensing systems (such as RhlI/RhlR pathway) and has antibacterial activity. D-Histidine works by non-covalently binding to bacterial regulatory factors or copper ion complexes, selectively inhibiting bacterial biofilm formation and motility. D-Histidine downregulates quorum sensing-related gene expression, reduces the synthesis of virulence factors (such as alginate and proteases), and interferes with bacterial membrane stability, inhibiting biofilm formation, promoting the disintegration of mature biofilms, and enhancing antibiotic sensitivity. D-Histidine is also an efficient catalyst for the salt-induced peptide formation (SIPF) reaction, which promotes the condensation of amino acids to form dipeptides (such as dialanine and dilysine) by forming a complex with copper ions (Cu2+)[1][2][3].

  

• HY-W015764

  T-1105	55321-99-8
  T-1105, a structural analogue of T-705, is a novel broad-spectrum viral polymerase inhibitor. T-1105 inhibits the polymerases of RNA viruses after being converted to ribonucleoside triphosphate (RTP) metabolite. T-1105 has antiviral activity against various RNA viruses. T-1105 can be formed by nicotinamide mononucleotide adenylyltransferase[1][2].

  

• HY-W017522

  Adipic acid	124-04-9
  Adipic acid (Hexanedioic acid) is an orally active compound with anti-HSV-1 activity. Adipic acid has low toxicity and can be used as a food additive and a gelling agent. Adipic acid can also be used in the synthesis of lubricants, artificial resins, plastics, etc[1][2][3].

  

• HY-W412175

  Coproporphyrin III dihydrochloride	68938-73-8	99.57%
  Coproporphyrin III dihydrochloride is a bioactive molecule excreted by nostril- and skin-associated Propionibacterium species that induces aggregation of Staphylococcus aureus (conditions: during early stationary phase growth, low pH: 4-6). Coproporphyrin III dihydrochloride also induces plasma-independent biofilm formation on abiotic surfaces by Staphylococcus aureus. Coproporphyrin III dihydrochloride may be an important mediator of S. aureus accumulation and/or biofilm formation in the nostrils or other sites where Propionibacterium and S. aureus inhabit[1].

  

• HY-12396

  Aminothiazole	96-50-4
  Aminothiazole (2-Aminothiazole), a typical heterocyclic amine, is a precursor for the synthesis of biologically active molecules including sulfur agents, biocides, fungicides, antibiotics, dyes and chemical reaction accelerators[1][2].

  

• HY-N7922

  Urolithin M5	91485-02-8
  Urolithin M5 is a neuraminidase inhibitor that can be isolated from Ganlanye. Urolithin M5 has antiviral activity in vitro and in vivo by inhibiting the activity of viral NA. Urolithin M5 can increase the survival rate and improve pulmonary edema in pr8-infected mouse models. Urolithin M5 can be used in anti-influenza research[1].

  

• HY-B0744A

  Eflornithine hydrochloride	68278-23-9
  Eflornithine hydrochloride is a specific, irreversible inhibitor of the enzyme ornithine decarboxylase. Eflornithine is a medication for the treatment of African trypanosomiasis and excessive facial hair growth in women.

  

• HY-B1637A

  Sodium diethyldithiocarbamate,98%	148-18-5
  Sodium diethyldithiocarbamate,98% (Ditiocarb sodium,98%) is a copper reagent. The reaction with Cu2+ solution resulted in the formation of a complex, which increased the copper displacement precipitation rate. Sodium diethyldithiocarbamate can reduce HIV infection and can be used in adjuvant immune research of high-risk breast cancer[1][2][3].

  

• HY-N10617

  Hygromycin A	6379-56-2
  Hygromycin A is a Borrelia burgdorferi-selective antibiotic. Hygromycin A is a spirochete-specific antibacterial that is conducive to gut health. Hygromycin A can be used for Lyme disease research[1].

  

• HY-17589AR

  Chloroquine (Standard)	54-05-7
  Chloroquine (Standard) is the analytical standard of Chloroquine. This product is intended for research and analytical applications. Chloroquine is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].

  

• HY-W018582

  N-Phenylacrylamide	2210-24-4
  N-Phenylacrylamide is a special polymer showing high affinity with Ochratoxin A, a colorless and crystalline mycotoxin compound. N-Phenylacrylamide can be applied in the field of mycotoxin extraction, and be used for the security research of agricultural commodities and foods made from cereals and grapes[1].

  

• HY-19556

  (+)-SJ733	1424799-20-1	99.45%
  (+)-SJ733 is an anti-malaria agent which can also inhibit Na+-ATPase PfATP4.

  

• HY-19719A

  Miransertib hydrochloride	1313883-00-9	99.74%
  Miransertib hydrochloride (ARQ-092 hydrochloride) is a potent, orally active, selective and allosteric Akt inhibitor with IC50s of 2.7 nM, 14 nM and 8.1 nM for Akt1, Akt2, Akt3, respectively. Miransertib hydrochloride is also a potent the AKT1-E17K mutant protein inhibitor and has the potential for PI3K/AKT-driven tumors and Proteus syndrome research[1]. Miransertib hydrochloride is effective against Leishmania[2].

  

• HY-136149A

  Mpro inhibitor N3 hemihydrate
  Mpro inhibitor N3 hemihydrate is a potent inhibitor of SARS-CoV-2 Mpro with an EC50 of 16.77 μM for SARS-CoV-2. Mpro inhibitor N3 hemihydrate specifically inhibits Mpro from multiple coronaviruses, including SARS-CoV and MERS-CoV. Mpro inhibitor N3 hemihydrate displays inhibition against HCoV-229E, FIPV, and MHV-A59 with individual IC50 of 4.0 μM, 8.8 μM, and 2.7 μM, respectively[1][2].

  

• HY-15971

  AMD 3465 hexahydrobromide	185991-07-5
  AMD 3465 hexahydrobromide (GENZ-644494 hexahydrobromide) is a potent antagonist of CXCR4, inhibits binding of 12G5 mAb and CXCL12AF647 to CXCR4, with IC50s of 0.75 nM and 18 nM in SupT1 cells; AMD 3465 also potently inhibits the replication of X4 HIV strains (IC50: 1-10 nM), but has no effect on CCR5-using (R5) viruses.

  

• HY-D0215

  Safranin	477-73-6
  Safranin (Safranin T) is an important and classical phenazinium dye. Safranin has been extensively used in the academic field as a spectroscopic probe and indicator. Safranin possesses a planar structure and cationic charge. Safranin can readily intercalate into biological macromolecules, including DNA and proteins. Safranin has antibacterial effects against gram-positive bacteria (S. aureus). Safranin can be used as a redox indicator in the determination of metal ion concentration[1][2][3][4].

  

• HY-106005

  MMV390048	1314883-11-8	99.17%
  MMV390048 is a representative of a new chemical class of Plasmodium PI4K inhibitor (Kdapp=0.3 µM). MMV390048 binds to the ATP binding site of Plasmodium PI4K and does not bind to other P. falciparum and human kinases apart from human PIP4K2C, thus alleviating potential kinase-mediated safety concerns. MMV390048 is an antimalarial agent[1].

  

• HY-106541

  Neticonazole	130726-68-0	99.58%
  Neticonazole is an imidazole derivative and a potent and long-acting antifungal agent. Neticonazole has anti-infection and anti-cancer effects[1][2][3].

  

• HY-109197

  Vonafexor	1192171-69-9	99.32%
  Vonafexor (EYP001) is an orally active, non-steroidal and selective FXR agonist. Vonafexor shows significant HBsAg reduction when combined with Peg-IFNα. Vonafexor can be used for anti-HBV research[1][2].

  

• HY-124600

  NVR 3-778	1445790-55-5
  NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity[1].

  

• HY-14956

  Nemonoxacin	378746-64-6	99.80%
  Nemonoxacin (TG-873870) is an orally active and potent broad-spectrum antibiotic. Nemonoxacin shows good inhibitory activity against different species of staphylococci, streptococci, and enterococci, Neisseria gonorrhoeae, and Haemophilus influenza. Nemonoxacin can be used in the study of bacterial infections and community-acquired pneumonia[1][2][3].

  

• HY-17377

  Vicriviroc maleate	599179-03-0	99.91%
  Vicriviroc maleate (SCH-417690 maleate; SCH-D maleate) is a potent, selective, oral bioavailable and CNS penetrated antagonist of CCR5, with a Ki of 2.5 nM, and also inhibits HIV-1 in PBMC cells, with IC90s of 3.3 nM (JrFL), 2.8 nM (ADA-M), 1.8 nM (301657), 4.9 nM (JV1083) and 10 nM (RU 570).

  

• HY-N8533

  Sodium Camptothecin	25387-67-1
  Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA[1][2].

  

• HY-10581A

  Gatifloxacin hydrochloride	121577-32-0	99.94%
  Gatifloxacin hydrochloride (AM-1155; BMS-206584; PD135432) is a potent fluoroquinolone antibiotic with broad-spectrum antibacterial activity. Gatifloxacin hydrochloride inhibits bacterial type II topoisomerases (IC50=13.8 μg/ml for S. aureus topoisomerase IV) and E. coli DNA gyrase (IC50 = 0.109 μg/ml)[1]. Gatifloxacin hydrochloride can be used to treat bacterial conjunctivitis in vivo.

  

• HY-109056

  Elsulfavirine	868046-19-9	99.90%
  Elsulfavirine is a reverse transcriptase inhibitors for HIV-1 infection and is a new anti-HIV agent[1].

  

• HY-126130

  LysRs-IN-2	2170696-76-9	99.92%
  LysRs-IN-2 is a lysyl-tRNA synthetase (KRS) inhibitor with IC50s of 0.015 μM and 0.13 μM for Plasmodium falciparum lysyl-tRNA synthetase (PfKRS) and Cryptosporidium parvum lysyl-tRNA synthetase (CpKRS), respectively[1].

  

• HY-145932

  DMA-135 hydrochloride	2237925-62-9	98.04%
  DMA-135 hydrochloride inhibits enterovirus 71 (EV71) IRES-dependent translation and replication. DMA-135 hydrochloride binds to enterovirus 71 (EV71) SLII domain with moderately high affinity (KD= 520 nM). DMA-135 hydrochloride has no significant toxicity in cell-based studies[1].

  

• HY-147240

  Acloproxalap	1824609-67-7	99.92%
  Acloproxalap is a quinoline-based aldehyde scavenger that can be used in studies of diseases with toxic aldehyde accumulation, such as inflammatory diseases of the eye and skin, respiratory diseases such as pneumonia, organ diseases, and viral infection-related syndromes[1][2].

  

• HY-P99583

  Suvratoxumab	1629620-18-3	98.79%
  Suvratoxumab (MEDI4893) is a long-acting, high-affinity human anti-α-toxin monoclonal antibody (IgG1κ type). Suvratoxumab potently neutralizes α-toxin, a key S. aureus virulence factor. Suvratoxumab improves survival and reduces lung injury in an immunocompromised mice model of pneumonia. Suvratoxumab also enhances the antibacterial activity of Vancomycin (HY-B0671) or Linezolid (HY-10394)[1][2][3].

  

• HY-B0329S

  Isoniazid-d4	774596-24-6	99.86%
  Isoniazid-d4 is the deuterium labeled Isoniazid. Isoniazid (INH) is a proagent and must be activated by a bacterial catalase-peroxidase enzyme KatG. Isoniazid is bactericidal to rapidly dividing mycobacteria and has anti-tuberculostatic activity[1][2][3][4].

  

• HY-12640

  Pyrantel pamoate	22204-24-6	99.97%
  Pyrantel pamoate (Pyrantel embonate) is an orally active anthelmintic and an agonist of the nicotinic acetylcholine receptor (nAChR). Pyrantel pamoate can cause spasmodic muscle paralysis in parasites. Pyrantel pamoate can be used in the study of parasitic infections such as ascariasis, hookworm infections, intestinal worms (pinworm infections), trichinosis and trichinosis[1][2].

  

• HY-13859

  Clevudine	163252-36-6	99.93%
  Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice[1][2][3].

  

• HY-14266

  Dapivirine	244767-67-7	99.80%
  Dapivirine (TMC120), the prototype of diarylpyrimidines (DAPY), is an orally active and nonnucleoside reverse transcriptase inhibitor (NRTI). Dapivirine (TMC120) binds directly to HIV-1 reverse transcriptase. Dapivirine (TMC120) regulates autophagy and induced Akt, Bad and SAPK/JNK activations[1][2].

  

• HY-14800

  Radezolid	869884-78-6	99.27%
  Radezolid (RX-1741) is a oxazolidinone antibiotic. Radezolid is active against Staphylococcus, Chlamydia, and Legionella species, and remains active against Linezolid-resistant strains[1][2].

  

• HY-17516

  Tolfenpyrad	129558-76-5	98.64%
  Tolfenpyrad is an insecticide approved for marketing in Japan in 2002.

  

• HY-19593

  Nikkomycin Z	59456-70-1
  Nikkomycin Z is a nucleoside peptide and an orally active antifungal agent. Nikkomycin Z inhibits chitin synthesis by acting as a competitive analogue of the chitin synthase substrate UDP-N-acetylglucosamine. Nikkomycin Z has antifungal activity[1][2][3].

  

• HY-41404

  Piperonylic acid	94-53-1
  Piperonylic acid is a natural molecule bearing a methylenedioxy function that closely mimics the structure of trans-cinnamic acid. Piperonylic Acid is a selective, mechanism-based inactivator of the trans-cinnamate 4-Hydroxylase. Piperonylic acid has anticancer, antioxidant and antibacterial activities[1][2][3][4].

  

• HY-B0536

  Clinafloxacin	105956-97-6
  Clinafloxacin (AM 1091) is a potent and broad-spectrum fluoroquinolone antibiotic, has inhibitory activity against gram-positive, gram-negative bacterias, and anaerobic pathogens in vitro[1]. Clinafloxacin is against DNA gyrase and topoisomerase IV of?S. aureus with IC50 values of 0.92 μg/ml and 1.62 μg/ml, respectively[2].

  

• HY-B0901

  Bromperidol	10457-90-6	98.48%
  Bromperidol (R-11333) possesses antipsychotic activity, with a high affinity for central dopamine receptors D2. Bromperidol can kill Mycobacteria in a synergistic manner with Spectinomycin[1][2].

  

• HY-B0996

  Hexetidine	141-94-6
  Hexetidine (NSC-17764) is an orally active antibacterial and antifungal agent with broad antibacterial and antifungal activity. Hexetidine combined with IPBC potentiates strong fungal growth inhibition properties. Hexetidine at concentrations greater than 0.1% can cause oral ulceration. Additionally, Hexetidine improves its plaque inhibiting activities combined with zinc and has been confirmed the effectiveness on purulent wound along with ultrasound. Hexetidine is a promising candidate for research in fungus-related diseases and soft tissue purulent-inflammatory[1][2][3][4][5]

  

• HY-B1151

  Climbazole	38083-17-9	98.26%
  Climbazole (BAY-e 6975) is a potent antifungal agent. Climbazole also is a potent inducer of rat hepatic cytochrome P450[2].

  

• HY-B1217

  Bronopol	52-51-7
  Bronopol is an antibacterial agent with low toxicity (to mammals) and high activity (especially against Gram-negative bacteria). Bronopol oxidizes protein thiols, inhibits enzymatic activity, and exhibits antibacterial activity. Bronopol is also a formaldehyde releaser[2][3].

  

• HY-B1340

  Carbadox	6804-07-5
  Carbadox is a quinoxaline-di-N-oxide antibiotic compound which is widely fed to nursery-age pigs to control enteric diseases and improve feed efficiency.

  

• HY-B1885

  Fenitrothion	122-14-5
  Fenitrothion is a broad-spectrum and orally active insecticide/acaricide. Fenitrothion inhibits cholinesterase, AMPKα and IRS1/PI3K/AKT. Fenitrothion causes Apoptosis, reduces SOD activity. Fenitrothion shows insecticidal effect against Rhyzopertha dominica and Tribolium castaneum adults. Fenitrothion is widely used in cotton crops, vegetable crops, fruit crops and field crops, especially rice. Fenitrothion can be used for brain and spleen toxicology studies[1][2][3][4][5][6][7][8].

  

• HY-D0003

  Methyl Blue	28983-56-4
  Methyl blue belongs to the group of triaminotriphenylmethane dyes. Methyl blue is widely used as antiseptic dye in polychrome staining method and has applications in histological and microbiological staining solutions. Methyl blue has been used as a model to study the effect of various catalysts on photodegradation of dyes[1][2].

  

• HY-D0226

  Quinizarin	81-64-1
  Quinizarin (1,4-Dihydroxyanthraquinone), a part of the anticancer agents such as Doxorubicin, Daunorubicin, and Adriamycin, interacts with DNA by intercalating mode (Kd=86.1 μM). Quinizarin is used as a fungicide and pesticide chemical and has shown the ability to inhibit tumor cell growth[1][2].

  

• HY-G0006

  Omeprazole sulfide	73590-85-9	99.88%
  Omeprazole sulfide is an Esomeprazole (HY-17021) precursor. Omeprazole sulfide can be converted to Esomeprazole by Lysinibacillus sp. B71. Esomeprazole can inhibit gastric H+/+ ATP enzyme. Omeprazole sulfide is mainly used in gastroesophageal reflux disease, gastric ulcer and antibacterial research[1][2].

  

• HY-N0354

  Anthraquinone	84-65-1
  Anthraquinone is used as a precursor for dye formation and agrochemicals, existing in different organisms, such as bacteria, fungi, plants, and some animals. Anthraquinone has biological activities: anticancer, antiinflammatory, diuretic, antiarthritic, antifungal, antibacterial, antimalarial and antioxidant. Anthraquinone also plays an important role in the primary metabolism of plants by acting on the electron transport chain through the inhibition of energy transfer in the photosynthetic process. Anthraquinone can intercalates into DNA and inhibits the topoisomerase II (topo II) enzyme, resulting in cell death via Apoptosis[1][2][3][4].

  

• HY-N0626

  Sorbic acid	110-44-1	99.98%
  Sorbic acid is an effective, safe, and non-toxic food preservative. It can effectively inhibit most molds, yeasts, and certain bacteria. Sorbic acid is orally active and can enhance the growth performance of economically important animals (Duroc × Landrace × Yorkshire piglets) by activating the insulin-like growth factor system (IGF), and it can also lead to lipid accumulation by disrupting lipid clearance pathways[1][2][3][4].

  

• HY-N0642

  α-L-Rhamnose monohydrate	6155-35-7
  α-L-Rhamnose monohydrate is a component of the plant cell wall pectic polysaccharides rhamnogalacturonan I and rhamnogalacturonan II. α-L-Rhamnose monohydrate is also a component of bacterial polysaccharides where it plays an important role in pathogenicity.

  

• HY-N1677

  2,6-Dimethoxy-1,4-benzoquinone	530-55-2
  2,6-Dimethoxy-1,4-benzoquinone, a natural phytochemical, is a known haustorial inducing factor. 2,6-Dimethoxy-1,4-benzoquinone exerts anti-cancer, anti-inflammatory, anti-adipogenic, antibacterial, and antimalaria effects[1].

  

• HY-N1739

  Tectoquinone	84-54-8	98.40%
  Tectoquinone (2-Methylanthraquinone) is an inhibitor for SARS CoV-2 major protease (SARS CoV-2 Mpro). Tectoquinone exhibits anti-termite and antiviral activities[1][2].

  

• HY-N1941

  Isosinensetin	17290-70-9	99.90%
  Isosinensetin is a flavonoid compound and an inhibitor of HIV-1 protease and PTP1B (IC50: 2.61 µM; Ki: 0.92 µM). Isosinensetin inhibits P-glycoprotein (P-gp) in MDR1-MDCKII cells. Isosinensetin has multiple activities such as anti-tumor, anti-viral, anti-inflammatory, and antioxidant effects. Isosinensetin can be used in the research of various diseases including cancer, inflammation, osteoporosis, diabetes, etc[1][2][3][4][5].

  

• HY-N2340

  D-(+)-Melezitose	597-12-6
  D-(+)-Melezitose can be used to identify clinical isolates of indole-positive and indole-negative Klebsiella spp.

  

• HY-N2510

  Myristicin	607-91-0	99.89%
  Myristicine is an orally bioavailable serotonin receptor antagonist and weak monoamine oxidase (MAO) inhibitor. Myristicine also exerts anti-cancer effects on gastric cancer cells by inhibiting the EGFR/ERK signaling pathway. Myristicine is the main component of nutmeg essential oil and has anti-cancer, anti-proliferative, antibacterial, anti-inflammatory and apoptosis-inducing effects. Myristicine abuse can produce hallucinogenic effects, organ damage, etc[1][2][3][4].

  

• HY-N3519

  Platycodin D3	67884-03-1
  Platycodin D3 is a triterpenoid saponin isolated from Platycodon grandiflorum, with anti-HCV activity[1].

  

• HY-N3651

  Curzerenone	20493-56-5
  Curzerenone is one of constituents of leaf essential oil extracted from L. pulcherrima. Shows slight inhibitory effective against E. coli[1].

  

• HY-N4314

  Scutellarein tetramethyl ether	1168-42-9	99.93%
  Scutellarein tetramethyl ether (4',5,6,7-Tetramethoxyflavone) is a bioactive compound extracted from Eupatorium odoratum. Scutellarein tetramethyl ether exhibits anti-inflammatory, antibacterial, pro-coagulant, and anti-tumor activities. Scutellarein tetramethyl ether exerts its anti-inflammatory effects by modulating the NF-κB pathway and regulates bacterial resistance through the inhibition of efflux pumps. Additionally, Scutellarein tetramethyl ether accelerates coagulation time via the endogenous coagulation pathway. Studies have shown that Scutellarein tetramethyl ether can effectively inhibit the growth of the liver cancer cell line HepG2 (IC50= 20.08 μg/mL)[1][2][3][4].

  

• HY-N6777

  Penicillic acid	90-65-3
  Penicillic acid is a polyketide mycotoxin produced by several species of Aspergillus and Penicillium. Penicillic acid exhibits cytotoxicity in rat alveolar macrophages (AM) in vitro. Penicillic acid inhibits Fas ligand-induced apoptosis by blocking self-processing of caspase-8[1][2].

  

• HY-N7101

  Cefpodoxime Proxetil	87239-81-4	98.15%
  Cefpodoxime proxetil is an orally administered broad spectrum third-generation cephalosporin. Cefpodoxime proxetil has anti-bacterial activity. Cefpodoxime proxetil binds to penicillin binding proteins (PBPs) which inhibits peptidoglycan synthesis, finally results in interfering bacterial cell wall biosynthesis[1][2].

  

• HY-N8432

  Dipyrithione	3696-28-4	99.93%
  Dipyrithione is a potent antimicrobial agent. Dipyrithione shows antifungal activity and antiproliferative activity. Dipyrithione induces apoptosis and cycle arrest at G1 phase. Dipyrithione shows anti-inflammatory activity in vivo. Dipyrithione shows anti-tumor activity. Dipyrithione has the potential for the research of dermatophytosis[1][2][3].

  

• HY-N8599

  Cichoriin	531-58-8
  Cichoriin is an active compounds against SARS-CoV-2, and may be a potential candidate in researching severe COVID-19[1].

  

• HY-NP023

  Lactoferrin (human)
  Lactoferrin (human) is an iron-binding protein. Lactoferrin (human) has antimicrobial activity against a wide range of microorganisms, including Gram-positive and Gramnegative bacteria, viruses, protozoa, and fungi. Lactoferrin (human) can be used to culture mutans Streptococcus in iron-restricted medium[1].

  

• HY-P0272

  Peptide T	106362-32-7	98.86%
  Peptide T is an octapeptide from the V2 region of HIV-1 gp120. Peptide T is a ligand for the CD4 receptor and prevents binding of HIV to the CD4 receptor.

  

• HY-P1491

  HIV-1 TAT (48-60)	220408-24-2	99.80%
  HIV-1 TAT (48-60) is a cell-penetrating peptide derived from the human immunodeficient virus (HIV)-1 Tat protein residue 48-60. It has been used to deliver exogenous macromolecules into cells in a non-disruptive way.

  

• HY-P1938

  Cyclo(L-Pro-L-Val)	2854-40-2	98.43%
  Cyclo(L-Pro-L-Val) is a 2,5-diketopiperazine, with toxic activity against phytopathogenic microorganisms (such as R. fascians LMG 3605). Cyclo(L-Pro-L-Val) shows toxicity similar to Chloramphenicol (HY-B0239) with comparable concentration. Cyclo(L-Pro-L-Val) can also inhibit gram-positive phytopathogenic bacterium. Cyclo(L-Pro-L-Val) has potential development as biopesticide[1].

  

• HY-P1958

  Histone H4 (2-21)	667899-73-2	98.17%
  Histone H4 (2-21) is the core histones associated with chromatinization of herpes simplex virus 1 (HSV-1) genomes[1].

  

• HY-P2274

  Argifin	243975-37-3	98.46%
  Argifin is a sub-nanomolar chitinase inhibitor produced by soil microorganisms, with IC50s of 0.025 μM, 6.4 μM , 1.1 μM and 4.5 μM for SmChiA (Serratia marcescens chitinaese A), SmChiB, Aspergillus fumigatus chitinase B1 and human chitotriosidase, respectively[1].

  

• HY-100029

  Bay 41-4109	298708-81-3	99.24%
  BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.

  

• HY-100749

  HeE1-2Tyr	2245195-67-7
  HeE1-2Tyr, a pyridobenzothiazole compound, is a flavivirus RNA dependent RNA polymerases (RdRp) inhibitor. HeE1-2Tyr significantly inhibits West Nile, Dengue and SARS-CoV-2 RdRps (IC50 of 27.6 μM) activity in vitro[1][2].

  

• HY-103251

  PF-5081090	1312473-63-4	99.88%
  PF-5081090 (LpxC-4) is a potent LpxC inhibitor, is a rapidly bactericidal with broad-spectrum activity. PF-5081090 serves as a regulator of lipid A biosynthesis in Gram-negative pathogens[1][2].

  

• HY-106859

  Letrazuril	103337-74-2	99.63%
  Letrazuril is an anti-HIV agent.

  

• HY-107801

  Inosine pranobex	36703-88-5	98.11%
  Inosine pranobex is an orally active immunomodulator. Inosine pranobex has broad-spectrum antiviral activity. Inosine pranobex inhibits human immunodeficiency virus (HIV), herpes simplex virus (HSV), vaccinia virus (VACV), human tumor virus (HPV), Cytomegalovirus, influenza virus (INFV), parainfluenza virus (PIV), and Epstein-Barr virus [2][3][4][5].

  

• HY-108261

  Tomeglovir	233254-24-5	99.71%
  Tomeglovir is a potent anti-CMV agent, inhibiting processing of viral DNA-concatemers, with IC50s of 0.34 μM and 0.039 μM for HCMV and MCMV.

  

• HY-108307

  Micronomicin sulfate	66803-19-8
  Micronomicin sulfate (Gentamicin C2b sulfate) is an aminoglycoside antibiotic isolated from Micromonospora. Micronomicin sulfate is a broad-spectrum antibiotic close to the gentamicin-type antibiotics, exhibits a high activity against Pseudomonas, Proteus, Klebsiella pneumoniae, Serratia, etc (MIC=0.001-8.3 μg/ml)[1][2].

  

• HY-108450

  Polygodial	6754-20-7	98.74%
  Polygodial (Poligodial) is an antifungal potentiator[1]. Polygodial is a sesquiterpene with anti-hyperalgesic properties[2].

  

• HY-108485

  Damnacanthal	477-84-9
  Damnacanthal is an anthraquinone isolated from the root of Morinda citrifolia. Damnacanthal is a highly potent, selective inhibitor of p56lck tyrosine kinase activity. Natural Damnacanthal inhibits p56 lck autophosphorylation and phosphorylation of exogenous substrates with IC50s of 46 nM and 220 nM, respectively. Damnacanthal is a potent inducer of apoptosis with anticancer activity. Damnacanthal also has antinociceptive, anti-inflammatory effects in mice and anti-fungal activity against Candida albicans[1][2][3][4].

  

• HY-111023

  Nemonoxacin malate	951163-60-3	99.43%
  Nemonoxacin (TG-873870) malate is a nonfluorinated quinolone antibiotic. Nemonoxacin malate has broad-spectrum activity against Gram-positive, Gram-negative and atypical pathogens. Nemonoxacin malate can inhibit drug-resistant Streptococcus pneumoniae and (HY-121544) Methicillin-resistant Staphylococcus aureus. Nemonoxacin malate can be used for the research of community-acquired pneumonia[1][2].

  

• HY-111151

  AR-9281	913548-29-5
  AR9281 (APAU) is a potent, selective and orally active soluble epoxide hydrolase (s-EH) inhibitor. AR-9281 can inhibits human sEH (HsEH) and murine sEH (MsEH) with IC50 values of 13.8 nM and 1.7 nM, respectively. AR9281 can be used for the research of inflammation, hypertension and type 2 diabetes[1][2].

  

• HY-116637

  Tetrahydromagnolol	20601-85-8	99.79%
  Tetrahydromagnolol (Magnolignan), the main metabolite of Magnolol, is a potent and selective cannabinoidCB2 receptor agonist (EC50 =170 nM) and GPR55 antagonist. The Ki of Tetrahydromagnolol for CB2 is 416 nM, 20-fold higher than for the CB1 receptor. Magnolol shows antifungal, anti-inflammatory and analgesic effects[1][2][3][4].

  

• HY-121410

  Narasin	55134-13-9
  Narasin is a cationic ionophore antibiotic and coccidiostat agent. Narasin inhibits NF-κB signaling and induces tumor cells apoptosis. Narasin has antimicrobial, antiviral anticancer activity. Narasin inhibits tumor metastasis and growth of ERα‑positive breast cancer cells by inactivation of the TGF-β/SMAD3 and IL‑6/STAT3 signaling pathways[1][2][3].

  

• HY-121618

  α-Thujone	546-80-5
  α-Thujone is a monoterpene isolated from Thuja occidentalis essential oil with potent anti-tumor activities. α-Thujone is a reversible modulator of the GABA type A receptor and the IC50 for α-Thujone is 21 μM in suppressing the GABA-induced currents. α-Thujone induces ROS accumulation-dependent cytotoxicity, also induces cell apoptosis and autophagy. α-Thujone has antinociceptive, insecticidal, and anthelmintic activity, and can cross the blood-brain barrier[1][2][3].

  

• HY-121999

  (+)-cis-Abienol	17990-16-8
  (+)-cis-Abienol (Compound Z-abienol), a diterpenoid, can be isolated from leaves of tobacco. (+)-cis-Abienol inhibits hyphal growth of P. nicotianae[1].

  

• HY-124796

  Qstatin	902688-24-8
  QStatin is a potent and selective inhibitor of SmcR (V. harveyi LuxR homologue) with an EC50 of 208.9 nM, binding tightly to SmcR and changes the flexibility of the protein, thereby altering its transcription regulatory activity. QStatin shows pan-QS (Vibrio quorum sensing) inhibitor activity in diverse Vibrio species and attenuates their virulence in an aquatic host. QStatin may be a sustainable antivibriosis agent useful in aquacultures[1].

  

• HY-126113

  KIN101	610753-87-2	99.44%
  KIN101 is a potent RNA viral inhibitor with IC50s of 2 μM, >5 μM for influenza virus and Dengue virus (DNV), respectively. KIN101, an isoflavone agonist of IRF-3 dependent signaling, induces IRF-3 nuclear translocation. KIN101 has broad-spectrum activity against RNA viruses[1][2].

  

• HY-129405

  N-(Ketocaproyl)-DL-homoserine lactone	76924-95-3	98.45%
  N-(Ketocaproyl)-DL-homoserine lactone is a natural, very active ligand of LuxR. N-(Ketocaproyl)-DL-homoserine lactone is a quorum sensing (QS) autoinducer[1].

  

• HY-131011

  Furanone C-30	247167-54-0
  Furanone C-30 is a quorum sensing inhibitor. Furanone C-30 can effectively inhibit bacterial biofilm formation by S. mutans and its luxSmutant strain[1].

  

• HY-133154

  Carboxyaminoimidazole ribotide	6001-14-5	98.31%
  Carboxyaminoimidazole ribotide (CAIR) is a metabolite of E. coli. Carboxyaminoimidazole ribotide can be used to detect distinctive features of E. coli PurE active site and synthesis fungal de novo purine[1].

  

• HY-135659

  BSH-IN-1	2553217-91-5
  BSH-IN-1 is a potent and covalent inhibitor of gut bacterial recombinant bile salt hydrolases (BSHs) with IC50s of 108 nM and 427 nM for B. longum BSH (Gram positive) and B. theta BSH (Gram negative), respectively[1].

  

• HY-135813

  LtaS-IN-1	877950-01-1
  LtaS-IN-1 (compound 1771) is a potent small-molecule inhibitor of Lipoteichoic acid (LTA) synthesis in multidrug-resistant (MDR) E. faecium and by altering the cell wall morphology. LtaS-IN-1 alone inhibits Enterococcus.spp 28 strains with varying MIC values ranging from 0.5 μg/mL to 64 μg/mL. LtaS-IN-1 combination with antibiotics abolishs multidrug-resistant E. faecium growth almost completely[1].

  

• HY-136637

  NPD-001	469863-16-9	99.50%
  NPD-001 is a potent Trypanosoma brucei phosphodiesterases TbrPDEB1 and TbrPDEB2 inhibitor, with IC50 values of 4 and 3 nM, respectively. NPD-001 also inhibits human PDEs (phosphodiesterases). NPD-001 shows good anti trypanosomal activity, with an IC50 of 80 nM[1].

  

• HY-13735C

  l-Atabrine dihydrochloride	56100-42-6	98.35%
  l-Atabrine dihydrochloride is a less active enantiomer of quinacrine which displays antiprion activity.

  

• HY-13986A

  (R)-Merimepodib	2748420-50-8
  (R)-Merimepodib is the isomer of Merimepodib (HY-13986), and can be used as an experimental control. Merimepodib (VX-497) is a noncompetitive and oral inhibitor of inosine monophosphate dehydrogenase (IMPDH) with broad spectrum antiviral activities.

  

• HY-14273S

  Isavuconazole-d4	1346598-58-0	99.88%
  Isavuconazole-d4 is a deuterium labeled Isavuconazole (BAL-4815). Isavuconazole is a triazole proagent with antifungal activity against yeasts, molds, and dimorphic fungi[1].

  

• HY-143899

  FBA-IN-1	2605897-57-0	98.79%
  FBA-IN-1 (compound 2a11) is a first-in-class, covalent and allosteric inhibitor of fructose-1,6-bisphosphate aldolase from Candida albicans (CaFBA). FBA-IN-1 inhibits the growth of Azole-resistant strains 103 with the MIC80 of 1 μg/mL[1].

  

• HY-145079

  Bunamidine hydrochloride	1055-55-6	99.79%
  Bunamidine hydrochloride is a veterinary anti-platyhelmintic agent used for Echinococcus granulosus and Taenia hydatigena[1].

  

• HY-145307

  DATPT	2891582-75-3	99.50%
  DATPT is a 12WLVSKF17 peptide-mimetic molecule. DATPT blocks the SNX9-p47phox interaction in the endosome and suppresses reactive oxygen species and inflammatory cytokine production. DATPT with anti-inflammatory and antibacterial functions has the potential for the research of sepsis[1].

  

• HY-148836

  c-Myc inhibitor 6	2768765-58-6	98.04%
  c-Myc inhibitor 6 (compound A102) is a c-Myc inhibitor. c-Myc inhibitor 6 decreases cancer cell viability and degrades c-Myc protein. c-Myc inhibitor 6 can be used for the research of c-Myc imbalance, such as cancer, cardiovascular diseases, and viral infection[1].

  

• HY-15232B

  Tenofovir alafenamide hemifumarate	1392275-56-7
  Tenofovir alafenamide hemifumarate (GS-7340 hemifumarate) is an investigational oral proagent of Tenofovir. Tenofovir is a HIV-1 nucleotide reverse transcriptase inhibitor.

  

• HY-153335

  Enpp-1-IN-16	2289739-47-3	99.11%
  Enpp-1-IN-16 (compound 54) is an ENPP1 inhibitor. Enpp-1-IN-16 has the potential to study cancer, especially in cases of high ENPP1 expression or elevated cytoplasmic DNA levels. Enpp-1-IN-16 can also be used in other diseases mediated by ENPP1, such as bacterial or viral infections, insulin resistance and type II diabetes, chondrocalcinosis and osteoarthritis, calcium pyrophosphate deposition disorder (CPPD), low Phosphatase disease and soft tissue calcification disorders[1].

  

• HY-160922

  BAY 249716	696628-24-7	99.03%
  BAY 249716 stabilizes all three p53 protein variants. BAY 249716 also has antitubercular activity (IC90: <0.10 μg/mL for Tuberculosis)[1][2].

  

• HY-A0248A

  Polymyxin B1	4135-11-9
  Polymyxin B1 is a potent antimicrobial lipopeptide first derived from Bacilus polymyxa. Polymyxin B1 is the major component in Polymyxin B (HY-A0248). Polymyxin B1 can induce lysis of bacterial cells through interaction with their membranes. Polymyxin B1 has the potential for multidrug-resistant Gram-negative bacterial infections treatment[1][2].

  

• HY-B0330R

  Levofloxacin (Standard)	100986-85-4	99.96%
  Levofloxacin (Standard) is the analytical standard of Levofloxacin. This product is intended for research and analytical applications. Levofloxacin ((-)-Ofloxacin) is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin inhibits the DNA gyrase and topoisomerase IV. Levofloxacin can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin shows anti-orthopoxvirus activity[1][2][3][4][5].

  

• HY-B1275A

  Cephalothin	153-61-7	99.34%
  Cephalothin (Cephalotin) is a semi-synthetic cephalosporin antibiotic and beta-lactam antibiotic. Cephalothin inhibits class C β-lactamase AmpC, with an Ki of 0.32 µM. Cephalothin binds to penicillin-binding proteins, interfering with the cross-linking of peptidoglycan in the cell wall and thus hindering the normal synthesis of the bacterial cell wall. Cephalothin shows antibacterial activity against a variety of bacteria. Cephalothin can be used in hematological and nephrotoxicity studies[1][2][3][4][5][6][7].

  

• HY-B1864A

  Kasugamycin hydrochloride	19408-46-9	99.95%
  Kasugamycin (Ksg) hydrochloride hydrate is an antibiotic that binds to 30s and 70s ribosomes but not to the 50s subunit, and has anti-infective activity. Kasugamycin hydrochloride hydrate mimics mRNA nucleotides, disrupts tRNA binding and inhibits canonical translation initiation. Kasugamycin hydrochloride hydrate increases the sensitivity of mycobacteria to Rifampicin (HY-B0272) in vitro and in mouse infection models[1][2][3].

  

• HY-B1896A

  Piperaquine phosphate	85547-56-4	98.33%
  Piperaquine phosphate is a bisquinoline antimalarial agent. Piperaquine phosphate can be used in antimalarial research in combination with Artemisinin[1][2].

  

• HY-P0012A

  Aviptadil acetate	1444827-29-5	99.87%
  Aviptadil acetate is an analog vasoactive intestinal polypeptide (VIP) with potent vasodilatory effects. Aviptadil acetate induces pulmonary vasodilation and inhibits vascular SMCs proliferation, platelet aggregation. Aviptadil acetate can be used for the research of pulmonary fibrosis, pulmonary arterial hypertension (PAH) and SARS-CoV-2 caused respiratory failure, et al[1].

  

• HY-P0233A

  Melittin TFA		99.17%
  Melittin TFA is a PLA2 activator, stimulates the activity of the low molecular weight PLA2, while it does not the increase activity of the high molecular weight PLA2[1][2].

  

• HY-P99586

  Suptavumab	1629615-23-1
  Suptavumab (REGN2222) is a human monoclonal antibody. Suptavumab can bind and block a conserved epitope on RSV A and B subtypes. Suptavumab can be used for the research of RSV infection[1][2].

  

• HY-P99699

  Lesofavumab	1807960-57-1	98.27%
  Lesofavumab (MHAB5553A) is a human IgG1κ anti-influenza B virus antibody[1].

  

• HY-124237A

  N-Octanoyl-L-homoserine lactone	147852-84-4	99.58%
  N-octanoyl-L-Homoserine lactone is a small diffusible signaling molecule involved in quorum sensing, thereby controlling gene expression and affecting cellular metabolism. N-octanoyl-L-Homoserine lactone can be used for the infection prevention and regulation of virulence in cystic fibrosis.

  

• HY-137697D

  ddCTP trisodium
  ddCTP trisodium is one of 2',3'-dideoxyribonucleoside 5'-triphosphates (ddNTPs) that acts as chain-elongating inhibitor of DNA polymerase for DNA sequencing. ddCTP trisodium is a nucleoside analog that targets the reverse transcriptase of human immunodeficiency virus (HIV). ddCTP trisodium can be used for AIDS research[1][2].

  

• HY-139602C

  (-)-JNJ-A07	2135640-92-3
  (-)-JNJ-A07 is a potent and selective DENV inhibitor with an EC50 value of 31 nM[1].

  

• HY-149906C

  Trecovirsen sodium		98.83%
  Trecovirsen sodium is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.

  

• HY-W012009

  2'-Deoxy-2'-fluorocytidine	10212-20-1	99.98%
  2'-Deoxy-2'-fluorocytidine, an nucleoside analog, is a potent inhibitor of Crimean-Congo hemorrhagic fever virus (CCHFV) replication. 2′-deoxy-2′-fluorocytidine can act synergistically with T705 to increase the potency of both compounds antiviral effects on CCHFV replication[1].

  

• HY-W013967

  1,6-Diphenylhexa-1,3,5-triene	1720-32-7	98.26%
  1,6-Diphenylhexa-1,3,5-triene is a fluorescent probe[1].

  

• HY-W015912

  2-Acetylfuran	1192-62-7	99.67%
  2-Acetylfuran (2-Furyl methyl ketone), an important flavour compound or intermediate in foods, is isolated from essential oils, sweet corn products, fruits and flowers. 2-Acetylfuran also can be formed from glucose and glycine by Maillard reaction. 2-Acetylfuran can be used to synthesis Cefuroxime. 2-acetylfuran can be used in the synthesis of reagents with antiamoebic activity[1][2][3].

  

• HY-W017401

  Benzisothiazolone	2634-33-5
  Benzisothiazolone is an isothiazolone fungicide. Benzisothiazolone has growth inhibiting activity against E. coli ATCC 8739 and saccharornyces pombe NCYC 1354. Benzisothiazolone can be used in the study of growth inhibition model [1].

  

• HY-W020182

  α-Terpinene	99-86-5
  α-Terpinene (Terpilene) is a monoterpene found in the essential oils of a large variety of foods and aromatic plants such as Mentha piperita. α-Terpinene is active against Trypanosoma evansi and has the potential for trypanosomosis treatment. α-Terpinene has antioxidant and antifungal properties[1][2][3][4].

  

• HY-W279260

  APOBEC3G-IN-1	14261-92-8
  APOBEC3G-IN-1 (MN136.0185) is a potent HIV inhibitor, targeting APOBEC3G[1].

  

• HY-Y0366S1

  Lauric acid-d23	59154-43-7
  Lauric acid-d233 is the deuterium labeled Lauric acid. Lauric acid is a middle chain-free fatty acid with strong bactericidal properties. The EC50s for P. acnes, S.aureus, S. epidermidis, are 2, 6, 4 μg/mL, respectively.

  

• HY-10240

  Mericitabine	940908-79-2	99.07%
  Mericitabine (RG 7128; R-7128) is a nucleoside inhibitor of the HCV NS5B polymerase that acts as an RNA chain terminator and prevents elongation of RNA transcripts during replication.

  

• HY-B0289

  Erdosteine	84611-23-4	99.62%
  Erdosteine inhibits lipopolysaccharide (LPS)-induced NF-κB activation[1][2]. Erdosteine has muco-modulatory, anti-bacterial, anti-inflammatory and anti-oxidant effects[3].

  

• HY-Y0532

  N-Chlorosuccinimide	128-09-6
  N-Chlorosuccinimide can enhance the antimicrobial effect of Benzalkonium chloride (HY-B2232) on biofilm Pseudomonas aeruginosa[1].

  

• HY-121935

  Tecnazene	117-18-0	99.96%
  Tecnazene (2,3,5,6-Tetrachloronitrobenzene) is a fungicide and is used as a sprout inhibitor on stored potatoes[1].

  

• HY-17422R

  Acyclovir (Standard)	59277-89-3
  Acyclovir (Standard) is the analytical standard of Acyclovir. This product is intended for research and analytical applications. Acyclovir (Aciclovir) is a potent, orally active antiviral agent. Acyclovir has antiherpetic activity with IC50 values of 0.85 μM and 0.86 μM for HSV-1 and HSV-2, respectively. Acyclovir induces cell cycle perturbation and apoptosis. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia[1][2][3][4].

  

• HY-Y0320R

  Dimethyl sulfoxide (Standard)	67-68-5
  Dimethyl sulfoxide (Standard) is the analytical standard of Dimethyl sulfoxide. This product is intended for research and analytical applications. Dimethyl sulfoxide (DMSO) is an aprotic solvent that dissolves both polar and nonpolar compounds. Dimethyl sulfoxide has anti-freezing and bacteriostatic properties[1][2].

  

• HY-131576A

  Thymidine 5′-diphosphate sodium	108322-12-9
  Thymidine 5′-diphosphate (dTDP) sodium is the key product of pyrimidine synthesis in organisms. Thymidine 5′-diphosphate sodium is produced by thymidylate kinase (TMPK) catalyzed phosphorylation of 5′-thymidine monophosphate (dTMP), which requires ATP and Mg2+. Thymidine 5′-diphosphate sodium is further catalyzed by TMPK to thymidine 5′-triphosphate (dTTP). TMPK activity can be detected by measuring the level of Thymidine 5′-diphosphate[1][2].

  

• HY-W010538

  trans-4-Methylcyclohexanamine	2523-55-9
  trans-4-Methylcyclohexanamine is an intermediate and can be used for the development of T. cruzi enzyme inhibitor[1].

  

• HY-W011518

  2′-Deoxy-2′-fluoroguanosine	78842-13-4	99.90%
  2′-Deoxy-2′-fluoroguanosine, a nucleoside analog, is a potent inhibitor of influenza virus strains, with an EC90 of <0.35 μM for influenza virus A and B strains. 2′-Deoxy-2′-fluoroguanosine significantly inhibits replication of influenza virus in the upper respiratory tract, resulting in amelioration of fever and nasal inflammation[1][2].

  

• HY-W013040

  Pyrazine	290-37-9	98.94%
  Pyrazine is an aromatic azaheterocycle containing two nitrogen atoms, known for its electron-deficient nature. Pyrazine is a key pharmacophore in various drugs, including anti-inflammatory, anticancer, and antimicrobial agents, with significant applications in pharmaceuticals, flavor, fragrance, and food industries[1].

  

• HY-W145518

  Pectin	9000-69-5
  Pectin is a heteropolysaccharide, derived from the cell wall of higher plants. Pectin involves in the formation of nanoparticles as a delivery vehicle of agents. Pectin is also an adsorbent, a broad-spectrum antimicrobial agent that binds to bacteria toxins and other irritants in the intestinal mucosa, relieves irritated mucosa[1][2][3].

  

• HY-W404916

  Probenecid sodium	23795-03-1	99.37%
  Probenecid sodium is the sodium salt of Probenecid. Probenecid is an effective selective transient receptor potential vanilloid 2 (TRPV2) agonist. Probenecid also inhibits the pannexin 1 channel[1][2][3][4].

  

• HY-128365

  Neticonazole hydrochloride	130773-02-3	99.96%
  Neticonazole hydrochloride is an imidazole derivative and a potent and long-acting antifungal agent. Neticonazole hydrochloride has anti-infection and anti-cancer effects[1][2][3].

  

• HY-135327

  Amphotericin B methyl ester	36148-89-7
  Amphotericin B methyl ester is the methyl ester derivative of the polyene antibiotic Amphotericin B (A634250). Amphotericin B methyl ester is the cholesterol-binding compound possesses significant antifungal activity. Amphotericin B methyl ester disrupts HIV-1 particle production and potently inhibits HIV-1 replication[1][2].

  

• HY-136303

  GS-704277	1911579-04-8	99.63%
  GS-704277 is an alanine metabolite of Remdesivir (HY-104077). GS-704277 is further hydrolyzed to GA-441524 (HY-103586) with antiviral activity. Remdesivir, a nucleoside analogue with effective antiviral activity, is highly effective in the control of SARS-CoV-2 (COVID-19) infection[1][2][3][4][5].

  

• HY-159502

  Surlorian	1467605-57-7	99.75%
  Surlorian is a ryanodine receptor (RyR) stabilizer[1].

  

• HY-18595

  BI 224436	1155419-89-8	99.74%
  BI 224436 is a novel HIV-1 noncatalytic site integrase inhibitor with EC50 values of less than 15 nM against different HIV-1 laboratory strains.

  

• HY-B1050

  Gemifloxacin mesylate	210353-53-0	99.76%
  Gemifloxacin mesylate (SB-265805S; LB-20304a) is an orally active broad-spectrum quinolone antibacterial antibiotic. Gemifloxacin mesylate inhibits DNA synthesis by inhibiting DNA gyrase and Topoisomerase IV activities. Gemifloxacin mesylate has potent antibacterial activities against gram-positive bacteria in vitro efficacy study, particularly Streptococci and Staphylococci. Gemifloxacin mesylate has been used in the research of respiratory tract infections[1][2][3].

  

• HY-103643

  Fumagillol	108102-51-8
  Fumagillol is a direct precursor of fumagillin. Fumagillin, as an antimicrobial agent, is a potent and selective inhibitor of angiogenesis[1].

  

• HY-122907

  JNJ4796	2241664-16-2	99.94%
  JNJ4796 is an oral active fusion inhibitor of influenza virus, neutralizing influenza A group 1 viruses by inhibiting hemagglutinin (HA)-mediated fusion. JNJ4796 mimics the functionality of the broadly neutralizing antibodies (bnAbs)[1].

  

• HY-148072

  MM3122	2574390-27-3	99.20%
  MM3122 is a selective type II transmembrane serine protease (TMPRSS2) inhibitor with an IC50 value of 0.34 nM. MM3122 effectively blocks TMPRSS2, thereby inhibiting the entry of SARS-CoV-2 and MERS-CoV into human cells[1].

  

• HY-148564

  TBI-166	1353734-12-9	98.00%
  TBI-166, a riminophenazine analogue, is an orally active anti-tuberculosis agent with fewer adverse reactions than the lead riminophenazine compound, Clofazimine (HY-B1046) [1][2][3].

  

• HY-150167

  TH-Z93	2260887-09-8	98.77%
  TH-Z93, a lipophilic bisphosphonate, is a FPPS inhibitor (IC50: 90 nM)[1].

  

• HY-P0052A

  Enfuvirtide acetate	914454-00-5	99.95%
  Enfuvirtide (T20; DP178) acetate is an anti-HIV-1 fusion inhibitor peptide.

  

• HY-P3383A

  Peceleganan acetate		98.36%
  Peceleganan (PL-5) acetate is an artificial antimicrobial cecropin A (1-10) × melittin B (3-18) hybrid (10+16)-peptide analogue. Peceleganan acetate inhibits wound infection[1].

  

• HY-U00035

  MGB-BP-3	1000277-08-6	98.93%
  MGB-BP-3 is an antibiotic that has been shown to be active against a broad range of important multi-resistant Gram-positive pathogens.

  

• HY-P2522

  Competence-Stimulating Peptide-2 (CSP-2)	1174553-84-4	98.56%
  Competence-Stimulating Peptide-2 (CSP-2) is a quorum sensing signal peptide produced by Streptococcus pneumoniae. ComD2 is a compatible receptor of Competence-Stimulating Peptide-2 (CSP-2) with an EC50 value of 50.7 nM[1].

  

• HY-14283

  Luliconazole	187164-19-8	99.99%
  Luliconazole (NND 502) is a topical antifungal imidazole antibiotic with broad-spectrum and potent antifungal activity. Luliconazole can be used for the research of skin infection, including dermatophytosis, tinea corporis, tinea pedis et al[1].

  

• HY-14957

  Ozenoxacin	245765-41-7	99.66%
  Ozenoxacin is a nonfluorinated quinolone antibacterial, which shows potent activities against the main microorganisms isolated from skin and soft tissue infections.

  

• HY-15884

  GSK2838232	1443460-91-0	98.99%
  GSK2838232 inhibit HIV reverse transcriptase activity across a broad panel of HIV-1 isolates, extracted from patent WO/2013090664A1, compound51.

  

• HY-16764

  Avarofloxacin	878592-87-1	99.36%
  Avarofloxacin (JNJ-Q2) is a broad-spectrum fluoroquinolone antibacterial agent being developed for the treatment of acute bacterial skin and skin-structure infections and community-acquired pneumonia with oral activity. Avarofloxacin (JNJ-Q2) is an aminoethylidenylpiperidine fluoroquinolone that demonstrates antibacterial effect against numerous Gram-positive bacteria with a mean 0.12 mg/L MIC90 value. Avarofloxacin (JNJ-Q2) has potential for treatment of methicillin-resistant Staphylococcus aureus (MRSA) infections[1][2][3].

  

• HY-17041

  Darunavir Ethanolate	635728-49-3	99.93%
  Darunavir ethanolate (TMC114 Ethanolate) is a potent HIV protease inhibitor used to treat and prevent HIV/AIDS. Darunavir has a Ki of 1 nM for wild type HIV-1 protease.

  

• HY-19974

  TAK-220	333994-00-6	99.95%
  TAK-220 is a selective and orally bioavailable CCR5 antagonist, with IC50s of 3.5 nM and 1.4 nM for inhibition on the binding of RANTES and MIP-1α to CCR5, respectively, but shows no effect on the binding to CCR1, CCR2b, CCR3, CCR4, or CCR7; TAK-220 also selectively inhibits HIV-1, with EC50s of 1.2 nM (HIV-1 KK), 0.72 nM (HIV-1 CTV), 1.7 nM (HIV-1 HKW), 1.7 nM (HIV-1 HNK), 0.93 nM (HIV-1 HTN), and 0.55 nM (HIV-1 HHA), and EC90s of 12 nM (HIV-1 KK), 5 nM (HIV-1 CTV), 12 nM (HIV-1 HKW), 28 nM (HIV-1 HNK), 15 nM (HIV-1 HTN), and 4 nM (HIV-1 HHA) in PBMCs.

  

• HY-A0068

  Aurothioglucose	12192-57-3
  Aurothioglucose (Gold thioglucose), containing monovalent gold ion, is a potent active-site inhibitor of TrxR1 (thioredoxin reductase 1), with an IC50 of 65 nM. Aurothioglucose inhibits the DNA binding of NF-κB in vitro. Aurothioglucose shows anti-HIV and anti-rheumatic activities[1][2].

  

• HY-A0111

  Cefetamet	65052-63-3	99.42%
  Cefetamet is a cephalosporin antibiotic. Cefetamet has the potential for the research of both upper and lower community-acquired respiratory tract infections[1].

  

• HY-B0157

  Ketotifen	34580-13-7	99.74%
  Ketotifen (HC 20-511) is an orally active second-generation noncompetitive histamine 1 (H1) receptor blocker and mast cell stabilizer. Ketotifen can block 6-phosphogluconate dehydrogenase (PGD) in vitro. Ketotifen also has antiviral activity against SARS-CoV-2 and Influenza virus. Ketotifen can be used to the research of autoimmune encephalomyelitis (EAE) and asthma attack prevention[1][2][3][4].

  

• HY-B0291

  Oxfendazole	53716-50-0	99.29%
  Oxfendazole is a sulfoxide form of fenbendazole that is effective when taken orally. Oxfendazole fights parasites and has tumor-promoting activity[1][2][3].

  

• HY-B0306

  Prothionamide	14222-60-7	99.94%
  Prothionamide is an orally active thioamide antibacterial agent. Prothionamide is a substrate of OCT1 with a Km value of 805.8 μM. Prothionamide reacts with NAD to form a covalent adduct, with the adduct being a tight-binding inhibitor of Mycobacterium tuberculosis and Mycobacterium leprae InhA. Prothionamide can effectively inhibit the growth of Mycobacterium tuberculosis (MIC = ~0.5 µg/mL) and Mycobacterium leprae. Prothionamide is used in the research of tuberculosis and leprosy[1][2][3][4][5].

  

• HY-B0357

  Diclazuril	101831-37-2
  Diclazuril (R-64433), a benzeneacetonitrile derivative, is a potent and orally active anticoccidial agent. Diclazuril can be used for the research of certain infectious and parasitic diseases, including coccidiosis, acute toxoplasmosis, equine protozoal pyoencephalitis (EPM) et.al[1][2].

  

• HY-B0519

  Tylosin tartrate	74610-55-2
  Tylosin tartrate is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin tartrate exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin tartrate is widely used as a feed additive for promoting animal growth. Tylosin tartrate is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle[1][2][3].

  

• HY-B0643

  Dirithromycin	62013-04-1
  Dirithromycin (LY237216), a derivative of Erythromycin, is a potent and orally active semi-synthetic macrolide antibiotic. Dirithromycin is active against gram-positive bacteria, Legionella spp., Helicobacter pylori, and Chlamydia trachomatis[1][2].

  

• HY-B0740

  Cyclobenzaprine hydrochloride	6202-23-9	99.59%
  Cyclobenzaprine (MK130) hydrochloride is an orally active 5-HT2 receptor antagonist. Cyclobenzaprine hydrochloride acts centrally, providing skeletal muscle relaxation, alleviating muscle spasms, and reducing pain. Additionally, Cyclobenzaprine hydrochloride has antiprotozoal activity. Additionally, Cyclobenzaprine hydrochloride also possesses antiparasitic activity. Cyclobenzaprine hydrochloride holds promise for research in the fields of acute, painful skeletal muscle disorders and infectious diseases[1][2][3][4][5]

  

• HY-B1002

  Oxolinic acid	14698-29-4	98.97%
  Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice[1][2][3].

  

• HY-B1043

  Piromidic acid	19562-30-2	98.96%
  Piromidic acid is an antibacterial agent. Piromidic acid is active against gramnegative bacteria and staphylococci and can be used for the research of intestinal, urinary, and biliary tract infections[1][2].

  

• HY-B1113

  Diazinon	333-41-5	99.25%
  Diazinon is an orally active, irreversible AChE inhibitor and insecticide that can be absorbed through the digestive system, skin or respiratory tract. Diazinon inhibits AChE, leading to accumulation of acetylcholine, which in turn overstimulates ACh receptors and affects the nervous system. Diazinon also produces reactive oxygen species (ROS)， which induce oxidative stress in various tissues. Diazinon is mainly used in the agricultural field as an insecticide and may have potential effects on human and animal health[1][2][3][4].

  

• HY-B1344

  Oxantel pamoate	68813-55-8	99.97%
  Oxantel pamoate (Oxantel embonate) is an anthelmintic agent that potently against Trichuris muris. Oxantel pamoate inhibits fumarate reductase (Frd) activity in some pathogenic bacteria and inhibits P. gingivalis homotypic biofilm formation (IC50 of 2.2 μM)[1][2].

  

• HY-B1431

  Butylparaben	94-26-8	99.21%
  Butylparaben is an organic compound that has proven to be a very successful antimicrobial preservative in cosmetics, can also be used in active molecule suspensions, and as a food flavoring additive[1].

  

• HY-B1513

  α-Cyclodextrin	10016-20-3	99.82%
  α-Cyclodextrin (α-CD) is a soluble fiber derived from corn. α-Cyclodextrin can deplete sphingolipids and phospholipids from cell membranes. α-Cyclodextrin interacts with tubulin. α-Cyclodextrin improves defenses against SARS-CoV-2 infection. α-Cyclodextrin enhances the anticancer efficacy of Crcumin (HY-N0005) against breast, lung and cervical cancer. α-Cyclodextrin has beneficial effects on body weight and blood lipids[1][2][3][4][5].

  

• HY-B1781

  Sulfachloropyridazine	80-32-0	99.51%
  Sulfachloropyridazine is a broad spectrum sulfonamide used against both Gram-positive and Gram-negative aerobic bacteria.

  

• HY-B2224

  Thiamine disulfide	67-16-3	98.05%
  Thiamine disulfide, a vitamin B1 derivative, is an oxidized dimer of Thiamine. Thiamine disulfide is a potent HIV-1 inhibitor. Thiamine disulfide significantly depresses HIV-1 transactivator (Tat) activity[1][2].

  

• HY-N0224

  Epigoitrin	1072-93-1	99.91%
  Epigoitrin is a natural alkaloid that provides protection against influenza infection by reducing the host’s susceptibility to influenza virus under stress. Epigoitrin exerts antiviral activity against influenza A1 virus FM1 via inhibiting virus attachment and multiplication in vitro. Epigoitrin also has lipid-lowering effects[1][3].

  

• HY-N0325

  DL-Methionine	59-51-8
  DL-Methionine is an essential amino acid containing sulfur with oxidative stress defense effects. DL-Methionine can be used for animal natural feed. DL-Methionine also kills H. rostochiensis on potato plants[1][2][3].

  

• HY-N0677

  Dehydroandrographolide succinate	786593-06-4	99.88%
  Dehydroandrographolide succinate, extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect[1].

  

• HY-N0914

  Ajugol	52949-83-4
  Ajugol is an orally active iridoid glycoside found in the traditional Chinese medicine Leonurus japonicus. Ajugol is an autophagy activator. Ajugol activates TFEB-mediated autophagy and lysosomal biogenesis. Ajugol also has anti-inflammatory effects. Ajugol has great potential in the research of asthma, non-alcoholic fatty liver disease (NAFLD), and osteoarthritis[1][2][3][4].

  

• HY-N1377

  Nevadensin	10176-66-6	99.93%
  Nevadensin (Lysionotin), a natural flavonoid, is a selective human carboxylesterase 1 (hCE1) inhibitor with an IC50 of 2.64 μM. Nevadensin is more selective for hCE1 than hCE2 (IC50 of 132.8 μM). Nevadensin can induce apoptosis and DNA damage in cancer cells. Nevadensin has a variety of pharmacological effects such as anti-inflammatory, anti-tumour, anti-hypertensive, anti-tubercular, antitussive, antioxidant and anti-microbial activities[1][2][3][4][5].

  

• HY-N1778

  3,4-Dimethoxycinnamic acid	2316-26-9	99.66%
  3,4-Dimethoxycinnamic acid (O-Methylferulic acid) is a monomer extracted and purified from Securidaca inappendiculata Hassk. 3,4-Dimethoxycinnamic acid exerts anti-apoptotic effects on L-02 cells via the ROS-mediated signaling pathway[1]. Anti-apoptotic effects[1].

  

• HY-N2006

  Ganoderic acid B	81907-61-1	99.31%
  Ganoderic acid B is a triterpene isolated from a mushroom Ganoderma lucidum. Ganoderic acid B inhibits the activation of Epstein-Barr virus (EBV) antigens as telomerase inhibitor. Ganoderic acid B is a moderately active inhibitor against HIV-1 protease (IC50: 170 μM)[1][2][3].

  

• HY-N2472

  Medicagenic acid	599-07-5	98.97%
  Medicagenic acid (Castanogenin) is isolated from the roots of Herniaria glabra, exhibits potent fungistatic effects against several plant pathogens and human dermatophytes[1]. Medicagenic acid (Castanogenin) has low enzyme inhibitory activities, the target enzymes are xanthine oxidase, collagenase, elastase, tyrosinase, ChE[2].

  

• HY-N2562

  Norwogonin	4443-09-8	99.15%
  Norwogonin, isolated from Scutellaria baicalensis Georgi, possesses antiviral activity against Enterovirus 71 (EV71) with an IC50 of 31.83 μg/ml[1]

  

• HY-N2579

  1-Kestose	470-69-9
  1-Kestose, the smallest fructooligosaccharide component, which efficiently stimulates Faecalibacterium prausnitzii as well as Bifidobacteria.

  

• HY-N3138

  Ombuoside	20188-85-6	99.68%
  Ombuoside is a glycoside ombuoside isolated from Gynostemma pentaphyllum.Ombuoside has antimicrobial activity against several strains of gram-positive and gram-negative bacteria and the yeast Candida albicans[1]. Ombuoside has antioxidant effects by scavenging free radicals and ROS[2].

  

• HY-N3307

  (+)-Medioresinol	40957-99-1	98.88%
  (+)-Medioresinol is a furofuran type lignan with antifungal, antibacterial and lesishmanicidal activities. (+)-Medioresinol leads to intracellular ROS accumulation and mitochondria-mediated apoptotic cell death in Candida albicans. (+)-Medioresinol can reduce the cardiovascular disease risk[1][2].

  

• HY-N3488

  Isodiospyrin	20175-84-2	99.77%
  Isodiospyrin, a natural dimeric naphthoquinone, is a human DNA topoisomerase I (Topoisomerase) inhibitor. Isodiospyrin can prevent both DNA relaxation and kinase activities of human topoisomerase I. Isodiospyrin shows anticancer, antibacterial and antifungal activities[1][2][3].

  

• HY-N4122

  Neodiosmin	38665-01-9	99.37%
  Neodiosmin is a flavone glycoside isolated from the leaves of Citrus aurantium[1].

  

• HY-N5124

  Meloside A	60767-80-8
  Meloside A (Isovitexin 2''-O-glucoside) is a phenylpropanoid isolated from barley with antioxidant activity. In barley, phenylpropanoids have been described as having protective properties against excess UV-B radiation and have been linked to resistance to pathogens[1][2].

  

• HY-N6005

  Methyl caffeate	3843-74-1	99.89%
  Methyl caffeate, an antimicrobial agent, shows moderate antimicrobial and prominent antimycobacterial activities. Methyl caffeate also exhibits α-glucosidase inhibition activity, oxidative stress inhibiting activity, anti-platelet activity, antiproliferative activity in cervix adenocarcinoma and anticancer activity in lung and leukmia cell lines[1].

  

• HY-N6583

  Licoflavonol	60197-60-6
  Licoflavonol, a minor flavone from the roots of Glycyrrhiza uralensis, is an inhibitor of the Salmonella type III secretion system (T3SS)[1][2].

  

• HY-N6661

  Verbenone	1196-01-6	99.27%
  Verbenone ((-)-Verbenone) is a natural terpene in leaves of the tree, Verbena officinalis[1]. Verbenone has anti-aggregation pheromone and interrupts the attraction of bark beetles to their aggregation pheromones[2].

  

• HY-N6790

  Nonactin	6833-84-7
  Nonactin is a macrotetrolide antibiotic and mitochondrial uncoupler with antibacterial, insecticidal, and acaricidal activities. Nonactin acts as an ionophore for monovalent cations, including K+, and NH4+, and it can also inhibit the surface expression of endogenous HSP60. In addition, Nonactin can induce apoptosis in β-catenin mutant tumor cells and has anti-tumor activity[1][2][3][4].

  

• HY-N7123

  Sulfacetamide	144-80-9	99.81%
  Sulfacetamide (Sulphacetamide) is a sulfonamide antibiotic that can be used for the study of ocular infections. Sulfacetamide has antifungal and antibacterial activities[1].

  

• HY-N8213

  Rapanone	573-40-0	99.20%
  Rapanone is a natural benzoquinone. Rapanone exhibits a broad spectrum of biological actions, including anti-tumor, antioxidant, anti-inflammatory, antibacterial and antiparasitic. Rapanone also is a potent and selective human synovial PLA2 inhibitor, with an IC50 of 2.6 μM[1][2][3][4].

  

• HY-N9362

  Emodinanthrone	491-60-1	98.08%
  Emodinanthrone, an anthraquinone, is a sprecursor of Emodin (HY-14393) with antibiotic activity. Emodinanthrone inhibits respiration-driven solute transport at micromolar concentrations in membrane vesicles of Escherichia coli[1][2][3].

  

• HY-P1258

  PSI	158442-41-2
  PSI (Proteasome Inhibitor 1) is a potent proteasome inhibitor. PSI inhibits the proliferation of primary effusion lymphoma (PEL) cells. PSI has the potential for the research of Kaposi’s sarcoma-associated herpesvirus (KSHV) infection and KSHV-associated lymphomas[1].

  

• HY-P2315

  Human β-defensin-1	452274-53-2	99.33%
  Human β-defensin-1 (HβD-1) is a cysteine-rich cationic skin-antimicrobial peptide (SAP) produced by all epithelial surfaces, but also by circulatory cells and cells of the reproductive tract. Human β-defensin-1 has antimicrobial activities against a broad-sperm bacteria[1].

  

• HY-P2822

  Phosphoglycerate kinase, yeast	9001-83-6
  Phosphoglycerate kinase, yeast (PGK), namely phosphoglycerate kinase, is a glycolytic enzyme commonly used in biochemical research. Phosphoglycerate kinase can catalyze the reversible transfer of phosphate groups from 1,3-bisphosphoglycerate (1,3-BPG) to ADP to generate 3-phosphoglycerate (3-PG) and ATP. At the same time, it can also participate in gluconeogenesis, catalyzing the opposite reaction to produce 1,3BPGA and ADP. Phosphoglycerate kinase is involved in energy metabolism, interaction with nucleic acid, tumor progression, cell death and virus replication and other related processes[1].

  

• HY-P3914

  Cecropin A (1-7)-Melittin A (2-9)	157606-25-2	98.23%
  Cecropin A (1-7)-Melittin A (2-9) is an antimicrobial peptide with antimicrobial activity against a broad spectrum of Gram-positive and Gram-negative aerobic bacteria, as well as antimalarial activity, without the adverse hemolytic properties of bee venom peptides[1].

  

• HY-100176

  PF-4878691	532959-63-0	99.89%
  PF-4878691 (3M-852A) is an orally active TLR7 agonist. PF-4878691 has the innate immune response activity, antiviral efficacy against HCV, and can be used for the research of cancer[1][2].

  

• HY-101479

  Iclaprim	192314-93-5	99.49%
  Iclaprim is a new selective bacterial Dihydrofolate inhibitor, which can inhibit the growth of S. aureus (MRSA) with an MIC90 of 0.06 μg/mL.

  

• HY-10545A

  Taribavirin hydrochloride	40372-00-7
  Taribavirin hydrochloride is an orally active inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus. Taribavirin hydrochloride is a Ribavirin proagent, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia[2].

  

• HY-106282

  BIT-225	917909-71-8	98.87%
  BIT-225 is an inhibitor for Vpu protein through block of Vpu ion channel, and thus inhibits the release of HIV-1, especially in monocyte-derived macrophages (EC50 is 2.25 μM), without significant cytotoxicity (TC50 is 284 μM)[1].

  

• HY-107760

  Decanoyl-RVKR-CMK	150113-99-8	98.02%
  Decanoyl-RVKR-CMK (DecRVKRcmk) inhibits over-expressed gp160 processing and HIV-1 replication[1].

  

• HY-107789

  Sodium lauryl sulfoacetate	1847-58-1
  Sodium lauryl sulfoacetate is a solid anionic surfactant of plant origin. Sodium lauryl sulfoacetate is an immunoadjuvant with antiimmunosuppressive effects. Sodium lauryl sulfoacetate has antiviral activity[1][2][3].

  

• HY-108254

  Bisindolylmaleimide IV	119139-23-0	99.62%
  Bisindolylmaleimide IV (Arcyriarubin A) is a potent protein kinase C (PKC) inhibitor, with IC50s ranging from 0.1 to 0.55 μM. Bisindolylmaleimide IV also inhibits PKA (IC50=3.1-11.8μM)[1]. Bisindolylmaleimide IV is a potent, selective inhibitor of human cytomegalovirus (HCMV) replication in cell culture with an IC50 of 0.2 μM[2].

  

• HY-111802

  3,4'-Dihydroxyflavone	14919-49-4	99.55%
  3,4'-Dihydroxyflavone (3,4'-DHF) is an oral active flavonoid with antiviral activity against Influenza A virus[1].

  

• HY-114698

  Retro-2 cycl	1429192-00-6	99.17%
  Retro-2 cycl (RN 1-001) is a retrograde transport inhibitor with antiviral activity. Retro-2 cycl (RN 1-001) inhibits JCPyV and HPV16 pseudoviruses, with an IC50 of 54 μM and 160 μM respectively[1][2][3].

  

• HY-116174

  Omaciclovir	124265-89-0	99.46%
  Omaciclovir (H2G) is a potent and selective inhibitor of herpesvirus replication. Omaciclovir is a nucleoside analog with antiviral activity[1].

  

• HY-116934

  5-Pentadecylresorcinol	3158-56-3
  5-Pentadecylresorcinol (Adipostatin A) is a glycerol-3-phosphate dehydrogenase (GPDH) inhibitor with an IC50 of 4.1 μM. Adipostatin A shows good larvicidal activity against Aedes aegypti[1][2].

  

• HY-119172

  NSC-60339	70-09-7
  NSC-60339, an efflux pump inhibitor and a substrate of AcrAB-TolC, is a polybasic terephthalic acid derivative studied as a potential cancer chemotherapeutic agent[1][2].

  

• HY-119687

  Bifenazate	149877-41-8	99.89%
  Bifenazate is a carbazate acaricide that control 100% of mites at a concentration of 25 ppm[1]. Bifenazate is a positive allosteric modulator of GABA receptor[2]. Bifenazate is the inhibitor for the mitochondrial electron transport chain complex III[3].

  

• HY-120427

  Cosalane	154212-56-3	99.78%
  Cosalane (NSC 658586) is a CCR7 (IC50 = 2.43 μM) and CXCR2 antagonist (IC50 = 0.66 μM). Cosalane is an inhibitor of HIV replication with a wide range of activity against HIV-1 isolates, HIV-2, Rauscher murine leukemia virus, HSV-1, HSV-2 and human cytomegalovirus. Cosalane inhibits both attachment of gp120 to CD4. Cosalane inhibits human and murine CCR7 in response to both CCL19 and CCL21 agonists. Cosalane can be studied in research for HIV or attenuating acute graft-versus-host disease (aGVHD) in allogeneic hematopoietic stem cell transplantation (HSCT)[1][2][3][4][5].

  

• HY-120536

  HPi1	13080-21-2
  HPi1 is a potent, selective and orally active antimicrobial against Helicobacter pylori with an IC50 of 0.24 μM and an MIC of 0.08-0.16 μg/mL. HPi1 is inactive against other bacteria, including the gut commensals Lactobacillus casei, Lactobacillus reuteri, and Bifidobacterium longum[1].

  

• HY-120632

  BMS-433771	543700-68-1	99.96%
  BMS-433771 is a potent orally active inhibitor of respiratory syncytial virus (RSV). BMS-433771 is active against both A and B groups of RSV, with an average EC50 of 20 nM. BMS-433771 can be used for the research of respiratory tract disease[1][2].

  

• HY-122470

  Stampidine	217178-62-6	99.96%
  Stampidine is a nucleoside reverse transcriptase inhibitor (NRTI) with potent and broad-spectrum anti-HIV activity. Stampidine inhibits the laboratory HIV-1 strain HTLVIIIB (B-envelope subtype) and primary clinical isolates with IC50s of 1 nM and 2 nM, respectively. Stampidine also inhibits NRTI-resistant primary clinical isolates and NNRTI-resistant clinical isolates with IC50s of 8.7 nM and 11.2 nM, respectively[1].

  

• HY-123032

  Sorivudine	77181-69-2
  Sorivudine (BV-araU) is an orally active synthetic pyrimidine nucleoside antimetabolite agent. Sorivudine derives its antiviral activity from selective conversion by a specific thymidine kinase present in certain DNA viruses to nucleotides, which can in turn interfere with viral DNA synthesis[1].

  

• HY-125923

  Djenkolic acid	498-59-9
  Djenkolic acid is a sulfur-containing amino acid. Djenkolic acid can be isolated from the djenkol beans of the Southeast Asian plant Archidendron jiringa. Djenkolic acid de-inhibits the SO42- uptake system in Pseudomonas fluorescens. Djenkolic acid causes supersaturation of the urinary system with djenkolic acid crystals, leading to urinary tract obstruction and acute kidney injury[1][2].

  

• HY-126085

  (±)-Alliin	17795-26-5
  (±)-Alliin is the main active component of garlic. (±)-Alliin is a putative inhibitor of the main protease of SARS-CoV-2 (Mpro)[1].

  

• HY-12653A

  LDC4297 hydrochloride	2319747-14-1	98.23%
  LDC4297 hydrochloride is a selective inhibitor of CDK7 with an IC50 value of 0.13 nM. LDC4297 hydrochloride inhibits human cytomegalovirus (HCMV) replication with an EC50 value of 24.5 nM. LDC4297 hydrochloride shows broad antiviral activities to Herpesviridae, Adenoviridae, Poxviridae, Retroviridae and Orthomyxoviridae with EC50 values of 0.02-1.21 μM. LDC4297 hydrochloride can be used for the research of infection[1].

  

• HY-128447

  Allyl methyl sulfide	10152-76-8
  Allyl methyl sulfide is a bioactive organosulfur compound found in garlic. Allyl methyl sulfide exhibits antibacterial, antioxidant and anticancer properties[1].

  

• HY-135549

  Fluxapyroxad	907204-31-3	99.96%
  Fluxapyroxad is a synthetic broad-spectrum fungicide for the control of fungal diseases. Fluxapyroxad inhibits succinate dehydrogenase in complex II of the mitochondrial respiratory chain, resulting in inhibition of spore germination, germ tubes and mycelia growth within the fungus target species[1].

  

• HY-136466

  A2ti-2	482646-13-9	99.27%
  A2ti-2 is a selective and low-affinity annexin A2/S100A10 heterotetramer (A2t) inhibitor with an IC50 of 230 μM[1]. A2ti-2 specifically disrupts the protein-protein interaction (PPI) between A2 and S100A10. A2ti-2 prevents human papillomavirus type 16 (HPV16) infection[2].

  

• HY-136638

  ML328	634175-34-1	98.59%
  ML328 is a selective inhibitor of bacterial AddAB and RecBCD helicase-nucleases with IC50 values of 26 and 5.1 μM, respectively. ML328 is a gyrase inhibitor. ML328 strongly inhibits the growth of E. coli in the presence of phage. ML328 can be used for the research of bacterial infection[1][2].

  

• HY-143692

  SQDG	123036-44-2
  SQDG inhibits topoisomerase I and P-selectin receptor, exhibits anti-inflammatory, antiviral and antitumor activities. SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations[1][2][3].

  

• HY-144305

  KPH2f	2760615-09-4	99.22%
  KPH2f is a safe, orally active, and effective dual URAT1/GLUT9 inhibitor with IC50s of 0.24 μM and 9.37 μM for URAT1 and GLUT9, respectively. KPH2f shows little effects on OAT1 and ABCG2 (IC50=32.14 and 26.74 μM)[1].

  

• HY-144612

  NS2B/NS3-IN-2	3010940-08-3	98.10%
  NS2B/NS3-IN-2 is a potent dengue virus (DENV) NS2B/NS3 covalent inhibitor with an IC50 of 6.0 nM and Ki of 0.66 µM. NS2B/NS3-IN-2 shows no cytotoxicity and markedly increases the cell survival rate[1].

  

• HY-147266

  Elebsiran sodium
  Elebsiran sodium is a siRNA against hepatitis B and D virus infections [1].

  

• HY-153235

  COVID-19 Spike Protein mRNA-LNP
  COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing mRNA encoding COVID-19 Spike Protein. COVID-19 Spike Protein undertakes the functions of virus binding with host cell receptors, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design. COVID-19 Spike Protein mRNA-LNP can be used for RNA delivery, vaccine formulation and design targeting SARS-CoV-2[1].

  

• HY-153797

  Dox-btn2	3026061-31-1
  Dox-btn2 is a biotinylated derivative of Doxorubicin (HY-15142A), with a biotin label at the point of conjugation to doxorubicin at 3'-NH2. Dox-btn2 can be used for cell imaging. While Doxorubicin is mainly accumulated in the nucleus, while Dox-btn2 is mainly located in the cytoplasm[1].

  

• HY-16561S

  Resveratrol-d4	1089051-56-8	99.36%
  Resveratrol-d4 is the deuterium labeled Resveratrol. Resveratrol (trans-Resveratrol; SRT501), a natural polyphenolic phytoalexin that possesses anti-oxidant, anti-inflammatory, cardioprotective, and anti-cancer properties. Resveratrol (SRT 501) has a wide spectrum of targets including mTOR, JAK, β-amyloid, Adenylyl cyclase, IKKβ, DNA polymerase. Resveratrol also is a specific SIRT1 activator[1][2][3][4]. Resveratrol is a potent pregnane X receptor (PXR) inhibitor[5]. Resveratrol is an Nrf2 activator, ameliorates aging-related progressive renal injury in mice model[6]. Resveratrol increases production of NO in endothelial cells[7].

  

• HY-17412R

  Minocycline (hydrochloride) (Standard)	13614-98-7
  Minocycline (hydrochloride) (Standard) is the analytical standard of Minocycline (hydrochloride). This product is intended for research and analytical applications. Minocycline hydrochloride is an orally active, potent and BBB-penetrated semi-synthetic tetracycline antibiotic. Minocycline hydrochloride is a hypoxia-inducible factor (HIF)-1α inhibitor. Minocycline hydrochloride shows anti-cancer, anti-inflammatory, and glutamate antagonist effects. Minocycline hydrochloride reduces glutamate neurotransmission and shows neuroprotective properties and antidepressant effects. Minocycline hydrochloride inhibits bacterial protein synthesis through binding with the 30S subunit of the bacterial ribosome, resulting in a bacteriostatic effect[1][2][3][4][5][6][7].

  

• HY-19936A

  ACHN-975 TFA	1410809-37-8
  ACHN-975 TFA is a selective LpxC inhibitor and exhibits a subnanomolar LpxC inhibitory activity. ACHN-975 TFA is against a wide range of gram-negative bacterias with low MIC values (≤1 μg/mL)[1].

  

• HY-A0256B

  Clavulanate lithium	61177-44-4	99.64%
  Clavulanate lithium is a potent β-lactamase inhibitor and acts as an antibiotic[1][2].

  

• HY-B0330D

  (R)-Ofloxacin	100986-86-5	99.88%
  (R)-Ofloxacin is the dextrorotatory enantiomer of Ofloxacin (HY-B0125) and is an orally effective fluoroquinolone antibiotic. (R)-Ofloxacin can inhibit the activity of bacterial DNA topoisomerase II, interfere with bacterial DNA replication and repair, and exert a bactericidal effect. (R)-Ofloxacin has a broad-spectrum antibacterial activity and has inhibitory effects on both Gram-negative and Gram-positive bacteria[1][2].

  

• HY-B0343A

  Sarafloxacin hydrochloride	91296-87-6	98.14%
  Sarafloxacin (hydrochloride) (A-56620 (hydrochloride)) is a quinolone antibiotic agent.

  

• HY-B0614A

  Mafenide Acetate	13009-99-9	99.91%
  Mafenide Acetate is an effective sulfonamide-type antimicrobial agent used for burn wounds. Mafenide Acetate shows activity against both Gram-positive and Gram-negative organisms, including Pseudomonas aeruginosa, via inhibition of nucleotide synthesis[1][2].

  

• HY-B0706A

  Flomoxef sodium	92823-03-5	99.33%
  Flomoxef sodium is a oxacephem group antibiotic, with excellent activity against various Gram-positive bacteria[1][2].

  

• HY-B0902A

  Rufloxacin hydrochloride	106017-08-7
  Rufloxacin hydrochloride (MF-934 hydrochloride) is a fluoroquinolone antibacterial, inhibits B-cell differentiation in human mononuclear cells, inhibits Topo.

  

• HY-B0914A

  10-Undecenoic acid zinc salt	557-08-4
  10-Undecenoic acid zinc salt (Undecylenic acid zinc salt) is an antifungal agent. 10-Undecenoic acid zinc salt inhibits Aβ oligomerization, scavenges ROS and inhibits μ-calpain activity. 10-Undecenoic acid zinc salt has neuroprotective effects. 10-Undecenoic acid zinc salt has anticancer effects on a variety of tumors. 10-Undecenoic acid zinc salt inhibits C. albicans biofilm formation and MRSA infection. 10-Undecenoic acid zinc salt inhibits quorum sensing signals of Bacillus subtilis and Pseudomonas aeruginosa[1][2][3][4][5][6][7][8].

  

• HY-B1080A

  Tilorone	27591-97-5	99.80%
  Tilorone is an orally active antiviral agent and interferon inducer that also has potential antineoplastic, immunomodulatory, and metabolic modulating effects. Tilorone induces an abnormally delayed interferon response and primarily stimulates interferon production in lymphoid tissue. Thus, Tilorone exerts antiviral effects and can be used as a chemotherapeutic agent. Tilorone has the potential to inhibit type 2 diabetes by increasing glucose uptake in vivo and in skeletal muscle cells by enhancing Akt2/AS160 signaling and glucose transporter levels[1][2][3][4][5].

  

• HY-B1370R

  Hydroxychloroquine (sulfate) (Standard)	747-36-4	99.28%
  Hydroxychloroquine (sulfate) (Standard) is the analytical standard of Hydroxychloroquine (sulfate). This product is intended for research and analytical applications. Hydroxychloroquine sulfate (HCQ sulfate) is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine sulfate is efficiently inhibits SARS-CoV-2 infection in vitro[1][2][3].

  

• HY-B1390A

  Saccharin sodium	128-44-9
  Saccharin sodium is an orally active, non-caloric artificial sweeteners (NAS). Saccharin sodium has bacteriostatic and microbiome-modulating properties[1].

  

• HY-N1420A

  Rhamnose monohydrate	10030-85-0
  Rhamnose monohydrate (L-Rhamnose monohydrate) is an orally active deoxysugar. Rhamnose monohydrate can inhibit levels of pro-inflammatory interleukin and matrix metalloproteinases (MMPs) in skin aging models. Rhamnose can promote the phosphorylation levels of PKA substrates and HSL in SVF-derived adipocytes, stimulating PKA signaling. Rhamnose monohydrate can act against obesity in mice by stimulating fat dopamine receptors and inducing thermogenesis. Rhamnose monohydrate shows anti-aging effects. Rhamnose monohydrate can be used in the study of Ehrlich’s solid tumors and sarcomas[2][3][5].

  

• HY-N7139A

  Penicillin G benzathine	1538-09-6	99.85%
  Penicillin G benzathine (Benzathine benzylpenicillin) is an antibiotic against many bacterial infections[1].

  

• HY-P0093A

  Sincalide ammonium	70706-98-8	99.90%
  Sincalide ammonium (Cholecystokinin octapeptide ammonium, CCK-8 ammonium) is a rapid-acting amino acid polypeptide hormone analogue of cholecystokinin (CCK) for intravenous use in postevacuation cholecystography. Sincalide ammonium is a major bioactive segment of CCK that retains most of the biological activities of CCK. CCK‐8 can promote gallbladder contraction by injection and helps diagnose gallbladder and pancreas disorders. Sincalide ammonium can increase bile secretion, cause the gallbladder to contract and relax the sphincter of Oddi, resulting in bile drainage into the duodenum. Sincalide ammonium is a major bioactive segment of CCK that retains most of the biological activities of CCK[1][2][3].

  

• HY-P1104A

  FC131 TFA	842166-42-1	99.89%
  FC131 TFA is a CXCR4 antagonist, inhibits [125I]-SDF-1 binding to CXCR4, with an IC50 of 4.5 nM. Anti-HIV activity[1].

  

• HY-P99637

  Gedivumab	1807954-17-1
  Gedivumab (MHAA4549A; RG7745) is a human monoclonal antibody that targets influenza A virus (IAV) with high specificity and binds to the highly conserved stem region of the IAV haemagglutinin protein, thereby preventing haemagglutinin maturation and blocking haemagglutinin-mediated membrane fusion in the intranucleosome. Gedivumab can be used in IAV infection disease studies[1].

  

• HY-100528A

  Dianemycin	35865-33-9
  Dianemycin (Nanchangmycin free acid), a polyether antibiotic produced by Streptomyces nanchangensis NS3226, inhibits gram-positive bacteria[1]. Nanchangmycin is a broad spectrum antiviral active against Zika virus[2].

  

• HY-106542A

  Eberconazole nitrate	130104-32-4	99.76%
  Eberconazole nitrate is a dichlorinated imidazole derivative with antifungal activity. Eberconazole nitrate is more effective than Clotrimazole (HY-10882), Ketoconazole (HY-B0105), and Miconazole (HY-B0454). Eberconazole nitrate has potential for the study of dermatophytosis[1][2].

  

• HY-106934A

  Peldesine dihydrochloride	2772702-10-8	99.63%
  Peldesine (BCX 34) dihydrochloride is a potent, competitive, reversible and orally active purine nucleoside phosphorylase (PNP) inhibitor with IC50s of 36 nM, 5 nM, and 32 nM for human, rat, and mouse red blood cell (RBC) PNP, respectively. Peldesine dihydrochloride is also a T-cell proliferation inhibitor with an IC50 of 800 nM. Peldesine dihydrochloride has the potential for cutaneous T-cell lymphoma, psoriasis and HIV infection research[1][2][3][4].

  

• HY-117025A

  Manzamine A hydrochloride	104264-80-4	99.66%
  Manzamine A hydrochloride, an orally active beta-carboline alkaloid, inhibits specifically GSK-3β and CDK-5 with IC50s of 10.2 μM and 1.5 μM, respectively. Manzamine A hydrochloride targets vacuolar ATPases and inhibits autophagy in pancreatic cancer cells. Manzamine A hydrochloride has antimalarial and anticancer activities. Manzamine A hydrochloride also shows potent activity against HSV-1[1][2][3][4].

  

• HY-128423A

  Tylvalosin	63409-12-1
  Tylvalosin (Acetylisovaleryltylo?sin) is an orally active, broad-spectrum macrolide antibiotic with antimicrobial activity. Tylvalosin is an antiviral agent used to study PRRSV infection. Tylvalosin induces apoptosis. Tylvalosin also has anti-inflammatory activity, alleviates oxidative stress, and alleviates acute lung injury by inhibiting NF-κB activation[1][2][3].

  

• HY-131606B

  Cidofovir diphosphate tri(triethylamine)		99.39%
  Cidofovir diphosphate tri triethylamine is an active intracellular metabolite of Cidofovir. Cidofovir diphosphate tri triethylamine is a selective inhibitor of viral DNA polymerases with Ki values of 6.6, 0.86 and 1.4 μM for HCMV, HSV-1 and HSV-2 DNA polymerase, respectively[1][2].

  

• HY-136429A

  Ethylhydrocupreine hydrochloride	3413-58-9	99.72%
  Ethylhydrocupreine hydrochloride (Optochin hydrochloride) is a quinine derivate with antimicrobial activity against S. pneumoniae. Ethylhydrocupreine hydrochloride also possesses antimalarial activity against Plasmodium falciparum, with an IC50 of 25.75 nM. Ethylhydrocupreine hydrochloride is a Gallus gallus taste 2 receptors (ggTas2r1, ggTas2r2 and ggTas2r7) agonist[1][2][3][4].

  

• HY-148560A

  trans-ccc_R08	2413192-49-9	99.71%
  trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV)[1].

  

• HY-40354AS

  Tofacitinib-d3 citrate	2701680-77-3	99.14%
  Tofacitinib-d3 (citrate) is deuterium labeled Tofacitinib (citrate). Tofacitinib citrate is an orally available JAK1/2/3 inhibitor with IC50s of 1, 20, and 112 nM, respectively. Tofacitinib citrate has antibacterial, antifungal and antiviral activities.

  

• HY-W010520

  Methylisothiazolinone	2682-20-4	99.37%
  Methylothiazolinone is a bacterial and fungal inhibitor and preservative, as well as a sensitizer. Methylisothiazolinone can activate matrix metalloproteinases (MMPs) in human bronchial epithelial cells to induce apoptosis and inflammatory response. Methylisothiazolinone can promote the development of atopic dermatitis in mice by disrupting Th2/Th17 related immune responses. Methylisothiazolinone can cause mitochondrial damage in the endothelium of rat cerebral blood vessels[1][2][4].

  

• HY-W011100

  Cyclofenil	2624-43-3
  Cyclofenil is a selective estrogen receptor modulator and an ovulation-inducing agent. Cyclofenil shows an inhibitory effect on dengue virus replication in Vero cells with an EC50 of 1.62 μM. Cyclofenil has anti-dengue-virus activity[1][2].

  

• HY-W013673

  2,3-Diaminopropionic acid hydrochloride	1482-97-9
  2,3-Diaminopropionic acid hydrochloride is the precursor of antibiotics and the siderophore staphyloferrin B. 2,3-Diaminopropionic acid hydrochloride is the inhibitor for polyphenoloxidase (PPO)[1][2].

  

• HY-W013699

  Chlorhexidine diacetate	56-95-1
  Chlorhexidine diacetate is a orally active cationic antimicrobial agent that targets microbial cell membranes. Chlorhexidine diacetate binds to cell membrane phospholipids non-specifically, destroys membrane structure and induces leakage of cell contents. Chlorhexidine diacetate has broad-spectrum bactericidal activity against both Gram-positive and Gram-negative bacteria. Chlorhexidine diacetate can interfere with membrane permeability, cause protein precipitation and energy metabolism disorders, such as rapid inhibition of microbial growth and induction of cell death (necrosis or apoptosis)[1][2][3].

  

• HY-W040073

  Nifurtimox	23256-30-6	99.72%
  Nifurtimox, an antiprotozoal agent, which is generally used for the treatment of infections with Trypanosoma cruzi, has been used in the therapy of neuroblastoma. Nifurtimox affects enzyme activity of lactate dehydrogenase (LDH).

  

• HY-W041080

  3,5-Di-tert-butylphenol	1138-52-9	99.98%
  3,5-Di-tert-butylphenol is an volatile organic compound with anti-biofilm and antifungal activities. 3,5-Di-tert-butylphenol induces accumulation of reactive oxygen species (ROS) in C. albicans cells. 3,5-Di-tert-butylphenol also has antibacterial activities[1][2].

  

• HY-W091784

  3'-O-Methylguanosine	10300-27-3
  3'-O-Methylguanosine is a methylated nucleoside analogs and a RNA chain terminator. 3'-O-methylguanosine can inhibit early virus-specific RNA synthesis[1].

  

• HY-W129596

  Policresulen	101418-00-2
  Policresulen is a competitive inhibitor for DENV2 NS2B/NS3 protease with an IC50 of 0.48 μg/mL. Policresulen can be used as a local hemostatic and antibacterial agent for research of cervical and vaginal inflammation, skin lesions, oral mucosa and gingival inflammation[1][2].

  

• HY-W291131

  Isatin-β-thiosemicarbazone	27830-79-1	99.58%
  Isatin-β-thiosemicarbazone is a potent anti-poxvirus agent (including monkeypox virus, orthopoxvirus, vaccinia virus, etc). Isatin-β-thiosemicarbazone also is a potent herpes simplex virus (HSV) inhibitor. Isatin-β-thiosemicarbazone exhibits

  

• HY-W324882

  Salinazid	495-84-1	99.91%
  Salinazid is an antituberculous compound[1].

  

• HY-W749694

  Cannflavin B	76735-58-5	98.36%
  Cannflavin B is a flavonoid compound that can be isolated from Cannabis sativa L. Cannflavin B is inhibitors of PGE2 release (IC50: 0.7 μM), mPGES-1 (IC50: 3.7 μM), and 5-lipoxygenase. Cannflavin B has multiple activities such as anti-inflammatory, antioxidant, anti-glycation, anti-ferroptosis, anti-tumor, and anti-Leishmania (IC50: 14 μM). Cannflavin B can also inhibit the TrkB-BDNF signaling pathway[1][2][3][4].

  

• HY-10544

  Tegobuvir	1000787-75-6	98.01%
  Tegobuvir is a specific, covalent inhibitor of the HCV NS5B polymerase.

  

• HY-17036

  Naphthoquine phosphate	173531-58-3	99.59%
  Naphthoquine phosphate is a potent and orally active antimalarial agent. Naphthoquine phosphate has thorough killing function for various schizonts of plasmodia, including resistance of P. falciparum to Chloroquine[1][2].

  

• HY-B0914

  10-Undecenoic acid,98% (stabilized with TBC)	112-38-9
  10-Undecenoic acid (Undecylenic acid) is an antifungal agent. 10-Undecenoic acid inhibits Aβ oligomerization, scavenges ROS and inhibits μ-calpain activity. 10-Undecenoic acid has neuroprotective effects. 10-Undecenoic acid has anticancer effects on a variety of tumors. 10-Undecenoic acid inhibits C. albicans biofilm formation and MRSA infection. 10-Undecenoic acid inhibits quorum sensing signals of Bacillus subtilis and Pseudomonas aeruginosa[1][2][3][4][5][6][7][8].

  

• HY-B0960

  Sulfabenzamide	127-71-9	99.68%
  Sulfabenzamide (N-Sulfanilylbenzamide) is an antimicrobial agent and usually consumed in combination with Sulfathiazole and Sulfacetamide. Sulfabenzamide is effective against Gram-positive and negative bacterial strains[1].

  

• HY-B1143

  Broxaldine	3684-46-6	99.50%
  Broxaldine (Brobenzoxaldine) is an antiprotozoal agent. Broxaldine inhibits Clostridium difficile with a MIC value of 4 µM, and has antifungal effects[1][2].

  

• HY-B1267

  Sulfaguanidine	57-67-0
  Sulfaguanidine is an orally active antimicrobial agent/antibiotic of sulfonamide class. Sulfaguanidine can be used for the research of enteric infections such as bacillary dysentery[1][2].

  

• HY-B1530

  Ammonium lactate (60% in water)	515-98-0
  Ammonium lactate is the ammonium salt of lactic acid, with mild anti-bacterial properties. Ammonium lactate can be used for the research of xerosis[1][2][3].

  

• HY-B2004

  Thifluzamide	130000-40-7	98.36%
  Thifluzamide, a broad-spectrum succinate dehydrogenase inhibitor (SDHI) fungicide, has been widely used in the controlling of a variety of fungal diseases in rice fields[1][2].

  

• HY-N0838

  Cephalotaxine	24316-19-6
  Cephalotaxlen ((-)-Cephalotaxine) is an alkaloid that can be isolated from Cephalotaxus fortunei, with antileukemic and antiviral activities. Cephalotaxlen has anti-ZIKV (Zika virus) activity[1][2][3].

  

• HY-164793

  TGFBR1-IN-2	733806-89-8
  TGFBR1-IN-2 (Compound AQA) is a TGFBR1 inhibitor and an antibacterial agent. TGFBR1-IN-2 is a substrate for cytochrome P450s. TGFBR1-IN-2 contains the pyridyl-6-methyl moiety necessary for Mycobacterium tuberculosis inhibition and has potent inhibitory activity against non-replicating and persistent Mycobacterium tuberculosis[1].

  

• HY-22055B

  AN-12-H5 intermediate-1	254882-14-9
  AN-12-H5 intermediate-1 ((2S,4S)-1-tert-butyl 2-methyl-4-hydroxypiperidine-1,2-dicarboxylate) is an intermediate of the viral inhibitor AN-12-H5 (HY-120900) and can be used to synthesize Antibody-Drug Conjugates (ADCs).

  

• HY-A0181R

  Adenosine monophosphate (Standard)	61-19-8
  Adenosine monophosphate (Standard) is the analytical standard of Adenosine monophosphate (HY-A0181). This product is intended for research and analytical applications. Adenosine monophosphate is an adenosine A1 receptor agonist. Adenosine monophosphate has significant antiviral activity against HSV-1 and HSV-2. Adenosine monophosphate is a key cellular metabolite regulating energy homeostasis and signal transduction[1][2][3].

  

• HY-B0420A

  Moroxydine hydrochloride	3160-91-6	99.45%
  Moroxydine (ABOB) hydrochloride has multi-antiviral activities against DNA and RNA viruses including influenza symptoms, herpes simplex, varicellazoster, measles, mumps disease, hepatitis C virus, etc. Moroxydine hydrochloride shows high anti-grass carp reovirus (GCRV) activity[1].

  

• HY-B0522R

  Ampicillin (Standard)	69-53-4
  Ampicillin (Standard) is the analytical standard of Ampicillin. This product is intended for research and analytical applications. Ampicillin is a broad-spectrum beta-lactam antibiotic against a variety of gram-positive and gram-negative bacteria.

  

• HY-N10633

  LSTc	64003-55-0
  LSTc (LS-tetrasaccharide c) is a human lactooligosaccharide presents on glycoproteins and glycolipids. LSTc is also a specific human JC polyomavirus (JCV) recognition motif. LSTc has good potential for the study of progressive multifocal leukoencephalopathy (PML)[1].

  

• HY-N1428R

  Citric acid (standard)	77-92-9
  Citric acid (Standard) is the analytical standard of Citric acid (HY-N1428). This product is intended for research and analytical applications. Citric acid is a natural preservative and food tartness enhancer. Citric acid induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-W003943

  6-Hydroxypyridin-3-ylboronic acid	903899-13-8
  6-Hydroxypyridin-3-ylboronic acid is a heterocyclic building block, which can be used in the synthesis of non-nucleoside inhibitors of hepatitis C virus (HCV) RNA-dependent RNA polymerase nonstructural protein 5B (NS5B). 6-Hydroxypyridin-3-ylboronic acid has also been used in the synthesis of mammalian target of rapamycin (mTOR) inhibitors[1][2].

  

• HY-W004486

  Gallic aldehyde	13677-79-7
  Gallic aldehyde is a HSV-1 inhibitor isolated from Geum japonicum, with potent antiviral activity[1].

  

• HY-W028350

  NSC727447	40106-12-5
  NSC727447 is an inhibitor of ribonuclease H (Rnase H) of HIV-1 and HIV-2. NSC727447 has little activity against E. coli RNase H, but great selectivity over human Rnase H, with IC50s value of 2.0 μM, 2.5 μM, 100 μM, 10.6 μM, respectively[1].

  

• HY-W145657

  Trehalose 6,6′-dimycolate	61512-20-7
  Trehalose 6,6'-dimycolate (Cord Factor) is trehalose 6,6'-dimycolate, a cell wall glycolipid of Mycobacterium tuberculosis, which can be used to simulate inflammation and granuloma induced by Mycobacterium tuberculosis (MTB) form. Trehalose 6,6′-dimycolate also protects Mycobacterium tuberculosis from macrophage-mediated killing, inhibits efficient antigen presentation, and reduces the development of protective T cell responses[1][2].

  

• HY-10852

  Arterolane	664338-39-0
  Arterolane is an antimalarial agent, with IC50 of both 1.1 nM against P. falciparum Ro73 and W2, respectively.

  

• HY-145119

  GS-621763	2647442-13-3	99.72%
  GS-621763 is an orally available precursor to GS-441524 that exhibits anti-SARS-CoV-2 viral activity in mice. GS-621763 reduces viral load to undetectable levels in ferrets infected with SARS-CoV-2[1][2].

  

• HY-B0113S

  Omeprazole-d3	922731-01-9
  Omeprazole-d3 is deuterium labeled Omeprazole. Omeprazole, a proton pump inhibitor (PPI), is available for treatment of acid-related gastrointestinal disorders. Omeprazole shows competitive inhibition of CYP2C19 activity with a Ki of 2 to 6 μM[1]. Omeprazole also inhibits growth of Gram-positive and Gram-negative bacteria[2].

  

• HY-W040128

  Kanamycins sulfate	70560-51-9
  Kanamycins sulfate is a broad-spectrum antibiotic, can be used in certain severe staphylococcal or Gram-negative bacillary infections. Kanamycin sulfate has certain ototoxicity[1][2].

  

• HY-12785

  Albendazole sulfoxide	54029-12-8	99.20%
  Albendazole sulfoxide (Ricobendazole), the main active metabolite of Albendazole, exhibits anti-parasite effect against Echinococcus multilocularis Metacestodes[1].

  

• HY-19743

  Triazavirin	928659-17-0	99.15%
  Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza[1].

  

• HY-103487

  Uprifosbuvir	1496551-77-9	99.20%
  Uprifosbuvir is an antiviral agent. Uprifosbuvir is a NS5b inhibitor developed for the research of chronic hepatitis C virus[1].

  

• HY-107123

  TMC310911	1000287-05-7	99.90%
  TMC310911 is a potent and orally active HIV type-1 (HIV-1) protease inhibitor with EC50 values ranged from 2.2 nM to 14.2 nM for wild-type HIV-1. TMC310911 has potent activity against a wide spectrum of recombinant HIV-1 isolates. TMC310911 has strong antiviral activity[1][2].

  

• HY-109035

  Inarigivir soproxil	942123-43-5	99.87%
  Inarigivir soproxil (SB9200) is an agonist of innate immunity and shows potent antiviral activity against resistant HCV variants, with EC50s of 2.2 and 1.0 μM for HCV 1a/1b in cells of genotype 1 HCV replicon systems. Inarigivir soproxil, an orally bioavailable proagent of SB 9000, has broad-spectrum antiviral activity against RNA viruses including HCV, norovirus, respiratory syncytial virus and influenza and HBV[1][2].

  

• HY-117766

  PC945	1931946-73-4	99.27%
  PC945, a potent, long-acting antifungal triazole, possesses activity against a broad range of both azole-susceptible and azole-resistant strains of Aspergillus fumigatus. PC945 is also a potent, tightly binding inhibitor of A. fumigatus sterol 14α-demethylase activity, CYP51A and CYP51B, with IC50s of 0.23 μM and 0.22 μM, respectively[1][2].

  

• HY-125176

  G907	2244035-16-1	98.14%
  G907 is a selective antagonist of ATP-binding cassette (ABC) transporter MsbA with anti-microbial activity. G907 inhibits E. coli MsbA with an IC50 value of 18 nM. G907 traps MsbA in an inward-facing, lipopolysaccharide-bound conformation by wedging into an architecturally conserved transmembrane pocket[1][2].

  

• HY-145579

  Linvencorvir	1808248-05-6	98.02%
  Linvencorvir (RG7907) is an orally active Hepatitis B virus core protein allosteric modulator. Linvencorvir induces Apoptosis. Linvencorvir has antiviral activity against HBV[1][2][3][4][5][6].

  

• HY-126323B

  TCMDC-135051 hydrochloride	2705545-47-5	98.30%
  TCMDC-135051 hydrochloride is a highly selective and potent protein kinase PfCLK3 inhibitor with low off-target toxicity. TCMDC-135051 hydrochloride prevents trophozoite-to-schizont transition, disrupts transcription and reduces transmission to the mosquito vector. TCMDC-135051 hydrochloride has antiparasiticidal activity (EC50=320 nM)[1].

  

• HY-17503AS

  Metoprolol-d7 hydrochloride	1219798-61-4	99.71%
  Metoprolol-d7 (hydrochloride) is the deuterium labeled Metoprolol. Metoprolol is an orally active, selective β1-adrenoceptor antagonist. Metoprolol shows anti-inflammation, antitumor and anti-angiogenic properties[1][2][3][4].

  

• HY-10300

  Narlaprevir	865466-24-6	98.15%
  Narlaprevir (SCH 900518) is a selective and orally bioavailable NS3 protease inhibitor with a Ki value of 6 nM and an EC90 value of 40 nM[1]. Narlaprevir also inhibits the HCV nonstructural protein 3 serine protease[2]. Narlaprevir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 2.3 μM[3].

  

• HY-10522

  LEDGIN6	957890-42-5	99.62%
  LEDGIN6 (CX05168) is a quinoline-based protein-protein interaction inhibitor of LEDGF/p75 and HIV integrase[1].

  

• HY-101634

  ABT-072	1132936-00-5
  ABT-072 is an orally active and potent non-nucleoside HCV NS5B polymerase inhibitor (HCV GT1a EC50=1 nM; HCV GT1b EC50=0.3 nM)[1][2][3].

  

• HY-135532

  Amoxicillin-clavulanate potassium	74469-00-4
  Amoxicillin-clavulanate potassium is an antibiotic. Amoxicillin-clavulanate potassium has the potential for the research of various bacterial infection[1].

  

• HY-147110

  APX2039	2342606-49-7	98.12%
  APX2039 is an orally active and potent inhibitor of the fungal Gwt1 enzyme. APX2039 has extremely potent anticryptococcal activity against C. neoformans and C. gattii. APX2039 blocks the localization of GPI (glycosylphosphatidyl inositol)-anchored cell wall mannoproteins. APX2039 can be used for Cryptococcal meningitis (CM) research[1][2].

  

• HY-15440B

  Fostemsavir Tris	864953-39-9	99.78%
  Fostemsavir Tris (BMS-663068 (Tris)) is the phosphonooxymethyl proagent of BMS-626529. Fostemsavir Tris (BMS-663068 (Tris)) is a novel attachment inhibitor that targets HIV-1 gp120 and prevents its binding to CD4+ T cells.

  

• HY-A0256A

  Clavulanate potassium	61177-45-5
  Clavulanate potassium is a potent β-lactamase inhibitor and acts as an antibiotic[1][2].

  

• HY-B1751B

  Quinine sulfate	549-56-4
  Quinidine sulfate is an antiarrhythmic agent. Quinidine sulfate is a potent, orally active, selective cytochrome P450db inhibitor. Quinidine sulfate is also a K+ channel blocker with an IC50 of 19.9 μM. Quinidine sulfate can be used for malaria research[1][2][3].

  

• HY-117411A

  Coblopasvir dihydrochloride	1966138-53-3	99.19%
  Coblopasvir (KW-136) dihydrochloride is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir dihydrochloride can be used for research of chronic hepatitis C virus infection[1].

  

• HY-P990036

  Dazukibart	2639474-65-8	99.76%
  Dazukibart is a mouse-derived, humanized IgG1κ antibody targeting interferon beta 1 (IFNB1)[1].

  

• HY-14655S

  Sulfasalazine-d4	1346606-50-5
  Sulfasalazine-d4 is the deuterium labeled Sulfasalazine. Sulfasalazine (NSC 667219) is an anti-rheumatic agent for the research of rheumatoid arthritis and ulcerative colitis. Sulfasalazine can suppress NF-κB activity. Sulfasalazine is a type 1 ferroptosis inducer[1][2][3][4].

  

• HY-10004

  Faropenem daloxate	141702-36-5	98.18%
  Faropenem daloxate is the first oral penem in a new class of beta-lactam antibiotics.

  

• HY-10165

  PSI-6130	817204-33-4
  PSI-6130 is a potent and selective inhibitor of HCV NS5B polymerase, and inhibits HCV replication with a mean IC50 of 0.6 μM.

  

• HY-10393

  Eperezolid	165800-04-4
  Eperezolid (PNU-100592) is an orally active protein synthesis inhibitor that targets the bacterial 50S ribosomal subunit. Eperezolid competitively binds to a specific site on the ribosomal 50S subunit (overlapping with the binding sites of chloramphenicol (HY-B0239) and lincomycin (HY-117660)) to inhibit the translation initiation stage and exert antibacterial activity. Eperezolid can induce host cell autophagy to enhance the clearance of intracellular mycobacteria, and its MIC90 for Staphylococcus aureus and Enterococcus is 1-4 μg/mL. Eperezolid is mainly used for antibacterial research on infections with Gram-positive bacteria such as methicillin-resistant (HY-121544) Staphylococci and vancomycin-resistant (HY-B0671) Enterococci, as well as infections with intracellular bacteria such as Mycobacterium tuberculosis[1][2][3][4].

  

• HY-12607

  ML251	1486482-16-9	99.62%
  ML251, a potent nanomolar T. brucei and T. cruzi phosphofructokinase (PFK) inhibitor, inhibits T. brucei PFK (IC50=0.37 μM) and T. cruzi PFK (IC50=0.13 μM). ML251 can be used for the research of parasite[1].

  

• HY-13451

  Finafloxacin	209342-40-5	98.75%
  Finafloxacin is a fluoroquinolone antimicrobial agent that exhibits optimum efficacy in slightly acidic environments.

  

• HY-16158

  Cyclacillin	3485-14-1	99.79%
  Cyclacillin (Wy-4508) is an orally active aminopenicillin antibiotic, shows antibacterial activity against a wide range of gram-positive and gram-negative pathogens[1].

  

• HY-17522

  Meptyldinocap	131-72-6	99.91%
  Meptyldinocap (2,4-DNOPC) is a novel powdery mildew (Erysiphe necator) fungicide which shows protectant and post-infective activities.

  

• HY-19502

  Artemisone	255730-18-8
  Artemisone (Artemifone) is a potent and semi-synthetic antimalarial, inhibits P. falciparum strains, with a mean IC50 of 0.83 nM[1]. Artemisone is also a potent inhibitor of human CMV[2].

  

• HY-B0333

  Sulfamethizole	144-82-1	99.62%
  Sulfamethizole is a sulfathiazole antibacterial agent.

  

• HY-B0483

  Tioxolone	4991-65-5	98.24%
  Tioxolone is an inhibitor for the carbonic anhydrase. Tioxolone exhibits anti-leishmanial, antitumor, and anti-inflammatory activities. Tioxolone can be used in research of acne and psoriasis[1][2][3].

  

• HY-B0821

  Pymetrozine	123312-89-0
  Pymetrozine is a feeding inhibitor of Homoptera, in preventing transmission of cauliflower mosaic caulimovirus by the aphid species Myzus persicae (Sulzer).

  

• HY-B0898

  Ceftiofur sodium	104010-37-9	98.03%
  Ceftiofur sodium is a cell wall synthesis inhibitor that targets bacterial penicillin-binding proteins (PBPs) and has anti-inflammatory effects in endotoxemia. Ceftiofur sodium exerts bactericidal effects by inhibiting the synthesis of bacterial cell wall peptidoglycan, leading to bacterial cell lysis. Ceftiofur sodium also inhibits the activation of NF-κB and MAPKs, thereby reducing the secretion of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6[1][2][3].

  

• HY-B0946

  Sulfamonomethoxine	1220-83-3
  Sulfamonomethoxine is an orally active sulfonamide antibiotic for veterinary use. Sulfamonomethoxine is also an inhibitor of dihydropteroate synthetase, which can block the synthesis of folic acid. Sulfamonomethoxine has antibacterial activity[1][2].

  

• HY-B0959

  Chloramine-T	127-65-1
  Chloramine-T is a titrimetric reagent, and an oxidizing agent. Chloramine-T is an oxidizing biocide[1][2].

  

• HY-B1890

  (±)-Catechin	7295-85-4	98.80%
  (±)-Catechin (rel-Cianidanol) is the racemate of the green tea polyphenol Catechin. Catechin has anticancer activity and induces apoptosis. (±)-Catechin has two forms, (+)-Catechin and its enantiomer (-)-Catechin. (+)-Catechin inhibits cyclooxygenase-1 (COX-1) with an IC50 of 1.4 μM. (-)-Catechin can effectively promote hBM-MSC adipocyte differentiation and increase adiponectin and PPARγ levels. (±)-Catechin has anti-tumor, anti-obesity, anti-diabetic, anti-cardiovascular, anti-infectious, hepatoprotective and neuroprotective effects[1][2][3].

  

• HY-B1978

  Iprodione	36734-19-7	99.25%
  Iprodione is an orally active diformimide fungicide. Iprodione can specifically cause oxidative damage by producing free radicals (ROS). Iprodione is also an antiandrogen agent that delays adolescent development in rats and reduces sexual behavior and reproductive ability in rats[1][2][3][4][5].

  

• HY-B2148

  Myclobutanil	88671-89-0	99.86%
  Myclobutanil is a conazole class fungicide widely used as an agrichemical.

  

• HY-G0007

  Omeprazole sulfone	88546-55-8
  Omeprazole sulfone is a metabolite of Omeprazole, which is a proton pump inhibitor.

  

• HY-N0554

  Escin IA	123748-68-5
  Escin IA is a triterpene saponin isolated from Aesculus hippocastanum, which inhibits HIV-1 protease with IC50 values of 35 μM. Escin IA has anti-TNBC metastasis activity, and its action mechanisms involved inhibition of epithelial-mesenchymal transition process by down-regulating LOXL2 expression[1][2].

  

• HY-N0654

  Corypalmine	27313-86-6	99.48%
  Corypalmine is an alkaloid from Stephania cepharantha. Corypalmine is an antifungal.

  

• HY-N1453

  Hypocrellin B	123940-54-5	99.61%
  Hypocrellin B, a pigment isolated from the fungi Hypocrella bambusae and Shiraia bambusicola, is an apoptosis inducer. Hypocrellin B can be used as a photosensitizer for photodynamic therapy of cancer. Hypocrellin B also has antimicrobial and antileishmanial activities[1][2][3].

  

• HY-N1860

  3-O-Methylquercetin	1486-70-0	99.98%
  3-O-Methylquercetin is an inhibitor of cAMP and CGMP-phosphodiesterase (PDE) with IC50 at 13.8 μM and 14.3 μM, respectively. 3-O-Methylquercetin is an inhibitor of β-secretase with an IC50 of 6.5 μM. 3-O-Methylquercetin has a neuroprotective effect against neuronal death caused by oxidative damage. 3-O-Methylquercetin has strong antiviral activity against poliovirus, coxsackie virus and human rhinovirus. 3-O-Methylquercetin has anti-inflammatory and trachea-relaxing effects and can be used in the study of inflammatory diseases and asthma[1][2][3][4][5][6].

  

• HY-N1969

  3,3'-Di-O-methylellagic acid	2239-88-5
  3,3'-Di-O-methylellagic acid obtained from Euphorbia adenochlora selectively inhibits the formation of acid-fastness in mycobacteria without retardation of their growth. 3,3'-di-O-methylellagic acid as a hepatoprotective compound is apparently due to its antioxidative effect[1][2].

  

• HY-N2004

  Isoborneol	124-76-5
  Isoborneol ((±)-Isoborneol) is a monoterpenoid alcohol present in the essential oils of numerous medicinal plants and has antioxidant and antiviral properties. Isoborneol is a potent inhibitor of herpes simplex virus type 1 (HSV-1)[1][2].

  

• HY-N2060

  Evocarpine	15266-38-3
  Evocarpine, a quinolone alkaloid that could be isolated from Evodiae fructus, inhibitss Ca2+ influx through voltage-dependent calcium channels. Antimycobacterial activity[1][2].

  

• HY-N2443

  Tribuloside	22153-44-2	99.64%
  Tribuloside is a flavonoid that can be isolated from Tribulus terrestris L[1]. Tribuloside exhibits anti-mycobacterial activity against the non-pathogenic Mycobacterium species with a minimum inhibitory concentration (MIC) of 5.0 mg/mL. Tribuloside has 1,1-diphenyl-2-picrylhydrazyl radical scavenging activity[2].

  

• HY-N2460

  Aloesin	30861-27-9	99.62%
  Aloesin (Aloeresin) is a tyrosinase inhibitor, and shows anti-inflammatory activity, ultraviolet protection, and antibacterium effects. Aloesin can induce apoptosis and be used in ovarian cancer research[1][2][3].

  

• HY-N2552

  Vitamin K5 hydrochloride	130-24-5	98.00%
  Vitamin K5 hydrochloride is a photosensitizer and a antimicrobial agent. Vitamin K5 hydrochloride is a specific PKM2 inhibitor with IC50 values of 28, 191 and 120 μM for PKM2, PKM1 and PKL. Vitamin K5 hydrochloride induces apoptosis of colon 26 cells. Vitamin K5 hydrochloride can be used for the research of infection and cancer, and it also can be used as a preservative for pharmaceuticals, foods, and beverages[1][2][3].

  

• HY-N3016

  Rupestonic acid	83161-56-2	99.72%
  Rupestonic acid, a sesquiterpene, can inhibit influenza virus[1].

  

• HY-N3536

  Canthin-6-one	479-43-6	99.92%
  Canthin-6-one is an indole alkaloid, displays antibacterial and anti-inflammatory activities[1][2].

  

• HY-N3807

  Enniatin B1	19914-20-6
  Enniatin B1 is a Fusarium mycotoxin. Enniatin B1 inhibits acyl-CoA: cholesterol acyltransferase (ACAT) activity with an IC50 of 73 μM in an enzyme assay using rat liver microsomes[1]. Enniatin B1 crosss the blood-brain barrier[2]. Enniatin B1 decreases the activation of ERK (p44/p42). Enniatin B1 inhibits moderately TNF-α-induced NF-κB activation[3].

  

• HY-N4005

  Isoastilbin	54081-48-0	99.80%
  Isoastilbin is a dihydroflavonol glycoside compound in Rhizoma Smilacis glabrae and Astragalus membranaceus. Isoastilbin inhibits glucosyltransferase (GTase) with an IC50 value of 54.3 μg/mL, and also inhibits tyrosinase activity. Isoastilbin shows neuroprotective, antioxidation, antimicrobial and anti-apoptotic properties and has the potential for Alzheimer’s disease research[1][21][3].

  

• HY-N4102

  5,7-Dihydroxy-4-methylcoumarin	2107-76-8	98.02%
  5,7-Dihydroxy-4-methylcoumarin is a coumarin derivative from Mexican tarragon. 5,7-Dihydroxy-4-methylcoumarin possesses antifungal and antibacterial activities[1].

  

• HY-N6635

  trans-Nerolidol	40716-66-3
  trans-Nerolidol is a sesquiterpene alcohol. It can be isolated from f aerial parts of Warionia saharae ex Benth. trans-Nerolidol improves the anti-proliferative effect of Doxorubicin (HY-15142A) against intestinal cancer cells in vitro. trans-Nerolidol also has anti-fungal activity[1][2].

  

• HY-N6714

  Alternariol	641-38-3
  Alternariol is an orally ingested mycotoxin produced by Alternaria, capable of inhibiting the activity of topoisomerase I and II (topoisomerase I, topoisomerase II). Alternariol has weak estrogenic (Estrogen Receptor/ERR) and androgen/antiandrogen (Androgen Receptor) effects. Alternariol can induce apoptosis, trigger cell cycle arrest, suppress innate immune responses, and exhibit anti-tumor activity. Alternariol has genotoxic, mutagenic, and endocrine-disrupting effects[1][2][3][4][5].

  

• HY-N7082

  D-Arabinopyranose	28697-53-2
  D-Arabinopyranose is a rare aldehyde pentose, and its ring-opened form is D-arabinose (HY-N0059). D-arabinose is is an orally active antidepressant and a growth inhibitor of C. elegans (IC50 is 7.5 mM). D-arabinose can penetrate the blood-brain barrier, selectively interfere with the metabolism of D-ribose and D-fructose, and inhibit the growth of nematodes. D-arabinose can also inhibit the synthesis of cell biofilm and exert antibacterial activity. D-arabinose activates the ACSS2-PPARγ/TFEB-CRTC1 axis through the lysosomal AXIN-LKB1-AMPK pathway, inducing CRTC1 transcription, exerts antidepressant-like activity. D-arabinose is the ring-opened form of the aldopentose D-?Arabinose (HY-N7082)[1][2][3][4].

  

• HY-N7102

  Ceftiofur	80370-57-6	99.06%
  Ceftiofur is a cell wall synthesis inhibitor that targets bacterial penicillin-binding proteins (PBPs) and has anti-inflammatory effects in endotoxemia. Ceftiofur exerts bactericidal effects by inhibiting the synthesis of bacterial cell wall peptidoglycan, leading to bacterial cell lysis. Ceftiofur also inhibits the activation of NF-κB and MAPKs, thereby reducing the secretion of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6[1][2][3].

  

• HY-N7395

  Cyclic ADP-​ribose	119340-53-3
  Cyclic ADP-ribose (cADPR) is a potent second messenger for calcium mobilization that is synthesized from NAD+ by an ADP-ribosyl cyclase. Cyclic ADP-ribose increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels[1][2][3].

  

• HY-N7510

  12-O-Methylcarnosic acid	62201-71-2	99.67%
  12-O-Methylcarnosic acid (12-Methoxycarnosic acid), a diterpene carnosic acid isolated from the acetone extract of Salvia microphylla, is an active constituent of 5α-reductase inhibition with an IC50 value of 61.7 μM. 12-O-Methylcarnosic acid inhibits proliferation in LNCaP cells. 12-O-Methylcarnosic acid has antioxidant, anti-cancer and antimicrobial activity[1][2].

  

• HY-N7652

  Terminolic acid	564-13-6	99.63%
  Terminolic acid is a pentacyclic triterpene glycoside and antibacterial agent. Terminolic acid can be isolated from Combretum racemosum. Terminolic acid inhibits proinflammatory cytokines by binding to the receptor active sites of IL-1β and IL-6. Terminolic acid reduces IL-8. Terminolic acid has antibacterial activity against Staphylococcus aureus, Escherichia coli and Enterococcus faecalis with MICs ranging from 64 to 256 μg/mL. Terminolic acid is used in colon cancer research[1][2][3].

  

• HY-N7765

  Oenothein B	104987-36-2
  Oenothein B is a dimeric macrocyclic ellagitannin and has widely pharmacological activities, including antioxidant, anti-inflammatory, antifungal, anti-HCV, and antitumor properties. Oenothein B is a potent and specific inhibitor of poly(ADP-ribose) glycohydrolase[1][2].

  

• HY-N7906

  Myricetin 3-O-glucoside	19833-12-6
  Myricetin 3-O-glucoside (Myricetin 3-β-D-glucopyranoside) is a flavonol from Tibouchina paratropica and Hakmeitau beans. Myricetin 3-O-glucoside exhibits anti-Leishmanial, anti-inflammatory and antimicrobial activities[1][2][3].

  

• HY-N9388

  Andrograpanin	82209-74-3	99.89%
  Andrograpanin, a bioactive compound from Andrographis paniculata, exhibits anti-inflammatory and anti-infectious properties[1][2].

  

• HY-P2232

  Conalbumin	1391-06-6
  Conalbumin (Ovotransferrin), also known as ovotransferrin, is a monomeric glycoprotein consisting of 686 amino acids, encoded by the avian transferrin gene in the oviduct, and a prominent component of chicken egg white. Exhibiting a unique glycosylation pattern that differentiates it from serum transferrin, Conalbumin is a potent iron binder that plays a crucial role in iron transport to developing embryos. Additionally, it possesses a range of biological activities, including antimicrobial, antifungal, antiviral, anticancer, antioxidative, antihypertensive, and immunoregulatory properties, making it valuable in numerous applications such as infant formula ingredients, food additives, and agents for enhancing animal health.

  

• HY-P2695

  STh	118447-40-8	99.06%
  STh, an Escherichia coli heat-stable toxin, is a 19 amino acid polypeptide encompassing three disulfide bridges. STh is an antigen of interest in the search for a broad coverage enterotoxigenic Escherichia coli (ETEC) vaccine[1].

  

• HY-P3461

  Argadin	289665-92-5	98.71%
  Argadin is a cyclopentapeptide chitinase inhibitor. Argadin inhibits chitinase B (ChiB) with a Ki value of 20 nM. Argadin can be used for the research of fungicid and insecticid[1][2].

  

• HY-Y1832

  o-Vanillin	148-53-8
  o-Vanillin (2-Vanillin) is a nature product, could be extracted from Vanilla planifolia, Pinus koraiensis fruit. o-Vanillin is a potent antifungal agent. o-Vanillin inhibits the growth of mycelia by disrupting the integrity of cell walls and cell membranes. o-Vanillin inhibits Doxorubicin (HY-15142A)- and 4-hydroperoxycyclophosphamide-induced NF-κB activation[1][2].

  

• HY-100555

  CH5138303	959763-06-5
  CH5138303 is a potent and orally active Hsp90 inhibitor. CH5138303 shows high binding affinity for N-terminal Hsp90α, with Kd of 0.52 nM. CH5138303 shows potent anti-proliferative activity against human cancer cell lines (HCT116 and NCI-N87), with IC50 values of 0.098 and 0.066 μM, respectively. CH5138303 shows high oral bioavailability in mice (F=44.0%). CH5138303 shows potent antitumor efficacy in a human NCI-N87 gastric cancer xenograft model[1][2].

  

• HY-100956

  Flurofamide	70788-28-2
  Flurofamide is a potent bacterial urease inhibitor with potential in the treatment of infection induced urinary stones[1].

  

• HY-101014

  Octanoylcarnitine chloride	14919-35-8
  Octanoylcarnitine chloride is a homolog of acetylcarnitine chloride. Octanoylcarnitine chloride can enhance absorption of drugs from gastrointestinal tract[1].

  

• HY-103249

  Reutericyclin	303957-69-9	98.11%
  Reutericyclin (Reutericycline), a unique tetramic acid, is an antibiotic produced by some strains of Lactobacillus reuteri. Reutericyclin (Reutericycline) exhibits a broad inhibitory spectrum including Lactobacillus spp., Bacillus subtilis, B. cereus, Enterococcus faecalis, Staphylococcus aureus, and Listeria innocua[1][2].

  

• HY-105117

  Fantofarone	114432-13-2	99.91%
  Fantofarone is a highly potent Calcium Channel antagonist.

  

• HY-10585R

  Valproic acid (Standard)	99-66-1
  Valproic acid (Dipropylacetic Acid) (Standard) is an analytical standard for valproic acid. This product is intended for research and analytical applications. Valproic acid is an orally active HDAC inhibitor (IC50=0.5-2 mM), inhibits the activity of HDAC1 (IC50=400 μM), and induces the degradation of HDAC2. Valproic acid activates Notch1 signaling and inhibits the proliferation of small cell lung cancer (SCLC) cells. Valproic acid is used in the study of epilepsy, bipolar disorder, metabolic diseases, HIV infection, and migraine[1][2][3][4][5][6][7].

  

• HY-108402

  Cefodizime	69739-16-8
  Cefodizime is a third generation cephalosporin antibiotic with a broad spectrum of antibacterial activity. Cefodizime has no renal toxic effect, good tolerance and immune regulation activity, and has the potential for severe infections of the respiratory and urinary tracts[1][2].

  

• HY-110398

  5,6,7-Trimethoxyflavone	973-67-1	98.76%
  5,6,7-Trimethoxyflavone is a flavonoid compound that can be isolated from plants Callicarpa japonica. 5,6,7-Trimethoxyflavone exhibits antiviral and anti-inflammatory activities through inhibition of NF-κB/AP-1/STAT signaling pathway[1][2].

  

• HY-113133

  Kojibiose	2140-29-6	99.76%
  Kojibiose, an orally active prebiotic disaccharide, can specifically inhibit the activity of α-glucosidase I. kojibiose is a proliferation factor for Bifidobacterium, lactic acid bacteria, and eubacteria. kojibiose is a low-calorie sweetener capable of increasing the absorption of iron. Kojibiose exhibits antitoxic activity. Kojibiose reduces hepatic expression of inflammatory markers in vivo[1][2].

  

• HY-115584

  Lufenuron	103055-07-8	99.57%
  Lufenuron is an orally active lipophilic benzoylurea insecticide and a chitin synthesis inhibitor that can used for flea and fish lice control. Lufenuron inhibits moulting of arthropods. Lufenuron induces reproductive toxicity, genotoxic effects and oxidative stresses in pregnant albino rats and their fetuses[1][2][3][4].

  

• HY-116214

  Cyprodinil	121552-61-2	99.36%
  Cyprodinil (CGA-219417) is a broad-spectrum anilinopyrimidine fungicide and an activator of the aryl hydrocarbon receptor. Cyprodinil also has anti-androgenic and androgenic activities. Cyprodinil can inhibit the biosynthesis of methionine in plant-pathogenic fungi and protect fruits and vegetables from a variety of pathogens[1][2][3].

  

• HY-116448

  Metaflumizone	139968-49-3
  Metaflumizone is a semicarbazone insecticide, acts as a potent sodium channel blocker[1].

  

• HY-116587

  Halocarban	369-77-7	99.82%
  Halocarban is a chemical with antibacterial properties sometimes used in deodorant and soap[1].

  

• HY-118494

  Ascaridole	512-85-6	98.65%
  Ascaridole is an anthelmintic and also has antimalarial activity[1].

  

• HY-119046

  SNX-0723	1073969-18-2	99.12%
  SNX-0723 is a potent Hsp90 Inhibitor with anti-Plasmodium activity. SNX-0723 shows high binding affinity for HsHsp90 and PfHsp90 with Kis of 4.4 and 47 nM, respectively. SNX-0723 inhibits liver-stage P. berghei ANKA parasites with the EC50 of 3.3 μM[1].

  

• HY-119098

  GSK983	827591-02-6
  GSK983 is a broad-spectrum antiviral agent. GSK983 inhibits the replication of adenovirus-5 (Ad-5) and polyoma virus SV40. GSK983 inhibits the growth of cell lines immortalized by EBV, HTLV1, HPV. GSK983 induces the expression of interferon-stimulated genes[1].

  

• HY-121310

  Phthalocyanine	574-93-6
  Phthalocyanine is a photosensitizer. Phthalocyanine has a light-killing effect on bacterial biofilms, effectively inactivating bacteria. Phthalocyanine can be linked to anticancer drugs to target cancer. Phthalocyanine can also be used to develop chemical sensors for studying microbial infections and tumors[1][2].

  

• HY-122394

  Thiolactomycin	82079-32-1
  Thiolactomycin is an antibiotic. Thiolactomycin is active against Gram-negative anaerobes. Thiolactomycin also inhibits malaria and trypanosomes. Thiolactomycin is a FabB inhibitor. Thiolactomycin inhibits the synthesis of fatty acids and mycolic acids[1][2].

  

• HY-124594

  CA inhibitor 1	2189684-45-3	99.77%
  CA inhibitor 1 (GS-6207 analog) is a potent HIV capsid inhibitor for HIV inhibition[1]. CA inhibitor 1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-124614

  GLP-26	2133017-36-2	98.36%
  GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools[1]. GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-124789

  TBT1	52535-76-9	99.55%
  TBT1 is a first-generation inhibitor of the MsbA transporter. TBT1 is an LPS transport inhibitor and MsbA ATPase stimulator in strains from the Acinetobacter genus. TBT1 stimulated ATPase activity with an EC50 of 13 µM[1].

  

• HY-128467

  Dehydroacetic acid sodium	4418-26-2	99.87%
  Dehydroacetic acid sodium, a pyrone derivative acts as an antibacterial and antifungal agent. Dehydroacetic acid possess phytotoxic activity[1].

  

• HY-130703

  5-Dehydroepisterol	23582-83-4
  5-Dehydroepisterol is an episterol derivative and an intermediate in steroid biosynthesis. 5-Dehydroepisterol can be formed by C-5 sterol desaturase and converted into 24-methylenecholesterol by 7-dehydrocholesterol reductase. 5-Dehydroepisterol has anti-fungal activities[1][2].

  

• HY-130839

  LolCDE-IN-1	1639933-78-0	99.79%
  LolCDE-IN-1 is an inhibitor of the Lol proteins (LolCDE) complex, with antibacterial activity[1].

  

• HY-131981

  TP0586532	2427584-96-9	99.86%
  TP0586532 is a non-hydroxamate LpxC inhibitor (IC50=0.101 μM). TP0586532 as a compound with a low cardiovascular risk that is effective against K. pneumoniae, including resistant strains[1]. TP0586532 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-13318S

  Oseltamivir acid-d3	1242184-43-5
  Oseltamivir acid-d3 is a deuterium labeled Oseltamivir acid. Oseltamivir acid, the active metabolite of Oseltamivir phosphate, is an orally bioavailable, potent and selective inhibitor of influenza virus neuraminidase (IC50=2 nM) with activity against both influenza A and B viruses[1][2].

  

• HY-133704

  Pyrrolnitrin	1018-71-9	99.76%
  Pyrrolnitrin is an antibiotic isolated from Pseudomonas pyrrocinia. Pyrrolnitrin shows a broad spectrum of antibiotic activity against fungi, yeast and gram-positive bacteria[1].

  

• HY-134910

  SID-852843	909859-19-4	99.91%
  SID-852843 is a WNV NS2B-NS3 proteinase inhibitor. SID-852843 can inhibit WNV NS2B-NS3 proteinase activity with IC50 value of 0.105 μM. SID-852843 can be used for the research of virus infection[1].

  

• HY-135072

  N,N',N''-Triacetylchitotriose	38864-21-0
  N,N',N''-Triacetylchitotriose is a competitive inhibitor of lysozyme[1].

  

• HY-135652

  Hexyl gallate	1087-26-9	99.75%
  Hexyl gallates (Hexyl 3,4,5-trihydroxybenzoate) shows antibacterial activity and inhibits the production of rhamnolipid and pyocyanin by inhibiting RhlR[1]. Hexyl gallate, a alkyl ester derivative of gallic acid, exhibits potent antimalarial activity against Plasmodium falciparum, with IC50 of 0.11 mM[2].

  

• HY-13735D

  d-Atabrine dihydrochloride	56100-41-5	99.64%
  d-Atabrine dihydrochloride is an active enantiomer of quinacrine which displays antiprion activity.

  

• HY-13756S

  Tacrolimus-13C,d2	1356841-89-8
  Tacrolimus-13C,d2 is a 13C-labeled and deuterium labeled Tacrolimus. Tacrolimus (FK506), a macrocyclic lactone, binds to FK506 binding protein (FKBP) to form a complex. Tacrolimus inhibits calcineurin phosphatase, which inhibits T-lymphocyte signal transduction and IL-2 transcription. Immunosuppressive properties[1].

  

• HY-138597

  5'-O-TBDMS-dT	40733-28-6
  5'-O-TBDMS-dT is a nucleoside with protective and modification effects.

  

• HY-139684

  MNK1/2-IN-5	1426928-20-2	99.93%
  MNK1/2-IN-5 is a potent and selective MNK1/2 inhibitor as a therapeutic agent.

  

• HY-142128

  Cymal-6	228579-27-9
  Cymal-6 (Cyclohexyl-hexyl-β-D-maltoside) is a potent TEM-1 beta-lactamase inhibitor with an Ki value of 40.05 µM. Cymal-6 (Cyclohexyl-hexyl-β-D-maltoside) can be used as glycosidic surfactant[1][2].

  

• HY-144644

  NS2B/NS3-IN-3	2832876-90-9	98.98%
  NS2B/NS3-IN-3 (Compd 66) is an inhibitor of Flavivirus NS2B-NS3 protease[1].

  

• HY-148505

  5'-ODMT cEt N-Bzm5 C Phosphoramidite (Amidite)	1197033-17-2
  5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite allows the formation of a specific conformation of the furanose ring of the oligonucleotide through the introduction of a cEt modification, enhancing the ability to hybridize to complementary RNA. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is mainly used in the research of regulation of gene expression related to metabolic diseases, cardiovascular diseases, cancers and the development of antisense compounds[1][2].

  

• HY-149535

  Iscartrelvir	2921711-74-0	99.84%
  Iscartrelvir (WU-04) is a non-covalent inhibitor of SARS-CoV-2, targeting the 3CLpro protein. Iscartrelvir has high inhibitory effect on the 3CLpro protein of 6 SARS-CoV-2 variants (Alpha, Beta, Gamma, Delta, Lambda and Omicron) and 2 coronaviruses (SARS-CoV and MERS-CoV)[1].

  

• HY-155635

  Nav1.8-IN-4	1620846-16-3	99.78%
  Nav1.8-IN-4 (compound 9a) is a Nav1.8 channel inhibitor (IC50=0.014 μM). Nav1.8-IN-4 can be used for research on pain-related diseases[1].

  

• HY-156597

  Arbemnifosbuvir	1998705-63-7	99.88%
  Arbemnifosbuvir is a nidovirus DdRp-associated nucleotidyltransferase (NiRAN) domain of non-structural protein 12 (nsp12)-interfering drugs. Arbemnifosbuvir can be used for SARS-CoVs infection research[1].

  

• HY-157403

  Jun12682		99.60%
  Jun12682 is an inhibitor of SARS-CoV-2 papain-like protease. Jun12682 inhibits PLpro with a Ki value of 37.7 nM. Jun12682 has EC50 value of 1.1 μM in the FlipGFP PLpro assay. Jun12682 has orally activity[1].

  

• HY-161834

  RG100204	2140901-88-6	99.50%
  RG100204 is a selective, orally available inhibitor of the aquaporin AQP9. RG100204 directly inhibits AQP9 channel function, preventing the transmembrane transport of water, glycerol, and H2O2. RG100204 reduces the activation of the NLRP3 inflammasome and p38 MAPK signaling pathways, thereby alleviating inflammation and pyroptosis. RG100204 reduces multi-organ dysfunction in a mouse sepsis model and shows glucose-regulating effects in diabetic db/db mice[1][2][3].

  

• HY-163901

  E6-272	945142-65-4	99.93%
  E6-272 is an inhibitor for human papillomavirus 16 (HPV 16). E6-272 inhibits the proliferation of HPV-positive cells SiHa and CaSki with GI50 of 32 nM and 62 nM. E6-272 induces apoptosis in cell SiHa and CaSki[1].

  

• HY-16779B

  Fosravuconazole L-lysine ethanolate	914361-45-8	99.86%
  Fosravuconazole L-lysine ethanolate (BMS-379224 L-lysine ethanolate), a proagent of Ravuconazole, is an orally active broad spectrum antifungal agent. Fosravuconazole L-lysine ethanolate can be used for candidiasis, onychomycosis and parasitemia research[1][2][3].

  

• HY-B0035S

  Sulfamethazine-d4	1020719-82-7	99.91%
  Sulfamethazine-d4 is a deuterium labeled Sulfamethazine (Sulfadimidine). Sulfamethazine is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections)[1][2].

  

• HY-B0101S

  Fluconazole-d4	1124197-58-5	99.66%
  Fluconazole-d4 is the deuterium labeled Fluconazole. Fluconazole (UK-49858) is a triazole antifungal agent with excellent activities against a broad range of fungi, especially against Candida albicans. Fluconazole inhibits C. albicans and Candida kefyr with IC99s range from 0.20 μg/mL to 0.39 μg/mL[1].

  

• HY-B0239S

  Chloramphenicol-d5	202480-68-0	99.90%
  Chloramphenicol-d5 is the deuterium labeled Chloramphenicol. Chloramphenicol is a broad-spectrum antibiotic against bacterial infections[1][2].

  

• HY-N0363A

  (+)-Columbianetin acetate	23180-65-6	99.83%
  (S)-Columbianetin acetate is an isomer of Columbianetin. Columbianetin is a phytoalexin associated with celery (Apium graveolens) resistance to pathogens during storage. Columbianetin exhibits excellent anti-fungal and anti-inflammatory activity[1][2].

  

• HY-N0677A

  Kalii Dehydrographolidi Succinas	76958-99-1	99.30%
  Kalii Dehydrographolidi Succinas (Potassium dehydroandrographolide succinate), extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect[1][2].

  

• HY-N0709S

  Coumarin-d4	185056-83-1
  Coumarin-d4 is the deuterium labeled Coumarin. Coumarin is the primary bioactive ingredient in Radix Glehniae, named Beishashen in China, which possesses many pharmacological activities, including anticancer, anti-inflammation and antivirus activities.

  

• HY-N10776

  Kaempferol-3-O-(6′′-galloyl)-β-glucopyranoside	56317-05-6	99.26%
  Kaempferol-3-O-(6′′-galloyl)-β-glucopyranoside is a glucopyranoside. Kaempferol-3-O-(6′′-galloyl)-β-glucopyranoside inhibts HIV-2 RNase H with an IC50 value of 5.19 μM[1].

  

• HY-P10152

  INF7	185462-59-3
  INF7 is a derivative of the N-terminal domain of the HA2 protein that can be used to enhance the endosomal escape of polyplexes or liposome-encapsulated proteins[1].

  

• HY-P1883A

  Bacterial Sortase Substrate III, Abz/DNP TFA		98.09%
  Bacterial Sortase Substrate III, Abz/DNP TFA is an internally quenched fluorescent peptide substrate. Staphylococcus aureus transpeptidase sortase A (SrtA) reacts with its native substrate Bacterial Sortase Substrate III, Abz/DNP, cleaving it and catalyzing the formation of an amide bond between the carboxyl group of threonine and the amino group of cell-wall crossbridges. Cleavage of this substrate can be monitored at Ex/Em=320 nm/420 nm.

  

• HY-P2310A

  Defensin HNP-1 human TFA		99.91%
  Defensin HNP-1 human TFA is a Human neutrophil peptides (HNPs), involved in endothelial cell dysfunction at the time of early atherosclerotic development. Defensin HNP-1 human TFA exhibits broad antimicrobial and anti-leishmanial activities[1][2].

  

• HY-P5723A

  Api137 TFA		98.96%
  Api137 TFA is an antimicrobial peptide that interferes with bacterial growth by inhibiting translation. Api137 TFA inhibits protein synthesis by trapping of release factors on the 70S ribosome following hydrolysis of the nascent polypeptide chain[1][2].

  

• HY-P7061A

  ALX 40-4C Trifluoroacetate
  ALX 40-4C Trifluoroacetate is a small peptide inhibitor of the chemokine receptor CXCR4, inhibits SDF-1 from binding CXCR4 with a Ki of 1 μM, and suppresses the replication of X4 strains of HIV-1; ALX 40-4C Trifluoroacetate also acts as an antagonist of the APJ receptor, with an IC50 of 2.9 μM.

  

• HY-P99620

  Firivumab	1443004-15-6
  Firivumab (CT-P22; CT120) is a human IgG1 monoclonal influenza A virus hemagglutinin (Anti-IAV HA) antibody. Firivumab is capable of neutralizing H1N1, H5N1, H6N1, H6N2, H8N4, H8N8, H9N2 and H12N7. Firivumab shows protection against H1N1 virus in mice[1][2][3].

  

• HY-P99649

  Gremubamab	1800381-36-5
  Gremubamab (MEDI3902) is a humanized IgG1 kappa anti-PcrV/Psl monoclonal antibody. Gremubamab binds to the PA PcrV protein and Psl exopolysaccharide. Gremubamab has the potential for the research of pseudomonas aeruginosa infections[1][2].

  

• HY-P99770

  Omodenbamab	2241724-48-9
  Omodenbamab is an anti-SpA (Staphylococcal protein A) human monoclonal antibody with a KD value of 0.0467 nM. Omodenbamab circumvents a key S. aureus evasion mechanism by targeting the cell wall moiety Protein A (SpA). Omodenbamab can be used in research of S. aureus bloodstream infection[1].

  

• HY-103639A

  M62812	613263-00-6	99.86%
  M62812 is a toll-like receptor 4 (TLR4) signaling inhibitor. M62812 inhibits endothelial and leukocyte activation and prevents lethal septic shock in mice. M62812 can reduces LPS-induced coagulation and inflammatory responses. M62812 can be used for the research of sepsis[1].

  

• HY-114489A

  Haemanthamine	466-75-1
  Haemanthamine is a crinine-type alkaloid isolated from the Amaryllidaceae plants with potent anticancer activity. Haemanthamine targets ribosomal that inhibits protein biosynthesis during the elongation stage of translation. Haemanthamine has pro-apoptotic, antioxidant, antiviral, antimalarial and anticonvulsant activities[1][2].

  

• HY-128554S

  N-Desethyl amodiaquine-d5	1173023-19-2
  N-Desethyl amodiaquine-d5 is the deuterium labeled N-Desethyl amodiaquine. N-Desethyl amodiaquine is the major biologically active metabolite of Amodiaquine. N-Desethyl amodiaquine is an antiparasitic agent. IC50 values for strains V1/S and 3D7 are 97 nM and 25 nM, respectively[1].

  

• HY-144644A

  NS2B/NS3-IN-3 hydrochloride	2832876-91-0	98.00%
  NS2B/NS3-IN-3 hydrochlorideis an inhibitor of Flavivirus NS2B-NS3 protease[1].

  

• HY-148560B

  cis-ccc_R08	2413192-48-8	99.61%
  cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor[1].

  

• HY-160791A

  Claramine TFA	3030428-57-7
  Claramine TFA is a steroidal polyamine. Claramine TFA can regulate the properties of lipid membranes and protect cells from various biological toxins, including misfolded protein oligomers and toxins derived from biological proteins[1].

  

• HY-N0610S1

  trans-Cinnamic acid-d7	343338-31-8	99.98%
  trans-Cinnamic acid-d7 is the deuterium labeled trans-Cinnamic acid[1]. trans-Cinnamic acid is a natural antimicrobial, with minimal inhibitory concentration (MIC) of 250 μg/mL against fish pathogen A. sobria, SY-AS1[2].

  

• HY-N2041S6

  Myristic acid-d5	327077-03-2
  Myristic acid-d5 is the deuterium labeled Myristic acid. Myristic acid is a saturated 14-carbon fatty acid occurring in most animal and vegetable fats, particularly butterfat and coconut, palm, and nutmeg oils.

  

• HY-P10580A

  Vasculotide TFA		99.72%
  Vasculotide TFA, an angiopoietin-1 mimetic, is a Tie-2 activator and induces Tie-2 phosphorylation. Vasculotide has anti-inflammatiory effect and anti-permeability. Vasculotide TFA ameliorates endotoxin-induced endothelial barrier dysfunction. Vasculotide TFA promotes angiogenesis in a mouse model of diabetic ulcer. Vasculotide TFA protects mice from vascular leakage and reduces mortality in murine abdominal sepsis. Vasculotide TFA decreases microvascular leakage and improves microcirculatory perfusion in a rat model of hemorrhagic shock[1][2][3].

  

• HY-W007524

  2-Aminoquinoline	580-22-3
  2-Aminoquinoline (2-Quinolinamine) is a promising compound as bioavailable nNOS inhibitor but suffers from low human nNOS inhibition, low selectivity versus human eNOS, and significant binding to other CNS targets. 2-Aminoquinoline exhibits antiviral activity against the vaccinia virus. 2-Aminoquinoline has the potential for the research of antineurodegenerative agents[1][2].

  

• HY-W008226

  Phloracetophenone	480-66-0
  Phloracetophenone (2,4,6-trihydroxyacetophenone) is the aglycone part of acetophenone glycoside obtained from Curcuma comosa Roxb, with cholesterol-lowering activity. Phloracetophenone enhances cholesterol 7α-hydroxylase (CYP7A1) activity[1]. Phloracetophenone stimulats bile secretion mediated through Mrp2[2].

  

• HY-W010435

  Sulcatone	110-93-0
  Sulcatone (6-Methyl-5-hepten-2-one) is a plant-derived volatile organic compound with activities such as insecticidal, antifungal, and blood pressure-lowering effects. Sulcatone also serves as an insect pheromone and an endogenous metabolite, which can be found in feces. Changes in Sulcatone levels can be used for the auxiliary diagnosis of ulcerative colitis[1][2][3][4].

  

• HY-W010611

  3,3-Dimethylacrylic acid	541-47-9
  3,3-Dimethylacrylic acid is an active small molecule, that can be used as drug intermediate[1].

  

• HY-W011522

  Taurolidine	19388-87-5	98.19%
  Taurolidine is a potent antimicrobial and anticancer agent. Taurolidine inhibits cell proliferation. Taurolidine induces apoptosis and autophagy. Taurolidine rescues mice from sepsis-associated lethality[1][2].

  

• HY-W012282

  3′-Deoxyuridine	7057-27-4
  3′-Deoxyuridine is a potential anticancer and antiviral agent. 3'-deoxyuridine inhibits bovine diarrhoea virus (BVDV) production[1].

  

• HY-W012595

  Benzylideneacetone	122-57-6
  Benzylideneacetone (Benzalacetone) is an orally active antibiotic, tyrosinase inhibitor, phospholipase A2 inhibitor, and immunosuppressant. Benzylideneacetone has antibacterial activity against some gram-negative plant-pathogenic bacteria. Benzylideneacetone can also be used in the synthesis of chemicals and drugs, and as a flavoring additive for some foods[1][2][3].

  

• HY-W013256

  Foscarnet trisodium hexahydrate	34156-56-4
  Foscarnet trisodium hexahydrate (Trisodium phosphonatoformate hexahydrate) is a viral DNA polymerase activity inhibitor, leading to reversible suppression of viral replication. Foscarnet trisodium hexahydrate is an antiherpesvirus agent used in cytomegalovirus retinitis[1][2][3].

  

• HY-W024485

  SARS-CoV-2-IN-86	368866-07-3
  SARS-CoV-2-IN-86 (Compound 2734589) is a dual inhibitor of the methyltransferases nsp14 and nsp16 of SARS-CoV-2. SARS-CoV-2-IN-86 exhibits low toxicity with a LD50 of 700 mg/kg according to toxicity analysis predict[1].

  

• HY-W103183

  Ferron	547-91-1	99.43%
  Ferron (8-Hydroxy-7-iodo-5-quinolinesulfonic acid) has antiseptic and antifungal activity. Ferron can prevent skin and mucosa bacterial irritations and inflammations[1].

  

• HY-W110662

  Transtorine	13593-94-7	99.91%
  Transtorine is a quinoline alkaloid, found from Ephedra transitoria, with antibacterial activity[1].

  

• HY-W115746

  Ethyl cellulose	9004-57-3
  Ethyl cellulose is a derivative of cellulose. Ethyl cellulose is a non-toxic, biodegradable polymer. Ethyl cellulose has unique properties such as oil gel formation, active ingredient delivery and film formation. Ethyl cellulose can be used as a pharmaceutical excipient, such as a coating agent, flavoring agent, tablet filler, etc. Ethyl cellulose can be used to prepare nanoparticles for active compound delivery[1][2][3][4].

  

• HY-W141916

  Pentaglycine	7093-67-6	99.59%
  Pentaglycine (Tetraglycylglycine) is a bridge containing five glycine molecules. Pentaglycine can form highly cross-linked peptidoglycan. Glucose reduced expression of pentaglycine. Pentaglycine is cleaved by lysostaphin, and occurs in the cell envelope of staphylococci[1].

  

• HY-Y0366S3

  Lauric acid-d3	79050-22-9
  Lauric acid-d33 is the deuterium labeled Lauric acid. Lauric acid is a middle chain-free fatty acid with strong bactericidal properties. The EC50s for P. acnes, S.aureus, S. epidermidis, are 2, 6, 4 μg/mL, respectively.

  

• HY-13672

  LY2334737	892128-60-8	98.88%
  LY2334737 is an nucleoside analog and is an orally active proagent of Gemcitabine. LY2334737 exhibits inhibitory activity against enterovirus A71 (EV-A71) infection. LY2334737 has antiviral and anticancer effects[1][2].

  

• HY-44178

  Diethyl butylmalonate	133-08-4	99.79%
  Diethyl butylmalonate exhibits toxicity to T. pyriformis, with a log(IGC50-1) of 0.557[1].

  

• HY-B0826

  Spirodiclofen	148477-71-8	99.93%
  Spirodiclofen is a broad spectrum acaricide acting via lipid biosynthesis inhibition (LBI) with no cross resistance to currently available acaricides and with additional insecticidal properties.

  

• HY-B1134

  Imazalil	35554-44-0	99.54%
  Imazalil (Enilconazole) is a fungicide. Imazalil has oral activity and strongly activates mPXR but not mCAR in mouse liver. Imazalil is commonly used to protect various agricultural crops against fungal attack. Imazalil induces developmental abnormalities, gut microbiota dysbiosis, and hepatic metabolism disorder[1][2][3].

  

• HY-B1158

  Imidazolidinyl urea	39236-46-9	99.90%
  Imidazolidinyl urea is a commonly used antibacterial preservative in cosmetics and pharmaceuticals that releases formaldehyde through decomposition. Imidazolidinyl urea can also be used in the preparation of multifunctional hydrogels for the care of infectious wounds. Imidazolidinyl urea has broad-spectrum antibacterial activity, which mainly inhibits the reproduction of gram-negative bacteria and gram-positive bacteria, and restricts the growth of yeast and mold to a certain extent. Imidazolidinyl urea can induce non-histaminergic allergy by MRGPRX2 activation of mast cells[1][2][3].

  

• HY-B1434

  7-Aminocephalosporanic acid	957-68-6
  7-aminocephalosporanic acid (7-ACA) is a HSP90β inhibitor and an antibiotic. 7-Aminocephalosporanic acid is the core chemical structure of the synthesis of cephalosporin antibiotics and an effective β-lactamase inhibitor[1][2].

  

• HY-N0902

  Dihydrosanguinarine	3606-45-9	99.98%
  Dihydrosanguinarine is a natural compound isolated from the leaves of Macleaya microcarpa; has antifungal and anticancer activity.

  

• HY-N3242

  Moronic acid	6713-27-5
  Moronic Acid is a triterpenoid compound, which is an orally available anti-HIV agent with anti-inflammatory activity. Moronic Acid can inhibit viral replication, with an EC50 value of <1 μg/mL. Moronic Acid can be isolated from Brazilian propolis[1][2][3].

  

• HY-Y0403

  3-Chlorobenzoic acid	535-80-8	99.71%
  3-Chlorobenzoic acid (m-Chlorobenzoic acid) is the only carbon source for the bacterium[1].

  

• HY-Y1049

  2-Amino-6-bromopyridine	19798-81-3
  2-Amino-6-bromopyridine (compound 7) is a PqsR ligand with a Kd values of 6.8 μM in the SPR assay. 2-Amino-6-bromopyridine shows a weak antagonistic activity[1].

  

• HY-131583

  MP265	544-47-8	99.50%
  MP265 (4-Chlorobenzyl carbamimidothioate hydrochloride) is a structural analogue of A22 but is less toxic. MP265 is a MreB inhibitor[1].

  

• HY-156009

  CDFI	1199797-92-6	99.83%
  CDFI is an inhibitor of the lipid II flippase MurJ. CDFI potentiates the activity of β-lactams against MRSA[1][2].

  

• HY-15971A

  AMD 3465	185991-24-6	99.59%
  AMD 3465 (GENZ-644494) is a potent antagonist of CXCR4, inhibits binding of 12G5 mAb and CXCL12AF647 to CXCR4, with IC50s of 0.75 nM and 18 nM in SupT1 cells; AMD 3465 also potently inhibits the replication of X4 HIV strains (IC50: 1-10 nM), but has no effect on CCR5-using (R5) viruses.

  

• HY-164220

  PPM1A-IN-1	2919466-30-9
  PPM1A-IN-1 (Compound IV-4) is an inhibitor for PP2C Ser/Thr phosphatase protein phosphatase Mg2+/Mn2+-dependent 1A. PPM1A-IN-1 exhibits antibacterial activity against Mycobacterium tuberculosis[1].

  

• HY-B0712A

  Ceftriaxone sodium hydrate	104376-79-6	99.25%
  Ceftriaxone sodium hydrate (Ro 13-9904 sodium hydrate) is a broad spectrum β-lactam third-generation cephalosporin antibiotic, which has good antibacterial activity against a variety of gram-negative and positive bacteria. Ceftriaxone sodium hydrate is a covalent inhibitor of GSK3β with IC50 value of 0.78 μM. Ceftriaxone sodium hydrate is an inhibitor of Aurora B. Ceftriaxone sodium hydrate has anti-inflammatory, antitumor and antioxidant activities. Ceftriaxone sodium hydrate can be used in the study of bacterial infections and meningitis[1][2][3][4][5][6][7].

  

• HY-B0905A

  Tilmicosin phosphate	137330-13-3
  Tilmicosin (LY-177370) phosphate is an orally active calcium channel antagonist and macrolide antibiotic with antimicrobial activity. Tilmicosin phosphate mainly acts on the 50S subunit of bacterial ribosomes, inhibiting protein synthesis. Tilmicosin phosphate is effective in the treatment of respiratory diseases in livestock such as cattle, sheep and pigs. In addition, Tilmicosin phosphate has immunomodulatory and anti-inflammatory effects[1][2][3][4][5][6].

  

• HY-W004461

  S-Methyl thiomethanesulfonate	2949-92-0
  S-Methyl thiomethanesulfonate (MMTS) is a sulfur-containing volatile organic compound produced by plants and bacteria and is an effective anti-oomycete agent[1].

  

• HY-W009722

  Sodium diethylcarbamodithioate trihydrate	20624-25-3
  Sodium diethylcarbamodithioate (Ditiocarb sodium) trihydrate is a copper reagent. The reaction with Cu2+ solution resulted in the formation of a complex, which increased the copper displacement precipitation rate. Sodium diethylcarbamodithioate trihydrate can reduce HIV infection and can be used in adjuvant immune research of high-risk breast cancer[1][2][3].

  

• HY-W016288

  Naphthalene-2,3-Dicarboxaldehyde	7149-49-7
  Naphthalene-2,3-Dicarboxaldehyde (2,3-Naphthalenedicarboxaldehyde), a phthaldehyde derivative, is a fungal ASADH inhibitor (Ki: 45 μM). Naphthalene-2,3-Dicarboxaldehyde inhibits the growth of C. albicans CAF2-1 with IC50 of 58.2 μM and MIC of 12 μg/mL[1].

  

• HY-W017767

  Polyaniline	25233-30-1
  Polyaniline can be used to make antibacterial agents[1].

  

• HY-W017982

  Kathon 886MW	55965-84-9
  Kathon 886MW is an efficient broad-spectrum biocide suitable for various metalworking fluids[1][2].

  

• HY-W068682

  1-Hydroxyphenazine	528-71-2	99.80%
  1-Hydroxyphenazine (Hemipyocyanine; 1-Phenazinol; Hemi-pyocyanin) is an inhibitor for α-Amylase with an IC50 of 3.1 μg/mL[1]. 1-Hydroxyphenazine exhibits anticancer and anti-inflammatory activity against cells A549, 1321N1 and RAW264.7, antifungal and antibacterial activity against strains Candida albicans, Aspergillus fumigatus, Escherichia coli and Xanthomonas campestris[2][3][4][5].

  

• HY-W251687

  2'-Deoxy-2'-fluoroarabinoadenosine	20227-41-2	99.92%
  2'-Deoxy-2'-fluoroarabinoadenosine is a nucleoside analogue, which exhibits anticancer activity against human immunodeficiency virus (HIV)[1].

  

• HY-W423191

  Maltobionic acid	534-42-9
  Maltobionic acid is a naturally-derived polyhydroxy bionic acid. Maltobionic acid shows iron chelating ability, antibacterial potential and cytoprotection[1].

  

• HY-B1210

  Pipemidic acid	51940-44-4
  Pipemidic acid , a derivative of Piromidic acid, is an antibacterial agent. Pipemidic acid inhibits DNA gyrase. Pipemidic acid is active against gram-negative bacteria including Pseudomonas aeruginosa as well as some gram-positive bacteria. Pipemidic acid can be used for the research of intestinal, urinary, and biliary tract infections[1][2].

  

• HY-14775

  Nesbuvir	691852-58-1	99.21%
  Nesbuvir is a nonnucleoside inhibitor of the hepatitis C virus (HCV) nonstructural protein 5B (NS5B) polymerase.

  

• HY-124191

  Ravidasvir hydrochloride	1303533-81-4	99.94%
  Ravidasvir hydrochloride (PPI-668 hydrochloride) is a pan-genotypic inhibitor for hepatitis C virus (HCV) NS5A protein. Ravidasvir hydrochloride inhibits the replication of HCV, with EC50 of 0.12, 0.01 and 1.14 nM, for HCV gt-1a, gt-1b, and gt-3a replicons, respectively. Ravidasvir hydrochloride exhibits good pharmacokinetic characters in rats[1].

  

• HY-16467

  Squalamine lactate	320725-47-1	98.27%
  Squalamine lactate is an aminosterol compound discovered in the tissues of the dogfish shark, with antimicrobial activity, and used for the treatment of neovascular age-related macular degeneration.

  

• HY-18748

  BQR-695	1513879-21-4	99.92%
  BQR-695 is a PI4KIIIβ inhibitor with IC50s of 80 and 3.5 nM for human PI4KIIIβ and Plasmodium variant of PI4KIIIβ, respectively.

  

• HY-D1444

  Propidium monoazide	91416-20-5
  Propidium monoazide is a photoreactive DNA-binding dye that preferentially binds to dsDNA. Propidium monoazide (PMA) prevents DNA from dead bacteria from being amplified during the PCR. PMA-PCR enhanced both the specificity and the sensitivity of PCR[1]. Propidium monoazide is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-148044

  UNC10201652	372495-52-8
  UNC10201652 is a potent Loop 1 (L1)-specific gut bacterial β-glucuronidase (GUSs) inhibitor with an IC50 value of 0.117 μM for E. coli GUS. UNC10201652 can block SN-38 glucuronide (HY-126373) processing only in individuals whose fecal gut microbiota is highly abundant in L1 GUS enzymes[1][2].

  

• HY-16134A

  Celgosivir hydrochloride	141117-12-6
  Celgosivir hydrochloride (MBI 3253 hydrochloride; MDL 28574 hydrochloride; MX3253 hydrochloride) is an α-glucosidase I inhibitor; inhibits bovine viral diarrhoea virus (BVDV) with an IC50 of 1.27 μM in in vitro assay.

  

• HY-16742A

  Gepotidacin (S enantiomer)	2319789-82-5	98.27%
  Gepotidacin S enantiomer is an S enantionmer of gepotidacin.

  

• HY-117684A

  Cabamiquine succinate	2444781-71-7	99.80%
  Cabamiquine (DDD107498) succinate is a potent and orally active antimalarial agent, inhibits multiple life-cycle stages of the parasite, with an EC50 of 1 nM against P. falciparum 3D7. Cabamiquine succinate inhibits protein synthesis by targeting eEF2/CaMKIII, with an EC50 of 2 nM for WT-PfeEF2[1].

  

• HY-P1698

  Reltecimod	1447799-33-8	99.88%
  Reltecimod (AB-103) is a T-cell-specific surface glycoprotein CD28 (TP44) antagonist. Reltecimod has beneficial effects against different bacterial infections, their exotoxins and endotoxins, and ionizing radiation. Reltecimod modulates the inflammatory response by targeting and attenuating the critical CD28/B7-2 co-stimulatory pathway, without inhibiting it. Reltecimod can be used to research necrotizing soft-tissue infections (NSTIs)[1][2].

  

• HY-132306

  CCF0058981	2708934-53-4	98.02%
  CCF0058981 (CCF981), 3-chlorophenyl analogue, is a noncovalent SARS-CoV-2 3CLpro (SC2) inhibitor with an IC50 of 68 nM. CCF0058981 inhibits SC1 (SARS-CoV-1 3CLpro) with an IC50 of 19 nM. CCF0058981 has antiviral efficacy and has the potential for COVID-19 research[1].

  

• HY-132987

  Avibactam tomilopil	2245880-46-8	99.66%
  Avibactam tomilopil (ARX-1796, AV-006) is an orally active prodrug of Avibactam and a β-lactamase inhibitor. Avibactam tomilopil can be used in the study of diseases such as urinary tract infections[1][2][3].

  

• HY-133894

  Bofutrelvir	2103278-86-8
  Bofutrelvir (FB2001) is a SARS-CoV-2 main protease Mpro inhibitor with an IC50 value of 53 nM and an EC50 value of 0.53 μM. Bofutrelvir exhibits potent antiviral efficacy against several current SARS-CoV-2 variants with EC50 values of 0.26-0.42 μM. Bofutrelvir has an additive antiviral effect when combined with Remdesivir (HY-104077)[1][2].

  

• HY-15407B

  Sacubitril sodium	149690-05-1	99.95%
  Sacubitril sodium is a potent and orally active NEP (neprilysin) inhibitor, with an IC50 of 5 nM. Sacubitril sodium enhances the tone of the natriuretic peptide (NP) system and exerts significant antihypertensive effects. Sacubitril sodium is a component of the heart failure medicine LCZ696. Sacubitril sodium can be used for the research of heart failure, hypertension and COVID-19[1][2][3].

  

• HY-B0330B

  Levofloxacin hydrochloride	177325-13-2
  Levofloxacin ((-)-Ofloxacin) hydrochloride is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin hydrochloride inhibits the DNA gyrase and topoisomerase IV. Levofloxacin hydrochloride can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin hydrochloride shows anti-orthopoxvirus activity[1][2][3][4][5].

  

• HY-P99347

  Etesevimab	2423948-94-9	98.76%
  Etesevimab (JS016) is a recombinant neutralizing human IgG1 anti-SARS-CoV-2 monoclonal antibody[1].

  

• HY-P99564

  Teropavimab	2417213-72-8	99.90%
  Teropavimab (3BNC117-LS) is an antibody. Teropavimab can be used for the research of HIV infection[1].

  

• HY-113904S

  (Rac)-Tenofovir-d6	1020719-94-1	99.82%
  (Rac)-Tenofovir-d6 is a labelled racemic Tenofovir. Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV)[1].

  

• HY-119123A

  Voxvoganan trihydrochloride		98.13%
  Voxvoganan (LTX-109) trihydrochloride, a topical antimicrobial, is highly effective against S. aureus with a MIC range of 2 to 4 μg/mL. Voxvoganan trihydrochloride can be used for the research of bacterial skin infections, fungal infections and nasal decolonisation of MRSA[1][2].

  

• HY-B0330S

  Levofloxacin-d8	1217716-71-6	99.59%
  Levofloxacin-d8 is the deuterium labeled Levofloxacin. Levofloxacin, a synthetic fluoroquinolone, is an antibacterial agent that inhibits the supercoiling activity of bacterial DNA gyrase, halting DNA replication.

  

• HY-N0337S

  Eugenol-d3	1335401-17-6	99.86%
  Eugenol-d3 is the deuterium labeled Eugenol. Eugenol is an essential oil found in cloves with antibacterial, anthelmintic and antioxidant activity. Eugenol is shown to inhibit lipid peroxidation.

  

• HY-10118

  Filibuvir	877130-28-4
  Filibuvir is an orally active, selective non-nucleoside inhibitor of the HCV nonstructural 5B protein (NS5B) RNA-dependent RNA polymerase (RdRp). Filibuvir binds noncovalently in the thumb II allosteric pocket of NS5B. Filibuvir inhibits genotype 1a and 1b replicons with EC50s of 59 nM for both isoforms, respectively[1]. Filibuvir preferentially inhibits elongative RNA synthesis and potently decreases viral RNA accumulation[2].

  

• HY-12538

  Graveoline	485-61-0	99.96%
  Graveoline (Rutamine) is an anti-cancer agent that can trigger apoptosis and autophagy in skin melanoma cells. Graveoline also exhibits antifungal activity[1].

  

• HY-12994

  VP-14637	235106-62-4
  MDT-637 (VP 14637) is a novel respiratory syncytial virus (RSV) fusion inhibitor with an IC50 of 1.42 ng/mL.

  

• HY-14134

  BMS-378806	357263-13-9	98.94%
  BMS-378806 is a potent HIV-1 attachment inhibitor that interferes with CD4-gp120 interactions. BMS-378806 selectively inhibits the binding of HIV-1 gp120 to the CD4 receptor with EC50 of 0.85-26.5 nM in virus.

  

• HY-14743

  Golotimod	229305-39-9	98.04%
  Golotimod (SCV-07), an immunomodulating peptide with antimicrobial activity, significantly increases the efficacy of antituberculosis therapy, stimulates thymic and splenic cell proliferation, and improves macrophage function. Golotimod (SCV-07) inhibits STAT3 signaling and modulates the duration and severity of oral mucositis in animal models that received radiation or a combination of radiation and Cisplatin. Golotimod (SCV-07) is also a potential therapeutic for recurrent genital herpes simplex virus type 2 (HSV-2)[1][2][3].

  

• HY-15297

  Vesnarinone	81840-15-5	98.58%
  Vesnarinone (OPC-8212) is an orally active phosphodiesterase 3 (PDE3) inhibitor. Vesnarinone can increase in calcium flux and decrease in potassium flux. Vesnarinone shows dose-dependent positive inotropic activity. Vesnarinone can be used in heart failure research[1][2][3][4].

  

• HY-16246

  Haloprogin	777-11-7	98.86%
  Haloprogin is a potent antifungal agent. Haloprogin has activity against dermatophytes, Candida spp and a limited number of Gram-positive bacteria[1].

  

• HY-18169

  MUT056399	1269055-85-7	99.87%
  MUT056399 (Fab-001) is a highly potent inhibitor of the FabI enzyme of both S. aureus and E. coli with 50% inhibitory concentration IC50s of 12 nM and 58 nM, respectively.

  

• HY-76228

  1H-pyrazole	288-13-1
  1H-pyrazole is a nitrogen-containing heterocyclic compound composed of a five-membered ring and two nitrogen atoms. 1H-pyrazole is an intermediate in organic synthesis. 1H-pyrazole coordinates with metal ions. 1H-pyrazole derivatives have antibacterial, anti-inflammatory, anti-malarial, and anti-leishmanial activities[1][2][3][4].

  

• HY-B0846

  Dimethomorph	110488-70-5	99.13%
  Dimethomorph is a fungicide belongs to the fungicide group of sterol biosynthesis inhibitor. Dimethomorph can inhibit fungal cell wall formation. Dimethomorph also inhibits androgen receptor (AR) activity in MDA-kb2 cells with an IC20 of 0.263 µM[1][2][3].

  

• HY-B0957

  Erythromycin Ethylsuccinate	1264-62-6
  Erythromycin Ethylsuccinate is an antibiotic useful for the treatment of a number of bacterial infections, has an antimicrobial spectrum similar to or slightly wider than that of penicillin. Erythromycin Ethylsuccinate has antiviral activity against HIV-1.

  

• HY-B1148

  Furaltadone hydrochloride	3759-92-0	99.31%
  Furaltadone hydrochloride is an orally active antibacterial agent that can be used for the study of intestinal Salmonella infections. Furaltadone has in vitro inhibitory effects on Staphylococcus. In addition, Furaltadone shows inhibitory effects on allergic reactions[1][2][3].

  

• HY-B1241

  Dihydrostreptomycin sulfate	5490-27-7
  Dihydrostreptomycin sulfate (DHSM sulfate) is the sulfate salt form of Dihydrostreptomycin (HY-B1241A). Dihydrostreptomycin sulfate is an aminoglycoside antibiotic with antibacterial effect against Gram-negative bacteria. Dihydrostreptomycin sulfate exhibits ototoxicity that causes irreversible damage in inner ear hair cells, leading to hearing loss[1].

  

• HY-B1386

  Halazone	80-13-7
  Halazone is an atypical antimicrobial sulfonamide derivative and a carbonic anhydrase II inhibitor with a Kd value of 1.45 µM. Halazone protects sodium channels from inactivation. Halazone is widely used for disinfection of drinking water[1][2].

  

• HY-B1597

  Cetalkonium chloride	122-18-9
  Cetalkonium chloride is an ammonium antiseptic agent used in many topical agents for infections of mouth, throat and eye. Cetalkonium chloride acts as anti-inflammatory amphiphilic agent. Cetalkonium chloride is a cationic surfactant, that improves the precorneal residence time and bioavailability of drugs. Cetalkonium chloride interacts with the negative charges on the bacterial cell membrane, disrupts the integrity of the cell membrane, causes leakage of cell contents and ultimately leading to bacterial death[1][2][3].

  

• HY-B1953

  Thiacloprid	111988-49-9
  Thiacloprid, a chloronicotinyl insecticide, is targeted chiefly to control aphid pest species in orchards and vegetables[1]. Thiacloprid destabilizes DNA. Thiacloprid changes the structure and stability of DNA through binding into the minor groove by hydrophobic or hydrogen interactions[2].

  

• HY-B2226

  Sodium copper chlorophyllin B	28302-36-5
  Sodium copper chlorophyllin B exerts antiviral activities against Influenza virus and HIV with IC50s of 50 to 100 μM for both of them.

  

• HY-D0976

  NF279	202983-32-2
  NF279 is a potent selective and reversible P2X1 receptor antagonist, with an IC50 of 19 nM. NF279 displays good selectivity over P2X2, P2X3 (IC50=1.62 μM), P2X4 (IC50>300 μM). NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env[1][2].

  

• HY-N0129

  Sclareolide	564-20-5
  Sclareolide is isolated from the flower of Perilla frutescens with antibacterial and cytotoxic activities[1].

  

• HY-N0465

  Olaquindox	23696-28-8	99.88%
  Olaquindox, a quinoxalin derivative, is an orally active antibiotic. Olaquindox stimulates growth and decreases intestinal mucosal immunity of piglets[1].

  

• HY-N0757

  8-​O-​Acetylharpagide	6926-14-3	99.75%
  8-O-Acetylharpagide is an iridoid isolated from Ajuga reptans with antitumoral, antiviral, antibacterial, and anti-inflammatory activities. 8-O-Acetylharpagide also has a biological activity on isolated smooth muscle preparations from guinea pig[1][2].

  

• HY-N0926

  Columbamine	3621-36-1
  Columbamine (Columbamin; Dehydroisocorypalmine) is an organic heterotetracyclic alkaloid extracted from plants. Columbamine is a metabolite of Berberine (HY-N0716). Columbamine inhibits the cytochrome P450 (CYP) isoform CYP3A4 (IC50 = 30.6 µM). Columbamine induces apoptosis in cancer cells. Columbamine can be used for antioxidant, anti-inflammatory, antitumor, antifungal, antiparasite, hepatoprotective, neuroprotective, hypolipidemic and hypoglycemic study[1][2][3][4][5].

  

• HY-N1401

  20(R)-Ginsenoside Rh2	112246-15-8
  20(R)-Ginsenoside Rh2, a matrix metalloproteinase (MMP) inhibitor, acts as a cell antiproliferator. It has anticancer effects via blocking cell proliferation and causing G1 phase arrest. 20(R)-Ginsenoside Rh2 induces apoptosis, and has anti-inflammatory and antioxidative activity[1][2][3]. 20(R)-Ginsenoside Rh2 inhibits the replication and proliferation of mouse and human gammaherpesvirus 68 (MHV-68) with an IC50 of 2.77 μM for murine MHV-68[4].

  

• HY-N1581

  Quassin	76-78-8
  Quassin (Nigakilactone D) is a bioactive triterpenoid from stem bark extract of Quassia amara. Quassin inhibits P. falciparum with an IC50 of 0.15 μM. Quassin possesses reversible antifertility, anti-estrogenic and anti-plasmodial activity[1][2].

  

• HY-N1976

  (+)-(3R,8S)-Falcarindiol	225110-25-8	98.53%
  (+)-(3R,8S)-Falcarindiol is a polyacetylene found in carrots, has antimycobacterial activity, with an IC50 of 6 μM and MIC of 24 μM against Mycobacterium tuberculosis H37Ra[1][2]. Antineoplastic and anti-inflammatory activity[2]. (+)-(3R,8S)-Falcarindiol is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-N2048

  2,2':5',2''-Terthiophene	1081-34-1
  2,2':5',2''-Terthiophene (α-Terthiophene) is an oligomer of the heterocycle thiophene. 2,2':5',2''-Terthiophene has been employed as building block for the organic semi-conductor polythiophene.

  

• HY-N2161

  Apiopaeonoside	100291-86-9	99.39%
  Apiopaeonoside is a natural product isolated from the root of Paeonia suffruticosa[1].

  

• HY-N2357

  Eudesmin	526-06-7	99.96%
  Eudesmin ((-)-Eudesmin) impairs adipogenic differentiation via inhibition of S6K1 signaling pathway. Eudesmin possesses diverse therapeutic effects, including anti-tumor, anti-inflammatory, and anti-bacterial activities[1].

  

• HY-N3139

  Ombuin	529-40-8	98.96%
  Ombuin, isolated from Zanthoxylum armatum, displays broad spectrum antibacterial effect with MIC ranges from 125 to 500 μg/mL[1].

  

• HY-N5009

  Thermopsine	486-90-8	99.43%
  Thermopsine is a quinolizidine alkaloid isolated from the fruits and pods and stem bark of Sophora velutina subsp. Thermopsine has antibacterial activity[1].

  

• HY-N6009

  8-Deoxygartanin	33390-41-9	99.24%
  8-Deoxygartanin, a prenylated xanthones from G. mangostana, is a selective inhibitor of butyrylcholinesterase (BChE)[1]. 8-Deoxygartanin exhibits antiplasmodial activity with an IC50 of 11.8 μM for the W2 strain of Plasmodium falciparum[2]. 8-Deoxygartanin inhibits NF-κB (p65) activation with an IC50 of 11.3 μM[3].

  

• HY-N6689

  Destruxin A	6686-70-0
  Destruxin A is a fungal cyclopeptide with insecticidal and antiviral activities. Destruxin A has a certain inhibitory effect on leukemia cells in vitro. Destruxin A can also specifically inhibit the innate immune response of Drosophila melanogaster, making the flies more susceptible to bacterial infections[1][2][3].

  

• HY-N6773

  Cytochalasin A	14110-64-6	99.61%
  Cytochalasin A is a cell-permeable fungal toxin that is an oxidized derivative of cytochalasin B. Cytochalasin A is an inhibitor of HIV-1 protease (IC50=3 μM) and inhibits actin polymerization and interferes with microtubule assembly by reacting with sulfhydryl groups. Antibiotic and fungicidal activitives[1][2].

  

• HY-N6781

  Ophiobolin A	4611-05-6	99.53%
  Ophiobolin A, a fungal metabolite and a phytotoxin, is a potent and irreversibly inhibitor of calmodulin-activated cyclic nucleotide phosphodiesterase, with an IC50 value of 9 μM. Ophiobolin A antimicrobial and anticancer activity[1].

  

• HY-N7093

  Furaneol	3658-77-3
  Furaneol is mainly isolated from American grape (Vitis labrusca) and its hybrid grape. Furaneol is an important aroma compound in fruits and contribute to the strawberry-like note in some wines[1].

  

• HY-N7121

  Erythromycin estolate	3521-62-8
  Erythromycin estolate is the Erythromycin (HY-B0220) derivative[1], is a macrolide antibiotic used in the treatment of a wide variety of bacterial infections. Erythromycin estolate causes several cases of liver injury which mostly include cholestatic hepatitis. Erythromycin estolate toxicity is related to its inhibitory effect on bile acid transport[2].

  

• HY-N7141

  Spiramycin I	24916-50-5
  Spiramycin I is a macrolide antibiotic and antiparasitic[1].

  

• HY-N8015

  Octanal	124-13-0	99.57%
  Octanal is a fragrant aldehyde with antioxidant and antibacterial activity. Its antifungal effect against G. citri-aurantii may be related to the disruption of cell membrane integrity and the leakage of cellular components. Additionally, Octanal exhibits cytotoxicity towards HeLa cells, with an IC50 value of 3.5 μg/mL[1][2].

  

• HY-P1116

  PBP10	794466-43-6	98.13%
  PBP10 is a cell permeable and selective gelsolin-derived peptide inhibitor of formyl peptide receptor 2 (FPR2) over FPR1[1]. PBP10 is a 10-AA peptide with rhodamine conjugated at its N terminus, exerts bactericidal activity against gram-positive and gram-negative bacteria and limits microbial-induced inflammatory effects[2].

  

• HY-P1350

  H-Lys-Trp-Lys-OH	38579-27-0	99.97%
  H-Lys-Trp-Lys-OH is a small molecule peptide which displays antibacterial and antiviral activities extracted from patent CN 104072579 A, Compound AMP12.

  

• HY-P3512

  Iseganan	257277-05-7
  Iseganan is an anti-microbial peptide that is active against both Gram-positive and Gram-negative bacteria and fungi. Iseganan kills a broad-spectrum of bacteria and fungi by attaching to and destroying the integrity of the lipid cell membranes. Iseganan can be used for oral mucositis research[1][2][3].

  

• HY-P4086

  Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R)	1678417-57-6	98.00%
  Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R), a chimeric peptide consisting of 29 amino acids, is synthesized by adding nona-arginine motif to the carboxy terminus of RVG (rabies virus glycoprotein). Chimeric Rabies Virus Glycoprotein Fragment (RVG-9R) is positively charged and able to bind negatively charged nucleic acids via charge interaction[1][2].

  

• HY-Y0032

  Thiosemicarbazide	79-19-6
  Thiosemicarbazide is a vitamin B6 antagonist with anti-acne activity. Thiosemicarbazide is also a well-known source in the synthesis of heterocycles, and its derivatives have potential anticancer activity. Thiosemicarbazide (TSC: HL1) reacts with metal salts, urea (U), to prepare Co(II) and Cu(I) metal complexes. Thiosemicarbazide is also used in the fields of media communications and optical storage, and in the spectrophotometric detection of metals[1][2][3][1][2][3].

  

• HY-Y0585

  D-(-)-Mandelic acid	611-71-2
  D-(-)-Mandelic acid is an orally active alpha hydroxycarboxylic acid that can be isolated from bitter almonds and Indian chestnut trees. It has antioxidant and antibacterial properties and is expected to play an important role in the treatment of rheumatoid arthritis[1][4].

  

• HY-100589

  Isepamicin sulfate	67814-76-0
  Isepamicin sulfate (Sch 21420 sulfate) is a broad spectrum aminoglycoside antibiotic. Isepamicin sulfate exhibits considerable antimicrobial activity against Gram-negative non-fermenters in a region with high antimicrobial resistance[1][2].

  

• HY-101011

  Naloxonazine dihydrochloride	880759-65-9
  Naloxonazine dihydrochloride is a specific μ-opioid receptor antagonist with an IC50 of 5.4 nM. Naloxonazine dihydrochloride also shows anti-leishmanial activity[1][2][3].

  

• HY-101397

  Allopurinol riboside	16220-07-8
  Allopurinol riboside, a metabolite of allopurinol, shows potent activities against parasites.

  

• HY-106302

  Duramycin	1391-36-2	99.46%
  Duramycin (Moli1901) is a lantibiotic derived from Streptomyces cinnamoneuma. Duramycin also is a antimicrobial peptide. Duramycin can be used for the research of cystic fibrosis (CF)[1][2].

  

• HY-106755

  Tucaresol	84290-27-7	98.95%
  Tucaresol is an orally bioavailable immunopotentiatory drug that show to enhance T-helper-cell activity, with the induction of increased IL-2 and IFN-γ levels in mice and humans. Tucaresol has anti-HIV effect[1].

  

• HY-107496

  Imidocarb dipropionate	55750-06-6	99.07%
  Imidocarb dipropionate is a potent antiprotozoal agent. Imidocarb dipropionate is active against the parasite B. bovis with an IC50 of 87 μg/mL[1].

  

• HY-107814

  Nicarbazin	330-95-0
  Nicarbazin is an effective anticoccidial agent for chickens[1].

  

• HY-107902

  RIG-1 modulator 1	1428729-63-8	99.54%
  RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.

  

• HY-108700

  N-3-Oxo-octanoyl-L-homoserine lactone	147795-39-9	98.05%
  N-3-Oxo-octanoyl-L-homoserine lactone, a quorum-sensing signal, is an Agrobacterium autoinducer[1][2].

  

• HY-108941

  Salicyl-AMS	863238-55-5
  Salicyl-AMS is a mycobactin biosynthesis inhibitor which can also inhibit M. tuberculosis growth in vitro under iron-limited conditions.

  

• HY-108970

  Bafilomycin D	98813-13-9	99.30%
  Bafilomycin D is a specific inhibitor of vacuolar-type ATPase (V-ATPase). Bafilomycin D has antimicrobial, insecticidal, herbicidal and cytotoxic activity[1].

  

• HY-109000

  Afabicin	1518800-35-5	98.02%
  Afabicin (Debio 1450) is the proagent of Debio1452, specifically targeting staphylococci without significant activity against other Gram-positive or Gram-negative species. Debio1452 is an inhibitor FabI, an enzyme critical to fatty acid biosynthesis in staphylococci.

  

• HY-109040

  Quilseconazole	1340593-70-5	98.98%
  Quilseconazole (VT-1129) is a potent, orally active fungal Cyp51 (lanosterol 14-α-demethylase) inhibitor, binds tightly to cryptococcal CYP51, but weakly inhibits humans CYP450 enzymes[1].

  

• HY-109195

  Vebicorvir	2090064-66-5	99.73%
  Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM[1].

  

• HY-110354

  UCM05	1094451-90-7	99.58%
  UCM05 (G28UCM) is a potent inhibitor of fatty acid synthase (FASN) shows activity against HER2+ breast cancer xenografts and is active in anti-HER2 drug-resistant cell lines. UCM05 is a Filamentous temperature-sensitive protein Z (FtsZ) inhibitor and inhibits the growth of the Gram-positive bacterium B. subtilis with MIC values of 100 μM but lack activity on the Gram-negative bacterium E. coli.

  

• HY-111086

  DG70	930470-97-6	99.91%
  DG70 (GSK1733953A), a biphenyl amide, is a respiration inhibitor in Mycobacterium tuberculosis, inhibits MenG activity with an IC50 value of 2.6 ± 0.6 μM. DG70 inhibits the catalytic methylation of Mycobacterium tuberculosis demethylmenaquinone methyltransferase enzymes. DG70 can be used for Tuberculosis (TB) research[1][2][3].

  

• HY-112542

  Nemadectin	102130-84-7	99.79%
  Nemadectin (CL-287088), an orally active broad-spectrum endectocide, is highly efficacious against natural infections of all the major canine gastrointestinal helminthes. Anthelmintic activity[1].

  

• HY-112832

  Lumigen APS-5	193884-53-6
  Lumigen APS-5 is a substrate of alkaline phosphatase (ALP). Lumigen APS-5 can be used to assess the activity of alkaline phosphatase (ALP)[1].

  

• HY-113041

  Prostaglandin A2	13345-50-1
  Prostaglandin A2 (PGA2), a human endogenous metabolite of PGE2, is an antitumor agent. Prostaglandin A2 induces p53-dependent apoptosis. Prostaglandin A2 also has antiviral activity[1][2][3].

  

• HY-116228

  Cadrofloxacin	153808-85-6	98.21%
  Cadrofloxacin (Caderofloxacin; CS-940), a orally active fluoroquinolone, is effective against aerobic/anaerobic Gram-positive and Gram-negative bacteria. Cadrofloxacin can be used for the research of infectious diseases[1][2][3].

  

• HY-117015

  Purfalcamine	1038620-68-6	99.44%
  Purfalcamine is an orally active, selective Plasmodium falciparum calcium-dependent protein kinase 1 (PfCDPK1) inhibitor with an IC50 of 17 nM and an EC50 of 230 nM. Purfalcamine has antimalarial activity and causes malaria parasites developmental arrest at the schizont stage[1][2].

  

• HY-117430

  Hymeglusin	29066-42-0
  Hymeglusin, as a fungal β-lactone antibiotic, is a HMG-CoA synthase inhibitor (IC50 = 0.12 μM). Hymeglusin covalently modifies the active Cys129 residue of the enzyme[2][3].

  

• HY-117685

  Cefovecin sodium	141195-77-9	99.79%
  Cefovecin sodium is a cephalosporin. Cefovecin sodium interferes with bacterial cell wall synthesis. Cefovecin sodium shows antimicrobial activator[1].

  

• HY-118607

  VU041	332943-64-3	99.31%
  VU041 is a first submicromolar-affinity inhibitor of Anopheles (An.) gambiae and Aedes (Ae.) aegypti inward rectifier potassium 1 (Kir1) channels with IC50 values of 2.5 μM and 1.7 μM, respectively. VU041 inhibits appreciably is mammalian Kir2.1 (IC50 of 12.7 μM), and has less inhibitory effect on mammalian Kir1.1, Kir4.1, Kir6.2/SUR1, and Kir7.1. VU041 also induces impaired Malpighian tubule function[1].

  

• HY-118946

  BPH-1358	5352-53-4	99.12%
  BPH-1358 (NSC50460) is a potent human farnesyl diphosphate synthase (FPPS) and undecaprenyl diphosphate synthase (UPPS) inhibitor with IC50s of 1.8 μM and 110 nM, respectively, and is active against S. aureus in vitro (MIC ~250 ng/mL)[1][2].

  

• HY-121060

  Gloxazone	2507-91-7	99.66%
  Gloxazone is an effective anaplasmacide[1].

  

• HY-121144

  Cefazedone	56187-47-4	99.89%
  Cefazedone (Refosporen) is a first-generation cephalosporin antibiotic. Cefazedone is active against both Gram-positive and Gram-negative bacteria[1][2].

  

• HY-121206

  (-)-Isopulegol	89-79-2	99.83%
  (-)-Isopulegol is prepared directly from the treatment of essential oil of citronella under solid supported acid catalysis and solvent-free microwave assisted ene-cyclisation. (-)-Isopulegol shows high activity in reacting with carbonyl compounds. (-)-Isopulegol can be used for antiviral activity research[1].

  

• HY-123037

  Triadimefon	43121-43-3	98.12%
  Triadimefon is a triazole fungicide used to control powdery mildew, rusts, and other fungal pests on grains, fruit and vegetable crops, turf, shrubs, and trees. Triadimefon inhibits lanosterol 14α-demethylase, interfering with oxidative demethylation reactions in the ergosterol biosynthesis pathway of fungi, and also blocks gibberellin biosynthesis.

  

• HY-123081

  Eburicol	6890-88-6
  Eburicol is a natural sterol with antiproliferative and antimicrobial activities. Eburicol has a weak antimicrobial activity against S. aureus. Eburicol shows cytotoxic effect against MCF-7 and MDA-MB-231 cell lines[1].

  

• HY-124564

  Methisazone	1910-68-5	98.26%
  Methisazone (Marboran) is an antiviral agent that works by inhibiting mRNA and protein synthesis. Methisazone is also a SARS-CoV-2 (COVID-19) inhibitor. Methisazone is mainly used in pox viruses[1].

  

• HY-124645

  QL-X-138	1469988-63-3	99.77%
  QL-X-138 is a potent and selective BTK/MNK dual kinase inhibitor, exhibits covalent binding to BTK and non-covalent binding to MNK. QL-X-138 shows IC50s of 9.4 nM, 107.4 nM and 26 nM for BTK, MNK1 and MNK2 kinases respectively. QL-X-138 also shows anti-dengue virus 2 activity, with an IC50 of 3.5 μM. QL-X-138 can be used for the research of B-cell malignancies[1][2].

  

• HY-125650

  Pseudouridimycin	1566586-52-4
  Pseudouridimycin (PUM) is an antibiotic that selectively inhibits bacterial RNA polymerase (RNAP), with an IC50 of about 0.1 μM and MICs of 4-6 μg/mL. Pseudouridimycin is a C-nucleoside analogue that's effective against both Gram-negative and Gram-positive bacteria. Pseudouridimycin inhibits bacterial growth in vitro and shows activity in a mouse model of purulent streptococcal peritonitis[1][2].

  

• HY-125776

  Kresoxim-methyl	143390-89-0
  Kresoxim-methyl (BAS 490 F), a Strobilurin-based fungicide, inhibits the respiration at the complex III (cytochrome bc1 complex). Kresoxim-methyl binds to complex III from yeast with an apparent Kd of 0.07 μM proving a high affinity for this enzyme[1][2].

  

• HY-126396

  Sordarin sodium	463356-00-5
  Sordarin sodium is an eEF2 inhibitor and antibiotic. Sordarin sodium's function is dependent on the diphthamide modification on eEF2. Sordarin sodium inhibits protein synthesis by preventing the binding of eEF2 to the ribosome complex. Sordarin sodium has antifungal activity[1][2].

  

• HY-126421

  Kansuinine A	57701-86-7	99.81%
  Kansuinine A inhibits IL-6-induced Stat3 activation. Kansuinine A possesses antiviral and anticancer activity[1][2].

  

• HY-129943

  Benzothiohydrazide	20605-40-7	99.59%
  Benzothiohydrazide is an analogue of anti–tubercular agent Isoniazid. Benzothiohydrazide exhibits anti–tubercular activity, with MICs of 132 μM and 264 μM for M. tuberculosis wild type (H37Rv) and clinical mutant strains (IC1 and IC2)[1].

  

• HY-130000

  Pirmitegravir	2245231-10-9	99.76%
  Pirmitegravir is a potent and first-in-class inhibitor of allosteric integrase (ALLINI) that targets LEDGF/p75 binding site. Pirmitegravir displays picomolar IC50 in human PBMCs with a >24,000 therapeutic index against HIV-1. Pirmitegravir harbors outstanding anti-virus and safety properties[1].

  

• HY-130173

  Bafilomycin C1	88979-61-7
  Bafilomycin C1 is a macrolide antibiotic isolated from Streptomyces sp. Bafilomycin C1 is a potent, specific and reversible inhibitor of vacuolar-type H+-ATPases (V-ATPases). Bafilomycin C1 inhibits growth of gram-positive bacteria and fungi[2]. Bafilomycin C1 induces cell apoptosis and can be used for the study of hepatocellular carcinoma (HCC)[2].

  

• HY-130836

  LpxH-IN-AZ1	901260-40-0	99.10%
  LpxH-IN-AZ1, a sulfonyl piperazine compound, is a potent UDP-2,3-diacylglucosamine pyrophosphate hydrolase LpxH inhibitor. LpxH-IN-AZ1 is a potent inhibitor of Klebsiella pneumoniae LpxH with IC50 of 0.36 μM [1].

  

• HY-134665

  NITD-2	1197896-79-9	99.36%
  NITD-2, a dengue virus (DENV) polymerase inhibitor, inhibits the DENV RdRp-mediated RNA elongation. NITD-2 penetrates cell membrane poorly[1].

  

• HY-135282

  DHODH-IN-1	1800296-63-2	98.65%
  DHODH-IN-1 (compound 18d) is a potent Dihydroorotate Dehydrogenase (DHODH) inhibitor with an IC50 of 25 nM. DHODH-IN-1 is an inhibitor of pyrimidine biosynthesis pathway[1].

  

• HY-136450

  Triclabendazole sulfoxide	100648-13-3	98.78%
  Triclabendazole sulfoxide (TCBZ-SO) is the main plasma metabolite of Triclabendazole, and exhibits anti-parasite effects. Triclabendazole sulfoxide can inhibit membrane transporter ABCG2/BCRP[1][2].

  

• HY-137954

  GRL-0496	1087243-14-8	99.20%
  GRL-0496 is a potent chloropyridyl ester-derived SARS-CoV 3CLpro inhibitor, with an IC50 of 30 nM in both enzyme inhibitory and antiviral assays. GRL-0496 shows SARS-CoV antiviral activity, with an EC50 of 6.9 μM[1].

  

• HY-138610

  5'-O-DMT-Bz-rC	81246-76-6	99.69%
  5'-O-DMT-Bz-Rc is a modified nucleoside and can be used to synthesize DNA or RNA.

  

• HY-13910A

  Tenofovir hydrate	206184-49-8
  Tenofovir hydrate is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.

  

• HY-139431

  NAG-thiazoline	179030-22-9
  NAG-thiazoline is a O-GlcNAcase inhibitor with a Ki of 180 nM. NAG-thiazoline is a potent GH20 GlcNAcase (VhGlcNAcase) inhibitor with an IC50 of 11.9 μM and a Ki of 62 µM[1].

  

• HY-139628

  JPD447	2883235-86-5	99.80%
  JPD447, a MAC-0547630 derivative, is a novel class of UppS inhibitor to potentiate β-lactam antibiotics.

  

• HY-141622

  SDZ 224-015	161511-45-1
  SDZ 224-015 is an orally active inhibitor of the interleukin-1 beta (IL-1β) converting enzyme and caspase-1. SDZ 224-015 possesses anti-COVID-19 activity, targeting Mpro (IC50 of 30 nM)[1][2].

  

• HY-141715

  BRD-8000.3	2365504-95-4
  BRD-8000.3, as a specific EfpA inhibitor, is a narrow-spectrum, bactericidal antimycobacterial agent with good wild-type activity. BRD-8000.3 can be used for the research of tuberculosis[1].

  

• HY-148706

  STAT3-IN-17	1245814-52-1
  STAT3-IN-17 is a moderate STAT3 inhibitor (IC50=0.7 μM; HEK-Blue IL-6), with antiproliferative activity in HeLa cells. STAT3-IN-17 has good pharmacokinetic characteristics. STAT3-IN-17 also inhibits pyruvate-ferredoxin oxidoreductase (PFOR), and inhibits Helicobacter pylori[1][2].

  

• HY-149606

  TKB245	2892688-16-1	98.98%
  TKB245 is a highly potent SARS-CoV-2 Mpro inhibitor that effectively blocks SARS-CoV-2 replication in VeroE6 cells[1].

  

• HY-150514

  ARN1468	1381459-14-8	99.34%
  ARN1468 (compound 5) is an orally active and potent serpins inhibitor. ARN1468 can inhibit serpins activity would set the protease free to further reduce prion accumulation. ARN1468 shows anti-prion effect in ScGT1 RML, ScGT1 22L, ScN2a RML, and ScN2a 22L cell lines, with EC50 values of 8.64, 19.3, 11.2, and 6.27 μM[1].

  

• HY-151167

  LasR-IN-4	183488-96-2	99.52%
  LasR-IN-4 is a potent LasR inhibitor. LasR-IN-4 can inhibit Pseudomonas aeruginosa and its biofilm formation, pyocyanin production, and rhamnolipids production[1].

  

• HY-158730

  N-3-Hydroxybutyryl-L-homoserine lactone	1325550-06-8
  N-3-Hydroxybutyryl-L-homoserine lactone (3-OH-C4-HSL) is an acyl-homoserine lactone, that can be isolated from Vibrionaceae. N-3-Hydroxybutyryl-L-homoserine lactone is a signaling molecule that is involved in bacterial quorum sensing (QS). N-3-Hydroxybutyryl-L-homoserine lactone senses the density of bacterial population, regulates the cellular process, such as bioluminescence, biofilm formation, and exo-enzyme production[1].

  

• HY-163462

  Poacic acid	160097-32-5
  Poacic Acid is a plant-derived stilbenoid with an antifungal activity. Poacic Acid localizes to the yeast cell wall and disrupts the production and assembly of β-1,3-glucan in the fungal cell walls. Poacic Acid exhibits fungicidal activity to Saccharomyces cerevisiae and plasma membrane-compromised Candida albicans mutants[1].

  

• HY-17503R

  Metoprolol (Standard)	51384-51-1
  Metoprolol (Standard) is the analytical standard of Metoprolol. This product is intended for research and analytical applications. Metoprolol is an orally active, selective β1-adrenoceptor antagonist. Metoprolol shows anti-inflammation, antitumor and anti-angiogenic properties[1][2][3].

  

• HY-A0147A

  Grepafloxacin hydrochloride	161967-81-3	99.23%
  Grepafloxacin (OPC-17116) hydrochloride is an oral actively fluoroquinolone antibiotic with potent activity against community-acquired respiratory pathogens including Streptococcus pneumonia. Grepafloxacin hydrochloride has high tissue penetration and a promising pharmacodynamic profile[1][2][3][4].

  

• HY-B0337A

  Sulfadimethoxine sodium	1037-50-9	99.76%
  Sulfadimethoxine sodium (Sulphadimethoxine sodium) is a sulfonamide antibiotic. Sulfadimethoxine sodium causes a displacement of Thiopental in plasma protein binding in rats. Sulfadimethoxine sodium is used in a variety of infection studies including urinary tract infections[1][2][3][4].

  

• HY-B0479S

  Thiamphenicol-d3	2211914-19-9
  Thiamphenicol-d3 is a deuterium labeled Thiamphenicol. Thiamphenicol, a methyl-sulfonyl derivative of Chloramphenicol, is a broad-spectrum antimicrobial antibiotic. Thiamphenicol acts by binding to the 50S ribosomal subunit, leading to inhibition of protein synthesis and bacteriostatic effect (against Gram-negative, Gram-positive aerobic and anaerobic bacteria)[1][2].

  

• HY-B1128A

  Cefamandole sodium	30034-03-8
  Cefamandole Sodium Salt is a second-generation broad-spectrum cephalosporin antibiotic.

  

• HY-B1144A

  Chlormidazole hydrochloride	74298-63-8	98.98%
  Chlormidazole hydrochloride is an antifungal agent and has inhibitory activity against many fungi and some gram-positive cocci. Chlormidazole hydrochloride can be applied in fungal and bacterial infections of nails and skin, including interdigital and periungual mycoses[1].

  

• HY-B1190A

  Cefadroxil hydrate	66592-87-8
  Cefadroxil hydrate (BL-S 578 hydrate) is an orally active and first-generation cephalosporin with a broad spectrum antibacterial activity. Cefadroxil hydrate (BL-S 578 hydrate) also acts as a substrate of the peptide transporter PEPT1 and PEPT2[1][2].

  

• HY-B2144I

  Chitosan (≥90% deacetylated,viscosity 10 mPa.s)	9012-76-4
  Chitosan (Deacetylated chitin) (≥90% deacetylated,viscosity 10 mPa.s) is a polysaccharide obtained by deacetylating chitin, and exhibits antimicrobial activity against various bacteria and fungi. Chitosan (≥90% deacetylated,viscosity 10 mPa.s) can be used as a versatile biomaterial in drug delivery, tissue engineering, and wound healing[1][2][3].

  

• HY-E70079

  Cystathionine β-lyase, Recombinant Microorganisms	9055-05-4
  Cystathionine β-lyase, Recombinant Microorganisms (CBL) is an enzyme that catalyzes the breakdown of cystathionine to homocysteine, the penultimate step in methionine biosynthesis. Cystathionine β-lyase is important for bacterial virulence[1].

  

• HY-N0492A

  α-Lipoic Acid sodium	2319-84-8	99.92%
  α-Lipoic Acid (Thioctic acid) sodium is an antioxidant, which is an essential cofactor of mitochondrial enzyme complexes. α-Lipoic Acid sodium inhibits NF-κB-dependent HIV-1 LTR activation[1][2][3]. α-Lipoic Acid sodium induces endoplasmic reticulum (ER) stress-mediated apoptosis in hepatoma cells[4]. α-Lipoic Acid sodium can be used with CPUL1 (HY-151802) to construct the self-assembled nanoaggregate CPUL1-LA NA, which has improved antitumor efficacy than CPUL1[5].

  

• HY-N0717A

  D-Valine	640-68-6
  D-Valine is the enantiomer of L-Valine (HY-N0717). L-Valine is one of 20 proteinogenic amino acids. L-Valine is an essential amino acid.

  

• HY-N0930B

  Galegine hydrochloride	2368870-39-5
  Galegine hydrochloride, a guanidine derivative, contributes to weight loss in mice. Guanidine hydrochloride is the compound derived from G. officinalis, which gave rise to the biguanides, metformin and phenformin. Galegine hydrochloride activates AMPK in 3T3-L1 adipocytes and L6 myotubes, as well as in the H4IIE rat hepatoma and HEK293 human kidney cell lines. Galegine hydrochloride has antibacterial activity, with minimum inhibitory concentration of 4 mg/L against Staphylococcus aureus strains[1][2].

  

• HY-N10420

  Hinokinin	26543-89-5	99.38%
  Hinokinin (Compound 1) is a compound isolated from the stems of Hypoestes aristate. Hinokinin exhibits moderate activity of HIV-1 protease enzyme[1].

  

• HY-N10521

  6'-Sialyllactose	35890-39-2	99.51%
  6'-Sialyllactose promotes the growth of beneficial bacteria (such as Bifidobacterium and lactobacillus) and inhibits the proliferation of harmful bacteria. 6'-Sialyllactose exhibits anti-inflammatory and anti-angiogenic activities. 6'-Sialyllactose promotes the muscle health[1][2][3][4].

  

• HY-P10257

  KR-12 (human)	1218951-51-9	99.91%
  KR-12 human is an active segment of LL-37, which exhibits antimicrobial activity against gram-negative bacteria. KR-12 human inhibits E. coli K-12 with MIC of 66 μM[1].

  

• HY-P1801A

  Cys-TAT(47-57) TFA		98.04%
  Cys-TAT(47-57) (Cys-[HIV-Tat (47-57)]) is an arginine rich cell penetrating peptide derived from the HIV-1 transactivating protein.

  

• HY-P2260C

  Tat-beclin 1 scrambled TFA		98.54%
  Tat-beclin 1 scrambled TFA is the scrambled part and a scrambled control of Tat-beclin 1 (HY-P2260), which is derived from a region of the autophagy protein, beclin 1. beclin 1 induces autophagy via binding human immunodeficiency virus, HIV-1 Nef and interacting with negative regulator GAPR-1 (GLIPR2). Tat-beclin 1 decreases the accumulation of polyglutamine expansion protein aggregates and the replication of several pathogens, such as HIV-1. Tat-beclin 1 also reduces mortality in mice infected with chikungunya or West Nile virus[1].

  

• HY-U00058

  Diflucortolone valerate	59198-70-8
  Diflucortolone valerate is a powerful corticosteroid used topically for the research of various skin diseases[1].

  

• HY-100711A

  Prodigiosin hydrochloride	56144-17-3	98.00%
  Prodigiosin (Prodigiosine) hydrochloride is a red pigment produced by bacteria as a bioactive secondary metabolite. Prodigiosin hydrochloride is a potent proapoptotic agent, and inhibits Wnt/β-catenin pathway. Prodigiosin hydrochloride has antibacterial, antifungal, antiprotozoal, antimalarial, immunosuppressive, and anticancer properties[1][2].

  

• HY-105967A

  Dicresulene diammonium		99.48%
  Dicresulene diammonium is an impurity of Policresulen, an organic acid with hemostatic, antimicrobial and antiviral activities[1][2].

  

• HY-107613A

  R 59-022 hydrochloride	93076-98-3	98.88%
  R 59-022 (DKGI-I) hydrochloride is a DGK inhibitor (IC50: 2.8 µM). R 59-022 hydrochloride inhibits the phosphorylation of OAG to OAPA. R 59-022 hydrochloride is a 5-HT Receptor antagonist, and activates protein kinase C (PKC). R 59-022 hydrochloride potentiates thrombin-induced diacylglycerol production in platelets and inhibits phosphatidic acid production in neutrophils[1][2][3][4].

  

• HY-108062A

  BLI-489 hydrate	2580120-08-5
  BLI-489 hydrate, a penem β-lactamase inhibitor, is active against class A and class C as well as some class D β-lactamases. The combination of Piperacillin and BLI-489 hydrate is efficacious against murine infections caused by class A (including extended-spectrum β-lactamases), class C (AmpC), and class D β-lactamase-expressing pathogens[1][2].

  

• HY-113478S

  Ursodeoxycholic acid-2,2,4,4-d4	347841-46-7
  Ursodeoxycholic acid-2,2,4,4-d4 is the deuterium labeled Ursodeoxycholic acid (HY-13771). Ursodeoxycholic acid is a secondary bile acid issued from the transformation of (cheno)deoxycholic acid by intestinal bacteria, acting as a key regulator of the intestinal barrier integrity and essential for lipid metabolism. Ursodeoxycholic acid acts as signaling molecule, exerting its effects by interacting with bile acid activated receptors, including G-protein coupled bile acid receptor 5 (TGR5, GPCR19) and the farnesoid X receptor (FXR). Ursodeoxycholic acid can be used for the research of a variety of hepatic and gastrointestinal diseases. Ursodeoxycholic acid also reduces ACE2 expression and is beneficial for reducing SARS-CoV-2 infection[1][2][3][4][5].

  

• HY-119759A

  Lipoxamycin hemisulfate	11075-87-9	99.96%
  Lipoxamycin hemisulfate is an antifungal antibiotic and a potent serine palmitoyltransferase inhibitor with an IC50 of 21 nM[1][2].

  

• HY-128036B

  ddATP trisodium	72029-21-1
  ddATP (2',3'-Dideoxyadenosine 5'-triphosphate) trisodium, an active metabolite of 2',3'-dideoxyinosine, is a chain-elongating inhibitor of DNA polymerase. ddATP trisodium can be used for Sanger method for DNA sequencing and research of virus infection[1][2][4].

  

• HY-131069A

  MBX2329	1438272-42-4	99.90%
  MBX2329, a potent influenza virus inhibitor, specifically inhibits hemagglutinin (HA)-mediated viral entry with HIV/HA(H5) displaying IC90 of 8.6 μM. MBX2329 inhibits a wide spectrum of influenza A viruses, which includes the 2009 pandemic influenza virus A/H1N1/2009, highly pathogenic avian influenza (HPAI) virus A/H5N1, and oseltamivir-resistant A/H1N1 strains[1].

  

• HY-132598A

  Miravirsen sodium		99.44%
  Miravirsen sodium is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen sodium is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen sodium inhibits HCV replication, and can be used in research of HCV infection[1][2].

  

• HY-135416A

  Streptolysin O (≥1000000 units/mg)	98072-47-0
  Streptolysin O (≥1000000 units/mg) is a ≥1000000 units/mg Streptolysin O (HY-135416). Streptolysin O, a group A streptococcal toxin, is a well-characterized oxygen-labile prototype of a cholesterol-binding bacterial exotoxin. Streptolysin O causes both lysis of cells and cardiotoxicity. Streptolysin O is widely used for the controlled permeabilization of cell membranes. Streptolysin O exists in two forms, a reduced active state and an oxidized reversibly inactive state[1][2][3][4].

  

• HY-14881AR

  Bedaquiline (fumarate) (Standard)	845533-86-0
  Bedaquiline (fumarate) (Standard) is the analytical standard of Bedaquiline (fumarate). This product is intended for research and analytical applications. Bedaquiline fumarate, a diarylquinoline antibiotic that targets ATP synthase, is effective for the treatment of Mycobacterium tuberculosis infections.

  

• HY-17373S1

  Posaconazole-d4	1133712-26-1
  Posaconazole-d4 is a deuterium-labeled form of Posaconazole. Posaconazole is a broad-spectrum, second generation, triazole compound with antifungal activity[1].

  

• HY-N0097S3

  Guanosine-15N5		99.60%
  Guanosine-15N5 is the 15N labeled Guanosine[1]. Guanosine (DL-Guanosine) is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine possesses anti-HSV activity[2].

  

• HY-U00124B

  Tromantadine hydrochloride	41544-24-5
  Tromantadine hydrochloride, an Amantadine derivative with antiherpetic activity, inhibits herpes simplex virus type 1 (HSV-1) and HSV-2 replication[1].

  

• HY-W003561

  DHFR-IN-3	137553-43-6	99.48%
  DHFR-IN-3 is a dihydrofolate reductase (DHFR) inhibitor with the IC50 values of 19 μM and 12 μM in rat liver and P. carinii DHFR, respectively[1].

  

• HY-W005186

  6-Bromocoumarin	19063-55-9
  6-Bromocoumarin (compound 34) is a potential anti-bacterial agent, with no inhibition against 17β-HSD1. 6-Bromocoumarin exhibtis affinity for α and β estrogen receptors[1][2].

  

• HY-W008216

  HMMNI	936-05-0	99.91%
  HMMNI (Hydroxy dimetridazole) is a hydroxy metabolite of Dimetridazole (HY-B1244). Dimetridazole is a nitroimidazole class drug that combats protozoan infections[1][2].

  

• HY-W008833

  3-Aminobutanoic acid	541-48-0
  3-Aminobutanoic acid is a β-amino acid. 3-Aminobutanoic acid can protect plant against a challenge infection with P. infestans. 3-Aminobutanoic acid has various levels of susceptibility for the pathogen[1].

  

• HY-W010937

  1-Butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide	174899-83-3
  1-Butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (compound 8) is an HIV-1 integrase inhibitor that effectively inhibits both the 3'-processing (3'-P) and strand transfer (ST) steps of the integration reaction. 1-Butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide can be utilized in HIV-1 research[1].

  

• HY-W011733

  Tulobuterol hydrochloride	56776-01-3	99.66%
  Tulobuterol hydrochloride (C-78) is a long-acting β2-adrenoceptor agonist, which reduces the frequency of exacerbations of chronic obstructive pulmonary disease and bronchial asthma. Tulobuterol hydrochloride is also a sympathomimetic agent used as a transdermal patch, increases normal diaphragm muscle strength[1]. Tulobuterol hydrochloride inhibit rhinovirus replication and modulate airway inflammation[2].

  

• HY-W012738

  DL-Pyroglutamic acid	149-87-1
  DL-Pyroglutamic acid (CAE) as an inactivator of hepatitis B surface, inactivates vaccinia virus, herpes simplex virus, and influenza virus except poliovirus. DL-Pyroglutamic acid is also a possible inhibitor of GABA transaminase, increases GABA amount with antiepileptic action[1][2].

  

• HY-W016041

  2-Amino-2'-deoxyadenosine	4546-70-7	99.62%
  2-Amino-2'-deoxyadenosine is a deoxyribonucleoside used for the oligonucleotide synthesis[1].

  

• HY-W016969

  2-Undecanone	112-12-9	98.96%
  2-Undecanone is a volatile organic compound, which inhibits the DnaKJE-ClpB bichaperone dependent refolding of heat-inactivated bacterial luciferases. 2-Undecanone inhibits lung tumorigenesis[1][2].

  

• HY-W035409

  RPW-24	1001625-82-6	98.00%
  RPW-24 protects C. elegans from bacterial infection by stimulating the host immune response of the nematode. RPW-24 has antibacterial activity[1].

  

• HY-W041988

  Fmoc-Glu-OMe	145038-49-9	99.74%
  Fmoc-Glu-OMe, a glutamic acid derivative, shows antibacterial activity and gelation property in AgNO3 solution. Fmoc-Glu-OMe is a mouldable wound healing biomaterial[1].

  

• HY-W074930

  (S)-Tenofovir	147127-19-3	98.34%
  (S)-Tenofovir ((S)-GS 1278) is the less active S-enantiomer of Tenofovir. Tenofovir is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV)[1].

  

• HY-W295873

  Cyclo(Phe-Gly)	5037-75-2	98.48%
  Cyclo(Phe-Gly) is a cyclodipeptides with antimicrobial and anticancer activities, isolated from broth culture of endophytic Streptomyces YIM 64018 associated with Paraboea sinensis[1].

  

• HY-W395779

  EBOV-IN-1	1335113-30-8
  EBOV-IN-1 (com 3.47) is an adamantane dipeptide piperazine and an inhibitor of Ebola virus (EBOV). EBOV-IN-1 targets Niemann-Pick C1 (NPC1) and inhibits its binding to the EBOV glycoprotein (GP) that activates and mediates viral penetration into host cells, thereby inhibiting EBOV infection. EBOV-IN-1 inhibits pseudotyped EBOV infection with an IC50 of 13 nM[1].

  

• HY-W587430

  Glycolithocholic acid 3-sulfate disodium	64936-82-9	99.20%
  Glycolithocholic acid 3-sulfate (disodium) inhibits replication of HIV-1 in vitro. Glycolithocholic acid 3-sulfate (disodium) can be used for the research of HIV infection and gallbladder disease[1][2].

  

• HY-Y0264S1

  4-Hydroxybenzoic acid-d4	152404-47-2
  4-Hydroxybenzoic acid-d4 is the deuterium labeled 4-Hydroxybenzoic acid. 4-Hydroxybenzoic acid, a phenolic derivative of benzoic acid, could inhibit most gram-positive and some gram-negative bacteria, with an IC50 of 160 μg/mL.

  

• HY-113225S5

  Guanosine triphosphate-13C10 dilithium
  Guanosine triphosphate-13C10 (GTP-13C10) dilithium is 13C-labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate is a native nucleotide. The derivatives of GTP may be used as specific inhibitors against COVID-19.

  

• HY-21496

  4-(Bromomethyl)benzoic acid	6232-88-8
  4-(Bromomethyl)benzoic acid (4-Carboxybenzyl bromide) is an antiparasitic agent with low activity against Leishmania amazonensis and Trypanosoma cruzi. 4-(Bromomethyl)benzoic acid has certain cytotoxicity to PBMCs, with an IC50 of 88.8 μM[1].

  

• HY-B0348

  Liranaftate	88678-31-3	99.68%
  Liranaftate (Piritetrate) is a squalene epoxidase inhibitor with anti-fungicidal activities. Liranaftate can be used for the research of dermatophytes. Liranaftate also suppresses fungal element-promoted production of IL-8 and experimental inflammation[1][2][3][4].

  

• HY-B0915

  Orbifloxacin	113617-63-3	99.78%
  Orbifloxacin is a synthetic broad-spectrum fluoroquinolone antibiotic which is approved for use in dogs.

  

• HY-B1387

  Sulfamethoxypyridazine	80-35-3	99.67%
  Sulfamethoxypyridazine is a long-acting sulfonamide antibiotic, for treatment of Dermatitis herpetiformis.

  

• HY-B1950

  Quizalofop-p-ethyl	100646-51-3	99.10%
  Quizalofop-P-ethyl is a low-toxicity herbicide, a highly selective new type of post-emergence herbicide for dryland crops, with high selectivity between gramineous weeds and dicotyledonous crops, and it has good control efficacy against gramineous weeds in broadleaf crop fields.

  

• HY-N8722

  Datiscetin	480-15-9	99.91%
  Datiscetin (compound 5) is a natural compound isolated from the cultivar “Roland”, and shows fungitoxic activity towards F. oxysporum f. sp. dianthi.[1].

  

• HY-119749

  Diazaborine	22959-81-5	98.01%
  Diazaborine is an inhibitor for enoyl-acyl carrier protein (enoyl ACP) in an NAD+-dependent manner. Diazaborine exhibits antibacterial activity, MIC for E. coli and K. pneumoniae is 25 and 3.12 μg/mL[1].

  

• HY-119904

  Malaoxon	1634-78-2
  Malaoxon is a pesticide metabolite. Malaoxon can induce cellular death in cultured human pulmonary cells. Malaoxon can be used for the research of pulmonary toxicity[1].

  

• HY-14456A

  MAC13243	1071638-38-4
  MAC13243, an antibacterial agent, is an inhibitor of bacterial lipoprotein targeting chaperone, LolA. MAC13243 is an antibacterial agent with Gram-negative selectivity[1][2].

  

• HY-148077

  Phosphoglycolohydroxamic acid	51528-59-7
  Phosphoglycolohydroxamic acid is a potent aldolase and triose-phosphate isomerase inhibitor. Phosphoglycolohydroxamic acid can be used in the research of antibacterial and antifungal area[1][2].

  

• HY-156215

  NCI-B16	802835-01-4
  NCI-B16 is a small molecule RNA binder and inhibits HCV viral replication[1].

  

• HY-157570

  Anti-inflammatory agent 70	2767427-87-0
  Anti-inflammatory agent 70 (N-Me-SP23) is a STING protein PROTAC degrader and inhibits the STING signaling pathway. Anti-inflammatory agent 70 has anti-inflammatory activity. (Pink: STING inhibitor (HY-47709); Black: linker (HY-W008296); Blue: CRBN Ligand (HY-W460193))[1].

  

• HY-15781A

  (R)-Morinidazole	898230-59-6
  (R)-Morinidazole is an orally active and 5-nitroimidazole antimicrobial agent that undergoes extensive metabolism in humans via N+-glucuronidation and sulfation. (R)-Morinidazole can be used for bacterial infections research including appendicitis and pelvic inflammatory disease (PID) caused by anaerobic bacteria[1].

  

• HY-B0105A

  (+)-Ketoconazole	142128-59-4	99.79%
  (+)-Ketoconazole ((+)-R 41400) is an imidazole anti-fungal agent, a CYP3A4 inhibitor.

  

• HY-B0937A

  Amprolium hydrochloride	137-88-2	98.79%
  Amprolium hydrochloride is an anti-parasitic drug that's kind of taken orally, and it acts as an antagonist to thiamine in intestinal absorption[1][2][3][4].

  

• HY-147097A

  EDA-DA TFA	87156-01-2
  EDA-DA is a N-terminally tagged dipeptide probe, can be used to label Peptidoglycan (PG) of bacteria. EDA-DA is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups[1].

  

• HY-156895A

  Ile-AMS TFA		98.55%
  Ile-AMS TFA is active against P. falciparum with an ABS IC50 value of 1.19 nM[1].

  

• HY-W014120

  Thianthrene	92-85-3	99.98%
  Thianthrene, a sulfur-containing heterocyclic compound, is a derivative of dithiin. Thianthrene can be used in the research of dermal infections, in which it interferes with enzyme and nucleic acid function[1].

  

• HY-W015820

  Phthalide	87-41-2	99.94%
  Phthalide is a chemical scaffold. Phthalide can be used to synthesize a variety of phthalide derivatives including anti-inflammatory agent, antimicrobial, antioxidant and blood-tumor barrier modulators[1][2][3][4].

  

• HY-W018667

  3-Acetylindole	703-80-0
  3-Acetylindole can be used as a precursor for synthesis of antiviral agents[1].

  

• HY-W087988

  3-Pentanol	584-02-1
  3-Pentanol is an active organic compound produced by plants and is a component of insect-released pheromones. 3-Pentanol can trigger plant immunity against microbial pathogens and pests in crops by activating the SA and JA signaling pathways.

  

• HY-128554S1

  N-Desethyl amodiaquine-d5 dihydrochloride	1216894-33-5	98.76%
  N-Desethyl amodiaquine-d5 (dihydrochloride) is the deuterium labeled N-Desethyl amodiaquine dihydrochloride. N-Desethyl amodiaquine dihydrochloride is the major biologically active metabolite of Amodiaquine. N-Desethyl amodiaquine dihydrochloride is an antiparasitic agent. IC50 values for strains V1/S and 3D7 are 97 nM and 25 nM, respectively[1].

  

• HY-132280

  Tirilazad	110101-66-1	98.11%
  Tirilazad is a nonglucocorticoid, 21-aminosteroid that inhibits lipid peroxidation. Tirilazad can attenuate brain or spinal cord injury caused by trauma, stroke, ischemia and reperfusion injury. Tirilazad has antiviral activities against nCoV. Tirilazad is neuroprotective for ischaemic stroke, can be used for subarachnoid hemorrhage research[1][2][3].

  

• HY-18062S

  Pyrimethamine-d3	1189936-99-9	99.90%
  Pyrimethamine-d3 is the deuterium labeled Pyrimethamine. Pyrimethamine is a medication used for protozoal infections; interferes with tetrahydrofolic acid synthesis from folic acid by inhibiting the enzyme dihydrofolate reductase (DHFR)[1][2].

  

• HY-10224A

  Panobinostat lactate	960055-56-5	98.67%
  Panobinostat lactate is a potent and orally active non-selective HDAC inhibitor. Panobinostat lactate has antineoplastic activities. Panobinostat lactate effectively disrupts HIV latency. Panobinostat lactate induces cell apoptosis and autophagy. Panobinostat lactate can be used for the study of refractory or relapsed multiple myeloma[1][2][3][4][5].

  

• HY-117660

  Lincomycin	154-21-2
  Lincomycin, a lincosamide antibiotic, is an antimicrobial agent used for the research of Gram-positive bacteria infections[1].

  

• HY-112163A

  rel-Zotatifin	2098191-54-7
  rel-Zotatifin is the racemic isomer of Zotatifin, acts as an eIF4A inhibitor with activity less than Zotatifin. Zotatifin (eFT226) is a potent, selective, and well-tolerated eIF4A inhibitor. Zotatifin promotes eIF4A binding to specific mRNA sequences with recognition motifs in the 5’-UTRs (IC50=2 nM) and interferes with the assembly of the eIF4F initiation complex[1].

  

• HY-15005S1

  Sofosbuvir-d6	1868135-06-1
  Sofosbuvir-d6 is the deuterium labeled Sofosbuvir. Sofosbuvir (PSI-7977) is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.

  

• HY-13836

  ELQ-300	1354745-52-0
  ELQ-300 is a potent and orally bioavailable antimalarial agent, acts as an inhibitor of the reductive (Qi) site of the cytochrome bc1 complex (cyt bc1). ELQ-300 inhibits growth of P. falciparum Dd2, Tm90-C2B, and D1 with IC50 values of 6.6, 4.6 and 160 nM, respectively. ELQ-300 can be used for the research of antimalarial[1][2].

  

• HY-111358

  TLR7 agonist 1	2178156-33-5	98.19%
  TLR7 agonist 1 is a potent, selective and oral TLR7 agonist with an IC50 of 90 nM.

  

• HY-111746

  CWHM-1008	2362539-97-5	99.06%
  CWHM-1008 is a potent and orally active antimalarial agent, with EC50 values of 46 and 21 nM against agent-sensitive Plasmodium falciparum 3D7 and drug-resistant Dd2 strains, respectively[1].

  

• HY-112564

  JNJ-632	1572510-42-9	99.94%
  JNJ-632 is a hepatitis B virus (HBV) capsid assembly modulator (CAM).

  

• HY-124662

  IHVR-19029	1447464-73-4
  IHVR-19029 is a potent endoplasmic reticulum (ER) α-glucosidases I and II inhibitor, with an IC50 of 0.48 μM for ER a-glucosidase I. IHVR-19029 efficiently blocks the replication of several hemorrhagic fever viruses, such as Dengue virus (DENV), Ebola virus (EBOV) and Rift Valley fever virus. The combination of IHVR-19029 with Favipiravir (HY-14768) improves the antiviral efficacy[1][2][3][4].

  

• HY-133119

  PK150	2165324-62-7	99.43%
  PK150, an analogue of Sorafenib, shows oral bioavailability and antibacterial activity against several pathogenic strains at submicromolar concentrations. PK150 inhibits Gram-positive Methicillin-sensitive S. aureus (MSSA), Methicillin-resistant S. aureus (MRSA), Vancomycin intermediate S. aureus (VISA) with MICs of 0.3, 0.3-1, 0.3 μM, respectively[1].

  

• HY-B0219A

  Allopurinol sodium	17795-21-0	99.88%
  Allopurinol sodium is a potent and orally active xanthine oxidase inhibitor with an IC50 value of 0.2-50 μM. Allopurinol sodium can be used in the research of hyperuricemia and gout. Allopurinol sodium decreases the expression of HIF-1α and HIF-2α protein. Allopurinol sodium shows anti-depressant and anti-nociception activity. Anti-leishmanial effect[1][2][3][4][5].

  

• HY-W003467

  Rabeprazole Sulfide	117977-21-6	98.09%
  Rabeprazole Sulfide is an active metabolite of Rabeprazole. Rabeprazole is a proton pump inhibitor that suppresses gastric acid secretion through an interaction with (H+/K+)-ATPase in gastric parietal cells. Rabeprazole markedly inhibits the motility of H. pylori. Rabeprazole has the potential for various peptic diseases treatment[1][2].

  

• HY-14926

  Levonadifloxacin	154357-42-3	99.79%
  Levonadifloxacin ((S)-(-)-Nadifloxacin; WCK 771) is a broad-spectrum anti-staphylococcal agent. Levonadifloxacin shows antibacterial activity against Methicillin (HY-121544)-susceptible Staphylococcus aureus (MSSA) and Methicillin-resistant S. aureus (MRSA) strains, with a reduction of which phagocytized in THP-1 monocytes[1].

  

• HY-17028

  Besifloxacin Hydrochloride	405165-61-9	98.11%
  Besifloxacin Hydrochloride is a fourth generation fluoroquinolone antibiotic. Besifloxacin Hydrochloride is a DNA gyrase and topoisomerase IV inhibitor. Besifloxacin Hydrochloride has broad-spectrum antibacterial activity, it is effective against Gram-negative and Gram-positive aerobic and anaerobic strains and reduces the incidence of drug resistance. Besifloxacin Hydrochloride has anti-inflammatory activity. Besifloxacin Hydrochloride can be used in bacterial conjunctivitis research[1][2][3][4].

  

• HY-17452

  Cefditoren sodium	104146-53-4	99.70%
  Cefditoren sodium (ME 1206) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren sodium has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren sodium can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections[1][2].

  

• HY-B0603

  Fluticasone	90566-53-3	98.70%
  Fluticasone is an inhaled corticosteroid used for respiratory research. Fluticasone is a Smo agonist with an IC50 value of 99 nM. Fluticasone activates Hedgehog signaling and promotes the proliferation of primary neuronal stem or precursor cells[1][2].

  

• HY-10574A

  Rilpivirine hydrochloride	700361-47-3	99.81%
  Rilpivirine (R278474) hydrochloride is a potent and specific diarylpyrimidine (DAPY) non-nucleoside reverse transcriptase inhibitor (NNRTI). Rilpivirine hydrochloride has high antiviral activity against wild-type HIV (EC50=0.4 nM) and mutant viruses (EC50=0.1-2.0 nM). Rilpivirine hydrochloride has a high genetic barrier to resistance development of HIV[1][2].

  

• HY-109014

  Tenofovir exalidex	911208-73-6	99.82%
  Tenofovir exalidex (CMX157) is a lipid conjugate of the acyclic nucleotide analog Tenofovir with activity against both wild-type and antiretroviral drug-resistant HIV strains, including multidrug nucleoside/nucleotide analog-resistant viruses. Tenofovir exalidex is active against all major subtypes of HIV-1 and HIV-2 in fresh human PBMCs and against all HIV-1 strains evaluated in monocyte-derived macrophages, with EC50s ranging between 0.2 and 7.2 nM. CMX157 is orally available and has no apparent toxicity. Tenofovir exalidex also shows antiviral activity against HBV[1][2][3].

  

• HY-131350

  LXE408	1799330-15-6	99.08%
  LXE408 is an orally active, non-competitive and kinetoplastid-selective proteasome inhibitor. LXE408 has an IC50 of 0.04 μM for L. donovani proteasome and an EC50 of 0.04 μM for L. donovani. LXE408 has a low propensity to cross the blood brain barrier. LXE408 has the potential for visceral leishmaniasis (VL) research[1].

  

• HY-148797

  Rolusafine	2089153-78-4	98.78%
  Rolusafine is an antifungal agent[1].

  

• HY-B0277A

  Vidarabine phosphate	29984-33-6	98.74%
  Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection[1][2]. Vidarabine phosphate also against herpes simplex and varicella zoster viruses[3].

  

• HY-P99346

  Regdanvimab	2444308-95-4
  Regdanvimab (CT-P59) is a human monoclonal antibody that targets the receptor-binding domain of SARS-CoV-2 spike protein, blocking interaction with ACE2 for viral entry. Regdanvimab can be used for the research of COVID-19[1].

  

• HY-P99435

  Amubarvimab	2509447-07-6
  Amubarvimab (BRII-196) is a human IgG1 mAb that bind to non-competing epitopes on the receptor binding domain (RBD) of spike protein, with a KD of 5.88 nM. Amubarvimab can effectively neutralize SARS-CoV-2 variants[1][2].

  

• HY-U00160

  SP187	615253-61-7
  SP187 is a host-targeted iminosugar with activity against filovirus infections in vitro and in vivo. SP187 is active against influenza and dengue in vivo.

  

• HY-106574A

  Ceftobiprole medocaril sodium	252188-71-9
  Ceftobiprole medocaril (BAL5788) sodium is the parenteral proagent of Ceftobiprole (HY-112579). Ceftobiprole is a parenteral pyrrolidinone cephalosporin. Ceftobiprole is a broad-spectrum cephalosporin with high levels of in vitro activity against methicillin- (MRSA) and vancomycin-resistant staphylococci (VRSA) and penicillin-resistant streptococci. Ceftobiprole also inhibits gram-positive and gram-negative pathogens[1][2].

  

• HY-123475A

  Sisunatovir hydrochloride	1903763-83-6	98.61%
  Sisunatovir (RV521) hydrochloride is a potent and orally active respiratory syncytial virus (RSV) inhibitor with IC50 values of 1.4, 1.0 nM for RSV A, RSV B, respectively. Sisunatovir hydrochloride inhibits RSV infection and reduces virus titers in the lungs of mice[1].

  

• HY-P990015

  Tobevibart	2645440-65-7
  Tobevibart (VIR-3434) is a human IgG1 lambda monoclonal antibody against hepatitis B virus (HBV) surface antigen (HBsAg). Tobevibart shows potent neutralization against HBsAg from all HBV genotypes in vitro and inhibits viral entry of HBV and hepatitis delta virus (HDV). Recommend Isotype Controls: Human IgG1 lambda1, Isotype Control (HY-P99992)[1].

  

• HY-19964

  Potassium clavulanate cellulose
  Potassium clavulanate cellulose (Potassium clavulanate:cellulose (1:1)) is a mixture of potassium clavulanate and cellulose, is a bacterial β-lactamase inhibitor. Clavulanate potassium is a form of Clavulanic acid. Clavulanate potassium fights bacteria that resistant to penicillins and other antibiotics. Potassium clavulanate with the combination of amoxicillin can be used for the research of different infections caused by bacteria, such as sinusitis, pneumonia, ear infections, bronchitis, urinary tract infections, and infections of the skin[1][2].

  

• HY-B0502S

  Enrofloxacin-d5	1173021-92-5	99.82%
  Enrofloxacin-d5 is the deuterium labeled Enrofloxacin. Enrofloxacin (BAY Vp 2674) is an effective antibiotic with an MIC90 of 0.312 μg/mL for Mycoplasma bovis.

  

• HY-11098

  JNJ 2408068	317846-22-3
  JNJ 2408068 is a potent RSV (respiratory syncytial virus) inhibitor. JNJ 2408068 significantly inhibits replication of RSV A and B subtypes in the lungs of cotton rats without any evidence of toxicity. The minimum protective dose of JNJ 2408068 appears to be approximately 0.39 mg/kg[1].

  

• HY-12904

  TCA1	864941-32-2	98.29%
  TCA1 is a small molecule with activity against agent-susceptible and -resistant Mycobacterium tuberculosis (Mtb). TCA1 inhibits enzymes involved in cell wall and molybdenum cofactor biosynthesis, such as DprE1 and MoeW[1].

  

• HY-13833

  Endochin	354155-51-4
  Endochin is an antimalarial agent. Endochin inhibits T.gondii with an IC50 of 0.003 nM. Endochin is also active against experimental toxoplasmosis[1][2].

  

• HY-15353

  Emivirine	149950-60-7	99.73%
  Emivirine (MKC-442) is a non-nucleoside reverse transcriptase inhibitors (NNRTIs) with Ki values of 0.20 and 0.01 μM for dTTP- and dGTP-dependent DNA or RNA polymerase activity, respectively. Emivirine displays potent and selective anti-human immunodeficiency virus type 1 (HIV-1) activity[1][2].

  

• HY-15355

  Loviride	147362-57-0	99.59%
  Loviride (R 89439) is a non-nucleoside reverse transcriptase inhibitor (NNRTI), with an IC50 of 0.3 µM for reverse transcriptase from HIV-1. Loviride (R 89439) inhibits HIV-1, HIV-2 and SIV replication in MT-4 cells[1].

  

• HY-16719

  Dapaconazole	1269726-67-1	99.76%
  Dapaconazole, as an antifungal agent, inhibits sterol 14α-demethylase cytochrome P450 activity with an IC50 of 1.4 μM[1].

  

• HY-16745

  Lascufloxacin	848416-07-9	98.04%
  Lascufloxacin (KRP-AM1977X) is a potent and orally active fluoroquinolone antibacterial agent. Lascufloxacin potently inhibits infections caused by various pathogens, including quinolone-resistant strains. Lascufloxacin has the potential for various infectious diseases treatment, including lower respiratory tract infections[1][2].

  

• HY-16762

  Artefenomel	1029939-86-3	99.14%
  Artefenomel (OZ439) is an orally active, synthetic anti-malarial compound containing an artemisinin pharmacophore with a mechanism of action similar to that of artemisinin. Artefenomel has antiviral activity against SARS-CoV-2[1][2].

  

• HY-19364

  Ferroquine	185055-67-8	99.68%
  Ferroquine (Ferrochloroquine), a ferrocenyl analogue of Chloroquine, is an antimalarial agent. Ferroquine shows parasiticidal effect on Plasmodium by inducing oxidative stress and the subsequent destruction of the membrane[1].

  

• HY-19476

  AG-7404	343565-99-1
  AG-7404 is an orally active, irreversible inhibitor of the picornavirus 3C protease. AG-7404 blocks the processing of viral polyproteins, thereby inhibiting viral replication. AG-7404 has synergistic antiviral activity with capsid inhibitors such as V-073 (HY-104074) or BTA798 (HY-106254) and is effective against V-073-resistant variants. AG-7404 is used in the study of enterovirus infections such as poliovirus[1][2][3].

  

• HY-19856

  Valnivudine hydrochloride	956483-03-7
  FV-100 is a potent, selective and orally active anti-varicella zoster virus agent. FV-100 is a proagent of CF-1743. FV-100 exhibits very low toxicity in vivo[1][2].

  

• HY-30220

  (S)-2-Hydroxy-3-phenylpropanoic acid	20312-36-1
  (S)-2-Hydroxy-3-phenylpropanoic acid is the L-configuration of 2-Hydroxy-3-phenylpropanoic acid, and its level is closely related to some diseases, such as phenylketonuria[1].

  

• HY-41407

  2,3-Dimethoxybenzaldehyde	86-51-1	99.93%
  2,3-Dimethoxybenzaldehyde (o-Veratraldehyde) is a benzaldehyde analog, with high antifungal activity (MIC=2.5 mM) 2,3-Dimethoxybenzaldehyde (o-Veratraldehyde) could be used for the synthesis of berberine[1].

  

• HY-75800

  Lomibuvir	1026785-55-6	99.92%
  Lomibuvir (VX-222), a selective, non-nucleoside polymerase inhibitor, targets thumb pocket 2 of the HCV NS5B polymerase (RdRp) with a Kd of 17 nM. Lomibuvir inhibits the 1b/Con1 HCV subgenomic replicon with an EC50 of 5.2 nM. Lomibuvir preferentially inhibits elongative RNA synthesis rather than de novo-initiated RNA synthesis[1].

  

• HY-77652

  Nucleoside-Analog-2	876708-01-9
  Nucleoside-Analog-2 is a 4'-Azidocytidine analogue against Hepatitis C virus (HCV) replication. Nucleoside-Analog-2 is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-78086

  m-Tolualdehyde	620-23-5	99.31%
  m-Tolualdehyde (3-Methylbenzaldehyde) is a natural product. m-Tolualdehyde can be isolated from Ficus carica L. and Myosotis arvensis. m-Tolualdehyde has food protective effects. m-Tolualdehyde shows acaricidal activities for Tyrophagus putrescentiae with a LD50 of 1.97 μg/cm3[1][2].

  

• HY-78542

  Deshydroxyethoxy ticagrelor	220347-05-7	98.84%
  Deshydroxyethoxy ticagrelor (AR-C124910) is a metabolite of Ticagrelor (HY-10064) with antimicrobial and antiplatelet activities against MRSA[1].

  

• HY-A0130

  Sulfalene	152-47-6	99.73%
  Sulfalene (Sulfametopyrazine) is an antimalarial agent. Sulfalene is also a long-acting sulfonamide antibacterial.

  

• HY-A0278

  Hexaconazole	79983-71-4	98.11%
  Hexaconazole is a demethylation enzyme inhibitor and a synthetic fungicide that targets many fungi, especially ascomycetes and basidiomycetes, and it can enhance the activity of SOD and peroxidase. Hexaconazole causes endocrine disorders in zebrafish larvae[1][2][3][4].

  

• HY-B0609

  Fosfomycin tromethamine	78964-85-9	99.69%
  Fosfomycin (MK-0955) tromethamine is a blood-brain barrier penetrating, broad-spectrum antibiotic by irreversibly inhibiting an early stage in cell wall synthesis. Fosfomycin tromethamine shows both in vivo and in vitro activity against a wide range of bacteria, including multidrug-resistant (MDR), extensively drug-resistant (XDR), and pan-drug-resistant (PDR) bacteria[1][2].

  

• HY-B0798

  Cefpiramide sodium	74849-93-7	98.82%
  Cefpiramide sodium (SM-1652; Wy-44635) is a new Pseudomonas-active cephalosporin with a broad spectrum of antibacterial activity.

  

• HY-B0842

  Thiophanate-Methyl	23564-05-8	99.86%
  Thiophanate-Methyl is a systematic fungicide[1].

  

• HY-B1011

  Edoxudine	15176-29-1	99.12%
  Edoxudine is an antiviral active molecule and thymidine analog. Edoxudine is effective against herpes simplex virus[1][2].

  

• HY-B1224

  Exalamide	53370-90-4	99.99%
  Exalamide (2-(Hexyloxy)benzamide), an arenecarboxamide, is a potent antifungal agent[1].

  

• HY-B1244

  Dimetridazole	551-92-8
  Dmetridazole (1,2-Dimethyl-5-nitroimidazole), a nitroimidazole-based antibiotic, combats protozoan infections[1].

  

• HY-B1636

  Dithiazanine iodide	514-73-8	99.91%
  Dithiazanine iodide is an effective broad-spectrum anthelmintic. Dithiazanine iodide can be used for the research of trichuriasis, strongyloidiasis, enterobiasis, ascariasis, and hookworm infection. Dithiazanine iodide is also a cyanine dye[1][2].

  

• HY-B1984

  p,p'-DDD	72-54-8	99.71%
  p,p'-DDD (4,4’-DDD) is an organochlorine insecticide, a major metabolite of p,p'-DDT. p,p'-DDD is an agonist at estrogen receptor α(ERα) and ERβ. p,p'-DDD increases DNA damage, apoptosis and necrosis in peripheral blood. p,p'-DDD stimulates cell proliferation in SKBR3 cells. p,p'-DDD activates the AP-1 transcription factor. p,p'-DDD decreases sleep times of barbiturates and steroids in rats[1][2][3][4].

  

• HY-B2012

  Flusilazole	85509-19-9	98.82%
  Flusilazole (DPX-H6573), an organosilane fungicide, has broad-spectrum antifungal effect. Flusilazole exhibits curative and preventative activities and is recommended for use in agriculture and horticulture[1].

  

• HY-D1270

  Direct Violet 1	2586-60-9
  Direct Violet 1, an azo dye, is a textile dye. Direct Violet 1 is also the protein-protein interaction (PPI) between the SARS-CoV-2 spike protein and ACE2 inhibitor with IC50s of 1.47-2.63 μM[1][2].

  

• HY-D1543

  Pyronin B	2150-48-3
  Pyronin B is an organic cationic dye used for the staining of bacteria, mycobacteria and ribonucleic acids. Pyronin B is also used as a small hydrophobic (SH) protein channel inhibitor[1][2].

  

• HY-N0081

  (±)-Praeruptorin A	73069-25-7	99.94%
  (±)-Praeruptorin A is the di-esterified product of cis-khellactone (CKL) and the major active ingredient in Peucedani Radix which consists of the dried roots of Peucedanum praeruptorumDunn (Apiaceae). (±)-Praeruptorin A has been widely employed as one of the famous traditional Chinese medicines (TCMs) for the treatment of cough with thick sputum and dyspnea, nonproductive cough and upper respiratory infections for centuries in China. (±)-Praeruptorin A has dramatically therapeutic effects on hypertension mainly through acting as a Ca2+-influx blocker[1].

  

• HY-N0364

  Falcarindiol	55297-87-5
  Falcarindiol, an orally active polyacetylenic oxylipin, activates PPARγ and increases the expression of the cholesterol transporter ABCA1 in cells. Falcarindiol induces apoptosis and autophagy. Falcarindiol has anti-inflammatory, antifungal, anticancer and antidiabetic properties[1][2]. Falcarindiol is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-N1433

  Phytolaccagenin	1802-12-6	99.86%
  Phytolaccagenin, a triterpenoid saponin, is the active component of Radix Phytolaccae. Phytolcaccagenin has antifungal activity, anti-inflammatory activity and lower toxicity[1]

  

• HY-N2000

  Bellidifolin	2798-25-6	99.74%
  Bellidifolin is a xanthone isolated from the stems of Swertia punicea, with hepatoprotective, hypoglycemic, anti-oxidation, anti-inflammatory and antitumor activities[1][2][3]. Bellidifolin also acts as a viral protein R (Vpr) inhibitor[4].

  

• HY-N2211

  Picfeltarraenin IB	97230-46-1	98.53%
  Picfeltarraenin IB, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IB can be used for the treatment of herpes infections, cancer and inflammation[1].

  

• HY-N2224

  Guaijaverin	22255-13-6	99.79%
  Guaijaverin is a urease inhibitor with an IC50 of 120 μM. Guaijaverin shows antioxidant and anti-Streptococcus mutans activities[1][2][3].

  

• HY-N2377

  Allosecurinine	884-68-4	99.61%
  Allosecurinine (Phyllochrysine) is a Securinega alkaloid isolated from Phyllanthus glaucus [1].

  

• HY-N2417

  Stearyl glycyrrhetinate	13832-70-7
  Stearyl glycyrrhetinate, a major component in licorice extract, has a MIC against S. aureus strains of more than 256 mg/L. Stearyl glycyrrhetinate has antibacterial effects[1].

  

• HY-N2458

  Ganoderic acid G	98665-22-6	99.10%
  Ganoderic acid G is a triterpene isolated from the surface part of gills of Ganoderma lucidum[1].

  

• HY-N2512

  1-Monomyristin	589-68-4
  1-Monomyristin, extracted from Serenoa repens, inhibits the hydrolysis of 2-oleoylglycerol (IC50=32 μM) and fatty acid amide hydrolase (FAAH) activity (IC50=18 μM). 1-Monomyristin shows antibacterial activity against Staphylococcus aureus and Aggregatibacter actinomycetemcomitans and also antifungal activity against Candida albicans[1][2][3].

  

• HY-N2533

  Cyanidin 3-sambubioside chloride	33012-73-6
  Cyanidin 3-sambubioside chloride (Cyanidin-3-O-sambubioside chloride), a major anthocyanin, a natural colorant, and is a potent NO inhibitor. Cyanidin 3-sambubioside chloride is a H274Y mutation inhibitor, and inhibits influenza neuraminidase activity with an IC50 of 72 μM. Cyanidin 3-sambubioside chloride inhibits angiotensin-converting enzyme (ACE) activity and has antioxidant, anti-angiogenic and antiviral properties[1][2][3].

  

• HY-N2565

  Rosamultin	88515-58-6	99.58%
  Rosamultin is a 19 α-hydroxyursane-type triterpenoid isolated from Potentilla anserina?L. Rosamultin has inhibitory effects against HIV-1 protease[1]. Rosamultin has the potential for treating H2O2-induced oxidative stress injury through its antioxidant and antiapoptosis effects[2].

  

• HY-N2626

  Epimedoside A	39012-04-9
  Epimedoside A is a flavonoid isolated from the roots of Epimedium wushanense. Epimedoside A exhibits significant antioxidant activity in vitro[1].

  

• HY-N3013

  Bruceine B	25514-29-8	99.60%
  Bruceine B inhibits protein synthesis and nucleic acid synthesis[1].

  

• HY-N3074

  Hexahydrofarnesyl acetone	502-69-2
  Hexahydrofarnesyl acetone (6,10,14-Trimethyl-2-pentadecanone) is a oral active sesquiterpene with oral activity, exhibiting antibacterial, anti-inflammatory, and anticancer properties, and is used in pain relief research[1][2][3].

  

• HY-N4117

  Hamamelitannin	469-32-9	99.43%
  Hamamelitannin, a polyphenol extracted from the bark of Hamamelis virginiana, is a quorum-sensing (QS) inhibitor. Hamamelitannin increases antibiotic susceptibility of staphylococcus aureus biofilms by affecting peptidoglycan biosynthesis and eDNA release[1][2].

  

• HY-N4210

  Yadanziolide A	95258-14-3	99.42%
  Yadanziolide A, isolated from the cultivated dry seeds of Brucea javanica, has strong antiviral activities with IC50 of 5.5 μM against tobacco mosaic virus. Yadanziolide A shows significant antitumor effects[1][2].

  

• HY-N5018

  Nepodin	3785-24-8	99.71%
  Nepodin (Musizin) is a quinone oxidoreductase (PfNDH2) inhibitor isolate from Rumex crispus[1].Nepodin (Musizin) stimulates the translocation of GLUT4 to the plasma membrane by activation of AMPK[2].Nepodin (Musizin) has antidiabetic and antimalarial activities.

  

• HY-N5020

  Carabrone	1748-81-8	99.20%
  Carabrone is isolated from the fruits of Carpesium abrotanoides , is a well-known sesquiterpene and exhibits significant anti-bacterial and anti-tumor activities[1]. Carabrone exhibits antifungal activities in vitro and in vivo against Botrytis cinerea, Colletotrichum lagenarium(EC50=7.10 μg/mL) and Erysiphe graminis[2].

  

• HY-N6711

  Equisetin	57749-43-6
  Equisetin is an N-methylserine-derived acyl tetramic acid, quorum sensing inhibitor (QSI), herbicides and antibiotics. Equisetin specifically inhibits the anionic carriers of substrates in the inner mitochondrial membrane. Equisetin inhibits the activity of HIV-1 integrase, 11β-HSD1, and 2,4-dinitrophenol (Dnp)-stimulated ATPase (IC50 = ~8 nmol per mg of protein). Equisetin exhibits growth inhibition of bacteria, anti-inflammatory, amelioration of lipid-associated disorders, and cytotoxic effects[1][2][3][4][5][6][7][8][9][10][11].

  

• HY-N6737

  Aureothricin	574-95-8
  Aureothricin is a dithiolopyrrolone (DTP) antibiotic first isolated from Streptomyces and exhibits relatively broad-spectrum antibiotic activity. Aureothricin can inhibit adhesion of human umbilical vein endothelial cells (HUVECs) to vitronectin[1].

  

• HY-N6745

  Citreoviridin	25425-12-1	99.65%
  Citreoviridin, a toxin from Penicillium citreoviride NRRL 2579, inhibits brain synaptosomal Na+/K+-ATPase whereas in microsomes, both Na+/K+-ATPase and Mg2+-ATPase activities are significantly stimulated in a dose-dependent manner[1]. Citreoviridin inhibits cell proliferation and enhances apoptosis of human umbilical vein endothelial cells[2].

  

• HY-N6801

  Nivalenol	23282-20-4
  Nivalenol, classified as type B trichotecenes toxins produced by Fusarium graminearum, is a fungal metabolite present in agricultural product[1]. Nivalenol induces cell death through caspase-dependent mechanisms and via the intrinsic apoptotic pathway. Nivalenol affects the immune system, causes emesis, growth retardation, reproductive disorders and has a haematotoxic/myelotoxic effect[2].

  

• HY-N6811

  1-Octacosanol	557-61-9
  1-Octacosanol is a straight-chain aliphatic 28-carbon fatty alcohol and a major component of the cholesterol-lowering agent Policosanol. 1-Octacosanol exhibits various activities such as anti-fatigue, anti-angiogenic, cholesterol-lowering, and insecticidal effects[1][2][3].

  

• HY-N7012

  7,3',4'-Tri-O-methylluteolin	29080-58-8	99.28%
  7,3',4'-Tri-O-methylluteolin (5-Hydroxy-3',4',7-trimethoxyflavone) is a flavonoid with multiple biological activities. 7,3',4'-Tri-O-methylluteolin inhibits soybean lipoxygenase (LOX), with an IC50 value of 23.97 µg/mL. 7,3',4'-Tri-O-methylluteolin possesses anti-inflammatory effects in Lipopolysaccharides (HY-D1056) (LPS)-induced RAW 264.7 macrophages. 7,3',4'-Tri-O-methylluteolin inhibits the binding of MDM2 with p53 and induces apoptosis in MCF-7 breast cancer cells. 7,3',4'-Tri-O-methylluteolin also has antioxidant, antifungal and antitrypanosomal activities[1][2][3]sup>[4]sup>[5].

  

• HY-N7060

  Helicin	618-65-5	99.38%
  Helicin, found in Rosaceae, is a moderate syrB inducer. Helicon can be hydrolyzed by BglY enzyme[1][2].

  

• HY-N7449

  Neamine	3947-65-7
  Neamine, a degradation product of Neomycin, is a broad-spectrum aminoglycoside antibiotic. Neamine is an anti-angiogenesis agent targeting angiogenin. Neamine has potent antibacterial, antitumor and neuroprotective activities[1][2].

  

• HY-N7503

  Psoralenoside	905954-17-8	99.84%
  Psoralenoside is a benzofuran glycoside from Psoralea corylifolia[1]. Psoralenoside exhibits high binding affinities against histaminergic H1, calmodulin, and voltage-gated L-type calcium channels (E-value≥-6.5 Kcal/mol)[2]. Psoralenoside shows estrogen-like activity, osteoblastic proliferation accelerating activity, antitumor effects and antibacterial activity[3].

  

• HY-N7619

  Xanthopurpurin	518-83-2	98.01%
  Xanthopurpurin is an orally active anthraquinone glycoside. Xanthopurpurin can be isolated from the rhizome of Rubia akane. Xanthopurpurin has antiviral effects against rotavirus and HIV. Xanthopurpurin has a strong inhibitory effect on collagen-induced platelet aggregation. Xanthopurpurin prevents peanut allergy[1][2][3][4].

  

• HY-N7632

  5-Desmethylsinensetin	21763-80-4	99.21%
  5-desmethylsinensetin, isolated from Artemisia princeps , possesses antiprotozoal activity. 5-desmethylsinensetin shows IC50 values of 0.4 μg/mL on T. cruzi epimastigotes and 75.1 μg/mL on trypomastigotes, respectively[1].

  

• HY-N7897

  Myrrhone	183551-83-9	99.89%
  Myrrhone is a terpenoid compound with antiplasmodial effects[1].

  

• HY-N8151

  Sanguisorbigenin	6812-98-2	99.11%
  Sanguisorbigenin is a natural antibacterial agent that inhibits methicillin-resistant S. aureus (MRSA)[1].

  

• HY-N8492

  Monascorubrin	13283-90-4
  Monascorubrin is purified from the mycelium of Monascus purpureus. Monascorubrin has significant antibiotic activities against Bacillus subtilis and Candida pseudotropicalis[1].

  

• HY-N9343

  Kulactone	22611-36-5	98.25%
  Kulactone, a natural bioflavonoid and an inhibitor against jRdRp, possesses antifungal, antibacterial and antiplasmodial activities. Kulactone exhibit no crossing through Blood Brain Barrier (BBB)[1][2].

  

• HY-N9496

  Piperitone	89-81-6	99.89%
  Piperitone is as a powerful repellent and antiappetent agent. Piperitone is very toxic to Cymbopogon schoenanthus (C. schoenanthus) adults, newly laid eggs and to neonate larvae. Insecticidal activity[1].

  

• HY-P1630

  Buforin II	172998-24-2	98.61%
  Buforin II, derived from buforin I, a protein isolated from the stomach of the Asian toad Bufo bufo gargarizans, is a potent antimicrobial peptide. Buforin II has antimicrobial activity against a broad spectrum of Gram-positive and Gram-negative bacteria[1].

  

• HY-P1862

  HSV-gB2 (498-505)	149997-91-1	99.32%
  HSV-gB2 (498-505) is an immunodominant epitope from herpes simplex virus (HSV) glycoprotein B residues 498-505, acts as H-2Kb-restricted and HSV-1/2-cross-reactive cytotoxic T-lymphocyte (CTL) recognition epitope[1].

  

• HY-P2096

  Hexapeptide-11	161258-30-6	99.52%
  Hexapeptide-11 is a bioactive peptide with anti-aging effect. Hexapeptide-11 protects fibroblasts against oxidative stress-mediated premature cellular senescence by mediating a downregulation of cellular proteins, such as ataxia telangiectasia mutated (ATM) and p53 [1].

  

• HY-P2317

  Cecropin P1, porcine	125667-96-1	99.83%
  Cecropin P1, porcine is an antibacterial peptide that can be isolated from the upper part of the small intestine of the pig. Cecropin P1, porcine shows antibacterial activity against Gram-negative bacteria. Cecropin P1, porcine shows antiviral activity and inhibits PRRSV infection[1][2].

  

• HY-P3884

  Arylomycin A2	459844-20-3	99.05%
  Arylomycin A2, an antibiotic (Antibiotic), is a lipopeptide type I signal peptidase (SPase I) inhibitor. Arylomycin A2 has antibacterial effects[1].

  

• HY-P4211

  PSM-β		99.53%
  PSM-β is a active peptide , which can be isolated from Staphylococcus epidermidis. PSM-β is an analog of staphylococcal toxins, as well as a termed phenol-soluble modulin. PSM-β has bacteriostatic and poorly hemolytic properties[1][2].

  

• HY-Y1771

  2-Carboxybenzaldehyde	119-67-5
  2-Carboxybenzaldehyde is the major metabolite found in phenanthrene metabolism. Phenanthrene can be degrade by Pseudomonas sp. Lphe-2 strain[1].

  

• HY-100527

  AN2718	174672-06-1	99.85%
  AN2718 inhibits fungal growth by blocking protein synthesis using the oxaborole tRNA trapping (OBORT) mechanism.

  

• HY-100654

  10-DEBC hydrochloride	925681-41-0	99.82%
  10-DEBC hydrochloride is a selective Akt inhibitor, with an IC50 of 1.28 μM. 10-DEBC hydrochloride is a novel anti-TB compound[1][2].

  

• HY-100679

  Pirlindole	60762-57-4
  Pirlindole is a selective and reversible MAO-A inhibitor[1]. Pirlindole is also an inhibitor of enterovirus-D68 and coxsackievirus B3 (CV-B3)[2].

  

• HY-100725

  BM212	146204-42-4	99.51%
  BM212 is a potent Mycobacterial membrane protein Large 3 (MmpL3) inhibitor. BM212 has strong bactericidal activity against both M. tuberculosis and some nontuberculosis mycobacteria. BM212 exhibits antimycobacterial activity against M. tuberculosis H37Rv with an MIC of 5 µM[1][2].

  

• HY-102026

  Formycin A	6742-12-7
  Formycin A (NSC 102811), a purine nucleoside antibiotic, is a potent human immunodeficiency virus type 1 (HIV-1) inhibitor with an EC50 of 10 μM. Formycin A shows antitumor and antiviral activities[1][2].

  

• HY-103396

  Trimetrexate glucuronate	82952-64-5	98.09%
  Trimetrexate glucuronate (NSC 352122) is a folic acid antagonist. Trimetrexate glucuronate affects DNA and RNA synthesis by inhibiting dihydrofolate reductase and preventing the synthesis of purine nucleotides and thymidylate. Trimetrexate glucuronate has potential antitumour activity and can also be used to inhibit Pneumocystis carinii pneumonia[1][2].

  

• HY-10394R

  Linezolid (Standard)	165800-03-3
  Linezolid (Standard) is the analytical standard of Linezolid. This product is intended for research and analytical applications. Linezolid (PNU-100766) is the first member of the class of oxazolidinone synthetic antibiotic. Linezolid acts by inhibiting the initiation of bacterial protein synthesis. Linezolid is used for the treatment of serious infections caused by Gram-positive bacteria that are resistant to several other antibiotics[1][2][3].

  

• HY-107033

  Tetroxoprim	53808-87-0	99.32%
  Tetroxoprim is an antimicrobial DHFR inhibitor[1].

  

• HY-107329

  Cefathiamidine	33075-00-2
  Cefathiamidine is a first-generation cephalosporin antibacterial agent and is used to treat infections caused by susceptible bacteria. Cefathiamidine exhibits a wide spectrum of antimicrobial activity against bacteria. Cefathiamidine is used for the treatment of respiratory, liver, five senses, urinary tract infections, endocarditis and sepsis[1][2].

  

• HY-107634

  CP-20961	35607-20-6	98.34%
  CP-20961 is an interferon inducer. CP-20961 is a potent synthetic non-immunogenic adjuvant that induces arthritis[1][2][3].

  

• HY-10846S

  Delamanid-d4		98.44%
  Delamanid-d4 is the deuterium labeled Delamanid. Delamanid, a newer mycobacterial cell wall synthesis  inhibitor, inhibits the synthesisi of mucolic acids[1].

  

• HY-108610

  (R)-Edelfosine	77286-66-9
  (R)-Edelfosine ((R)-ET-18-OCH3) is a ether lipid analog with anti-HIV and antineoplastic activity[1].

  

• HY-110159

  (E/Z)-Teriflunomide	108605-62-5
  (E/Z)-Teriflunomide ((E/Z)-A77 1726) is the active metabolite of Leflunomide (HY-B0083). Leflunomide is an immunomodulatory agent that may exert effects by inhibiting the mitochondrial enzyme dihydroorotate dehydrogenase (DHODH). Leflunomide can be used for the research of rheumatoid arthritis (RA)[1].

  

• HY-110248

  MI 14	1715934-43-2	99.30%
  MI 14 is a selective PI4KIIIβ inhibitor with IC50s of 54 nM, >100 μM, >100 μM for PI4KIIIβ, PI4KIIIα, PI4KIIα, respectively. MI 14 has antiviral activity against HCV 1b, CVB3, HRVM, HVC 2a[1].

  

• HY-111009

  Swinholide A	95927-67-6	98.30%
  Swinholide A is the actin-binding marine polyketide and dimerizes actin with the Kd of ~ 50 nM[1]. Swinholide A is a microfilament disrupting marine toxin that stabilizes actin dimers and severs actin filaments. Swinholide A disrupts the actin cytoskeleton of cells.Antifungal activity[2].

  

• HY-111529

  Tafenoquine	106635-80-7	99.77%
  Tafenoquine (WR 238605) is an 8-aminoquinoline. Tafenoquine is an anti-malarial prophylactic agent[1].

  

• HY-111817

  ACT-451840	1984890-99-4
  ACT-451840 is an orally active, potent and low-toxicity compound, showing activity against sensitive and resistant plasmodium falciparum strains. ACT-451840 targets all asexual blood stages of the parasite, has a rapid onset of action. ACT-451840 behaves in a way similar to artemisinin derivatives, with very rapid onset of action and elimination of parasite. ACT-451840 can be used for the research of malarial[1][2][3].

  

• HY-114548

  Ebselen oxide	104473-83-8
  Ebselen oxide, the selenone analogue of Ebselen, covalently modifies diguanylate cyclase (DGC) to inhibit c-di-GMP-receptor interactions and reduces DGC activity. Ebselen oxide also inhibits alginate production (IC50=14 μM) by Pseudomonas aeruginosa. Ebselen oxide inhibits HDAC1, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, and HDAC9 (IC50 ranging from 0.2 to 4.7 μM)[1][2][3].

  

• HY-114979

  Pyoluteorin	25683-07-2
  Pyoluteorin is an antibiotic that inhibits Oomycete fungi, including the plant pathogen Pythium ultimum, and suppresses plant diseases caused by this fungus[1]. Pyoluteorin induces human triple-negative breast cancer MDA-MB-231 cells apoptosis in vitro. Pyoluteorin can be used for the research of human triple-negative breast cancer[2].

  

• HY-115448

  Bio-AMS	1393881-52-1	98.29%
  Bio-AMS is a potent bacterial biotin protein ligase inhibitor. Bio-AMS possesses selective activity against Mycobacterium tuberculosis (Mtb) and arrests fatty acid and lipid biosynthesis[1][2].

  

• HY-115658

  VU0420373	38376-29-3	99.99%
  VU0420373 is a potent heme sensor system (HssRS) activator with an EC50 of 10.7 μM and a pEC50 of 4.97. VU0420373 induces heme biosynthesis, and is toxic to fermenting S. aureus[1].

  

• HY-116474

  Viridicatol	14484-44-7	99.93%
  Viridicatol, a quinolinone alkaloid, is isolated from the fermentation of an endophytic fungus Penicillium sp. R22 in Nerium indicum. Viridicatol has strong antifungal activity against Staphylococcus aureus with MIC value of 15.6 μg/mL[1].

  

• HY-116568

  Prothioconazole	178928-70-6	99.52%
  Prothioconazole is a triazolinthione fungicide. Prothioconazole is a CYP51 inhibitor[1].

  

• HY-116999

  IR415	452967-14-5	99.66%
  IR415 is a potent anti-HBV agent and inhibits HBV replication by blocking the HBx activity. IR415 selectively interacts with HBx (Kd=2 nM) and blocks HBV-mediated RNAi suppression, reverses the inhibitory effect of HBx protein on the activity of the dicer endoribonuclease[1]. HBx: hepatitis B virus X protein.

  

• HY-117386

  Methoxyfenozide	161050-58-4
  Methoxyfenozide is an orally active insecticide belonging to the diacylhydrazine and non-steroidal ecdysone agonist classes, which can interfere with the growth and development of insects. Methoxyfenozide has ovicidal and insecticidal activities against phytophagous pests[1][2].

  

• HY-119500

  Ilimaquinone	71678-03-0
  Ilimaquinone, a marine sponge metabolite, displays anticancer activity via GADD153-mediated pathway. Ilimaquinone can induce vesiculation of the Golgi apparatus[1]. Ilimaquinone exerts anti-HIV, anti-microbial, anti-inflammatory, and effects[2].

  

• HY-119630

  Propineb	12071-83-9
  Propineb (Zinc propylenebis) is a compound widely used in fruit and vegetables cultures, due to its large spectrum of activity against fungal plant diseases[1].

  

• HY-120338

  RYL-552	1801444-56-3	98.63%
  RYL-552, a mitochondrial electron transport chain (ETC) inhibitor, is a P. falciparum NADH dehydrogenase 2 (PfNDH2) inhibtor[1].

  

• HY-120838

  Heptelidic acid	57710-57-3
  Heptelidic acid (Koningic acid) is a sesquiterpene antibiotic[1]. Heptelidic acid inhibits Etoposide-induced apoptosis via downregulation of caspases[2]. Koningic acid (KA) is a specific GAPDH inhibitor with an IC50of 90 μM[3].

  

• HY-121368

  Mahanine	28360-49-8
  Mahanine is a carbazole alkaloid with various biological properties. Mahanine is a potent anticancer agent against different types of cancer cells. Mahanine exhibits antileishmanial activity and can be used for Leishmania infection research research.

  

• HY-123523

  Enocitabine	55726-47-1
  Enocitabine is a nucleoside analog, and is a potent DNA replication inhibitor, and a DNA chain terminator. Enocitabine inhibits the replication of human cytomegalovirus. Enocitabine has antileukemic and antiviral activities[1][2][3].

  

• HY-123805

  KIN1400	446826-86-4
  KIN1400 is a potent IRF3 activator. KIN1400 triggers IRF3-dependent innate immune antiviral genes (RIG-I, MDA5, IFIT1, and Mx1) and IFN-β expression. KIN1400 inhibits WNV and DV, two mosquito-borne members of the Flaviviridae and the genus Flavivirus. KIN1400 also inhibits HCV replication. KIN1400 induces innate antiviral immunity through a MAVS-IRF3 axis[1].

  

• HY-124781

  ML406	774589-47-8	99.05%
  ML406 is a small molecule probe that shows anti-tubercular activity via M.tuberculosis BioA (DAPA synthase) enzyme inhibition with an IC50 of 30 nM. M.tuberculosis BioA is an enzyme involved in biotin biosynthesis in M.tuberculosis[1].

  

• HY-124793

  GAK inhibitor 49	319492-82-5	98.79%
  GAK inhibitor 49 is a potent, ATP-competitive and highly selective cyclin G associated kinase (GAK) inhibitor with a Ki of 0.54 nM and a cell IC50 of 56 nM. GAK inhibitor 49 also shows binding to RIPK2[1].

  

• HY-126387

  Moenomycin complex	11015-37-5
  Moenomycin complex is a potent transglycosylase inhibitor. Moenomycin complex inhibits bacterial growth by blocking the transglycosylase activity of class A penicillin-binding proteins (PBPs)[1].

  

• HY-126970

  HBF-0259	957011-15-3	99.99%
  HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC50 of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBV DNA synthesis[1][2].

  

• HY-128429

  trans-​2-​Hexenal	6728-26-3
  trans-2-Hexenal ((E)-2-Hexenal) is a volatile compound widely present in fresh plants, vegetables, and fruits, with a unique leafy aroma. trans-2-Hexenal has antifungal activity and can also inhibit the germination of soybean seeds and the growth of seedlings. In addition, trans-2-Hexenal can be used to determine low-molecular-weight carbonyl compounds that are reactive with biological nucleophiles in biological samples[1][2][3][4].

  

• HY-129043

  3-Formyl rifamycin	13292-22-3	98.96%
  3-Formyl rifamycin is an intermediate of Rifampicin.

  

• HY-130838

  JH-LPH-33	2414590-04-6	98.29%
  JH-LPH-33, a sulfonyl piperazine analog, is a potent UDP-2,3-diacylglucosamine pyrophosphate hydrolase LpxH inhibitor. JH-LPH-33 displays outstanding antibiotic activity with a MIC value of 0.66 μg/mL[1].

  

• HY-131873

  Dynapyrazole-A	2226517-75-3	98.41%
  Dynapyrazole A is a specific inhibitor of microtubule dynamin that specifically inhibits the ATPase activity of microtubule-stimulated dynamin without blocking microtubule-independent basal activity[1].

  

• HY-134635

  Dehydrozingerone	1080-12-2	99.98%
  Dehydrozingerone (Compound 10), a structural half analogue of Curcumin (HY-N0005), is a phenolic compound with antibacterial, anticancer, antioxidant, anti-Alzheimer’s and antifungal activity, which is isolated from ginger (Zingiber officinale) rhizomes. Dehydrozingerone shows moderate inhibitory activities on the secretion of HBsAg in HepG 2 cells with an IC50 value of 0.50 mM[1][2][3].

  

• HY-134851

  HIV-1 inhibitor-6	1821309-39-0	99.10%
  HIV-1 inhibitor-6 (compound 9), a diheteroarylamide-based compound, is a potent HIV-1 pre-mRNA alternative splicing inhibitor. HIV-1 inhibitor-6 blocks HIV replication. HIV-1 inhibitor-6 is active against wild-type HIV-1IIIB (subtype B, X4-tropic) and HIV-1 97USSN54 (subtype A, R5-tropic) with EC50s of 0.6 μM and 0.9 μM, respectively. HIV-1 inhibitor-6 inhibits HIV strains resistant to agents targeting HIV reverse transcriptase, protease, integrase, and coreceptor CCR5 with EC50s ranging from 0.9 to 1.5 μM[1].

  

• HY-134900

  Allyl methyl trisulfide	34135-85-8
  Allyl methyl trisulfide is a volatile organic compound and a component of garlic (Allium sativum L.) essential oil, which has antibacterial, antioxidant and antitumor activities[1].

  

• HY-136063

  Mefentrifluconazole	1417782-03-6	99.61%
  Mefentrifluconazole is a novel azole derivative and used as an agrochemical broad-spectrum antifungal agent. Mefentrifluconazole is a potent, selective and orally active fungal CYP51 (Kd= 0.5 nM) inhibitor, but shows less inhibitory activity on human aromatase (IC50=0.92 μM)[1].

  

• HY-137242

  Ingenol-3-palmitate	52557-26-3	99.65%
  Ingenol-3-palmitate, an ingenane diterpenoid, is a nature product that could be isolated from the roots of Euphorbia ebracteolata. Ingenol-3-palmitate is a potent HIV-1 (HIV) inhibitor with an IC50 value of 4.1 nM[1].

  

• HY-138694

  5-Benzyloxygramine	1453-97-0	99.36%
  5-Benzyloxygramine is a N protein PPI orthosteric stabilizer that exhibits both antiviral and N-NTD protein-stabilizing activities[1].

  

• HY-138865

  BiCAPPA	119662-55-4	98.35%
  BiCAPPA is the first bivalent antiprion ligand. BiCAPPA can decrease infectious conformational form of prion protein (PrPSc) from scrapie-infected cells, with an EC50 of 0.32 μM[1][2].

  

• HY-145286

  IMPDH2-IN-2	1434517-02-8	99.73%
  IMPDH2-IN-2 is a potent inhibitor of inosine 5’-monophosphate dehydrogenase (IMPDH) with a Ki,app value of 14 μM, respectively. IMPDH2-IN-2 displays moderate antibacterial activity (MIC = 6.3 and 11 μM in minimal GAST/Fe and rich 7H9/ADC/Tween media, respectively). IMPDH2-IN-2 is a potential anti-tuberculosis agent[1].

  

• HY-146331

  PC190723	951120-33-5	98.34%
  PC190723 is a bacterial cell division protein FtsZ inhibitor with an IC50 of 55 ng/mL. PC190723 has bactericidal activity against B. subtilis and a variety of staphylococci, with MIC ranging from 0.5 and 1.0 μg/mL. PC190723 exerts antibacterial activity by enhancing FtsZ polymer assembly and inhibiting depolymerization[1][2][3].

  

• HY-146460

  Antimicrobial agent-2	2412592-33-5	99.38%
  Antimicrobial agent-2 (compound V-a) is a broad-spectrum antimicrobial agent, possessing inhibitory activity against various Gram-positive and -negative bacteria. Antimicrobial agent-2 has excellent inhibitory effect on Methicillin-resistant Staphylococcus aureus (MRSA) with a MIC of 1 μg/mL. Antimicrobial agent-2 can effectively damage the membrane and lead to the leakage of protein, also can induce the generation of ROS. Antimicrobial agent-2 exhibits low toxicity, no obvious resistance and good bioavailability[1].

  

• HY-14855A

  (S)-Tedizolid	1431699-67-0	98.21%
  (S)-Tedizolid is the S-enantiomer of Tedizolid. Tedizolid is a novel oxazolidinone with activity against Gram-positive pathogens. (S)-Tedizolid is the less active isomer.

  

• HY-150784

  XR8-89	2817811-16-6
  XR8-89 is a potent papain-like protease (PLpro) inhibitor with an IC50 value of 0.1 μM. XR8-89 induces conformational changes in SARS-COV-2 papain-like protease, inhibiting SARS-CoV-2 replication. XR8-89 can be used for SARS-CoV-2 research[1].

  

• HY-151482

  SARS-CoV-2 Mpro-IN-2	2768834-39-3	98.96%
  SARS-CoV-2 Mpro-IN-2 (compound GC-14) is a selective, low cytotoxic and non-covalent Mpro inhibitor (IC50=0.40 μM) with good anti-SARS-CoV-2 activity (EC50=1.1 μM). SARS-CoV-2 Mpro-IN-2 can be used in COVID-19 studies[1].

  

• HY-151561

  WM382	2606990-92-3	99.35%
  WM382 is an orally active and potent dual plasmepsin IX/X (PMIX/X) inhibitor with IC50 values of 1.4 nM and 0.03 nM, respectively. WM382 has robust in vivo efficacy at multiple stages of the malaria parasite life cycle and an excellent resistance profile[1][2][3].

  

• HY-153083

  COVID-19 Spike Protein mRNA(N1-Me-Pseudo UTP)
  COVID-19 Spike Protein mRNA will express COVID-19 spike protein, and suitable for detection of RNA delivery, translation efficiency, cell viability, etc. COVID-19 spike protein is the novel coronavirus pneumonia spike protein located on the membrane surface. COVID-19 spike protein undertakes the functions of virus binding to host cell membrane receptors and membrane fusion, thereby mediating the entry of COVID-19 virus into cells. COVID-19 spike protein is an important site of action for host neutralizing antibodies and a key target for vaccine design[1].

  

• HY-153351

  IpOHA	132418-03-2	98.58%
  IpOHA is a potent plant KARI inhibitor. IpOHA also is an antimycobacterial agent with a Ki value of 97.7 nM for Mycobacterium tuberculosis (Mt)[1].

  

• HY-158128

  MK-8527	1810869-23-8	99.02%
  MK-8527 is an orally active HIV inhibitor and nucleoside reverse transcriptase translocation inhibitor (NRTTI) with antiviral activity. MK-8527 has a similar inhibitory mechanism to ISL (HY-104012)[1][2][3][4].

  

• HY-162066

  DNDI-6174	2868298-43-3
  DNDI-6174 is a cytochrome bc1 complex inhibitor with potent in vitro activity against a variety of Leishmania species. DNDI-6174 can reduce parasite burden in animal models of infection[1].

  

• HY-16581A

  DL-threo-2-methylisocitrate sodium
  DL-threo-2-methylisocitrate sodium salt is a substrate of isocitrate lyase 1 (ICL1).

  

• HY-17450A

  Aplaviroc hydrochloride	461023-63-2	99.94%
  Aplaviroc (AK 602) hydrochloride, a SDP derivative, is a CCR5 antagonist, with IC50s of 0.1-0.4 nM for HIV-1Ba-L, HIV-1JRFL and HIV-1MOKW.

  

• HY-A0181S

  Adenosine monophosphate-13C10,15N5 dilithium
  Adenosine monophosphate-13C10,15N5(AMP-13C10,15N5) is the 13C-labeled and 15N-labeled Adenosine monophosphate (HY-A0181). Adenosine monophosphate is an adenosine A1 receptor agonist. Adenosine monophosphate has significant antiviral activity against HSV-1 and HSV-2. Adenosine monophosphate is a key cellular metabolite regulating energy homeostasis and signal transduction[1][2][3].

  

• HY-A0248B

  Polymyxin B2	34503-87-2
  Polymyxin B2 is a polypeptide antibiotic that has antibacterial activity, particularly against gram-negative bacteria. Polymyxin B2 kills the bacteria by binding to lipopolysaccharide molecules on the bacterial cell membrane, disrupting the integrity of the cell membrane and causing the cell contents to leak. Polymyxin B2 can be used in antibiotic development and treatment of drug-resistant strains[1].

  

• HY-B0117S

  Tigecycline-d9	2699607-86-6
  Tigecycline-d9 is deuterium labeled Tigecycline. Tigecycline (GAR-936) is a broad-spectrum glycylcycline antibiotic. The mean inhibitory concentration (MIC) of Tigecycline for E. coli (MG1655 strain) is approximately 125 ng/mL[1]. MIC50 and MIC90 are 1 and 2 mg/L for Acinetobacter baumannii (A. baumannii), respectively[2].

  

• HY-B0147A

  Pefloxacin mesylate	70458-95-6	99.73%
  Pefloxacin mesylate is a an antibacterial agent and prevents bacterial DNA replication by inhibiting DNA gyrase (topoisomerse) Target: DNA gyrase Pefloxacin is a synthetic chemotherapeutic agent used to treat severe and life-threatening bacterial infections.

  

• HY-B0988R

  Deferoxamine (mesylate) (Standard)	138-14-7
  Deferoxamine (mesylate) (Standard) is the analytical standard of Deferoxamine (mesylate). This product is intended for research and analytical applications. Deferoxamine mesylate (Deferoxamine B mesylate) is an iron chelator (binds to Fe(III) and many other metal cations), is widely used to reduce iron accumulation and deposition in tissues. Deferoxamine mesylate upregulates HIF-1α levels with good antioxidant activity. Deferoxamine mesylate also shows anti-proliferative activity, can induce apoptosis and autophagy in cancer cells. Deferoxamine mesylate can be used in studies of diabetes, neurodegenerative diseases as well as anti-cancer and anti-COVID-19[1][2][3][4][5].

  

• HY-B1149A

  Bacampicillin hydrochloride	37661-08-8	99.94%
  Bacampicillin hydrochloride is a penicillin antibiotic, is a prodrug of ampicillin with improved oral bioavailability.

  

• HY-B1620H

  Polyvinylpyrrolidone K90	9003-39-8
  Polyvinylpyrrolidone K90 can be used to prepare drug delivery systems, such as electrospun nanofibrous membranes. Polyvinylpyrrolidone K90 is widely used in human and veterinary medicine as an effective wound healing promoter and disinfectant when combined with iodine and other compounds. In addition, Polyvinylpyrrolidone K90 is also used to stabilize nanosuspensions, interact with the surface of drug crystals, and remain bound to the surface after drying[1][2][3].

  

• HY-B1743S

  Puromycin-d3		98.96%
  Puromycin-d3 is the deuterium labeled Puromycin. Puromycin dihydrochloride is the dihydrochloride salt of puromycin. Puromycin is an aminoglycoside antibiotic that inhibits protein synthesis.

  

• HY-B1777R

  Spermine (Standard)	71-44-3
  Spermine (Standard) is the analytical standard of Spermine. This product is intended for research and analytical applications. Spermine (NSC 268508) functions directly as a free radical scabenger to protect DNA from free radical attack. Spermine has antiviral effects.

  

• HY-B1794A

  Thiethylperazine dimaleate	1179-69-7	99.99%
  Thiethylperazine dimaleate, a phenothiazine derivate, is an orally active and potent dopamine D2-receptor and histamine H1-receptor antagonist. Thiethylperazine dimaleate is also a selective ABCC1activator that reduces amyloid-β (Aβ) load in mice. Thiethylperazine dimaleate has anti-emetic, antipsychotic and antimicrobial effects[1][2][3].

  

• HY-B1888B

  Bromfenac sodium hydrate	120638-55-3	99.94%
  Bromfenac sodium hydrate (Bromfenac monosodium salt sesquihydrate) is a potent and orally active inhibitor of COX, with IC50s of 5.56 and 7.45 nM for COX-1 and COX-2, respectively. Bromfenac sodium hydrate can be used in ocular inflammation research[1].

  

• HY-B2080A

  Etidocaine hydrochloride	36637-19-1
  Etidocaine (hydrochloride) is a long aminoamide local agent that can suppress or relieve pain[1].

  

• HY-E70056

  α2,3-Sialyltransferase, Pasteurella multocida (P-1059)	71124-51-1
  α2,3-Sialyltransferase, Pasteurella multocida (P-1059) (PmST1(M144D)), a sialyltransferase, can be isolated from Pasteurella multocida. alpha-2,3-Sialyltransferase (PmST1) can be converted into regioselective α2-6-sialyltransferase by saturation mutagenesis and regioselective screening[1].

  

• HY-N0005S

  Curcumin-d6	1246833-26-0	99.78%
  Curcumin-d6is a deuterium labeled Curcumin (Turmeric yellow). Curcumin (Turmeric yellow) is a natural phenolic compound with diverse pharmacologic effects including anti-inflammatory, antioxidant, antiproliferative and antiangiogenic activities. Curcumin is an inhibitor of p300 histone acetylatransferase (HATs) and also shows inhibitory effects on NF-κB and MAPKs.

  

• HY-N10113

  Verrucarin J	4643-58-7
  Verrucarin J (Muconomycin B) is a metabolite of the Myrothecium fungus family. Verrucarin J generates reactive oxygen species (ROS) and induces apoptosis of cancer cell lines, such as A549, HCT 116 and SW-620 cells. Verrucarin J shows activities against Candida albicans and Mucor miehei. Verrucarin J inhibits arenavirus Junin (JUNV) yield with an IC50 of 1.2 ng/mL[1][2][3][4][5].

  

• HY-N2384A

  Febrifugine dihydrochloride	32434-42-7	99.95%
  Febrifugine dihydrochloride is a quinazolinone alkaloid that inhibits P. falciparum and has antimalarial activity. Febrifugine dihydrochloride inhibits bladder cancer by inhibiting DNA synthesis, inducing apoptosis, and reducing steroids[1][2][3].

  

• HY-N5142S

  α-Terpineol-d3	203633-12-9	98.14%
  α-Terpineol-d3 is the deuterium labeled α-Terpineol[1]. α-Terpineol is isolated from Eucalyptus globulus Labill, exhibits strong antimicrobial activity against periodontopathic and cariogenic bacteria[2].α-Terpineol possesses antifungal activity against T. mentagrophytes, and the activity might lead to irreversible cellular disruption[2].

  

• HY-N7139B

  Penicillin G benzathine tetrahydrate	41372-02-5
  Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections[1].

  

• HY-N7395A

  Cyclic ADP-​ribose ammonium
  Cyclic ADP-ribose ammonium (cADPR ammonium) is a potent second messenger for calcium mobilization that is synthesized from NAD+ by an ADP-ribosyl cyclase. Cyclic ADP-ribose ammonium increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels[1][2][3].

  

• HY-P10415

  EPI-X4	930280-31-2	99.21%
  EPI-X4 (hSA408–423 peptide) is an antagonist for C-X-C motif chemokine receptor 4 (CXCR4) with IC50 of 8.6 μM. EPI-X4 blocks the CXCL12-mediated signaling, inhibits chemokine-mediated migration and invasion of leukemia cell. EPI-X4 exhibits anti-inflammatory activity in mouse model. EPI-X4 exhibits antiviral activity against CXCR4-tropic HIV with IC50 of 8.6 μM[1].

  

• HY-P1068A

  Recombinant human lysozyme (plant expression)	9001-63-2
  Recombinant human lysozyme (plant expression) is a conserved anti-bacterial protein that causes bacterial lysis and death by hydrolyzing bacterial cell wall peptidoglycan (PG). Recombinant human lysozyme (plant expression) can be used to study bacterial infections[1][2].

  

• HY-P1452A

  RNAIII-inhibiting peptide(TFA)	2703745-76-8	99.19%
  RNAIII-inhibiting peptide(TFA) is a potent inhibitor of Staphylococcus aureus, effective in the diseases such as cellulitis, keratitis, septic arthritis, osteomylitis and mastitis.

  

• HY-P3912A

  Endotoxin inhibitor TFA		99.77%
  Endotoxin inhibitor TFA is a synthetic peptide that binds lipid A with high affinity, thereby detoxifying LPS (HY-D1056) and preventing LPS-induced cytokine release in vivo. Endotoxin inhibitor TFA inhibits the febrile response to LPS with very low toxicity and lethality[1].

  

• HY-P99608

  Exbivirumab	569658-80-6
  Exbivirumab is an anti-HBV mAb. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG)[1].

  

• HY-P99750

  Navivumab	1443004-16-7	99.10%
  Navivumab (CT-P23) is an influenza A virus hemagglutinin HA monoclonal antibody. neutralizes H1, H2, H5, and H9 influenza A viruses by binding to the stem fusion domain in HA2[1].

  

• HY-P99832

  Cosfroviximab	1792982-57-0
  Cosfroviximab (c13C6-FR1) is a mouse/human chimeric monoclonal antibody against Ebola virus glycoprotein (EBOV-GP)[1].

  

• HY-P99889

  Romlusevimab	2509447-08-7
  Romlusevimab (BRII-198) is a neutralizing recombinant human IgG1 monoclonal antibody against the spike protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)[1][2].

  

• HY-P99919

  Efmarodocokin alfa	2247840-74-8
  Efmarodocokin alfa is a fusion protein of human IL-22 and the IgG4 crystallizable fragment. Efmarodocokin alfa activates IL-22 signaling. Efmarodocokin alfa can be used for the research of severe COVID-19 pneumonia[1].

  

• HY-Y0367S

  Maleic Acid-d2	24461-33-4	99.26%
  Maleic Acid-d2 is the deuterium labeled Maleic Acid[1]. Maleic Acid is a Glutamate Decarboxylase (GAD) inhibitor of E. coli and L. monocytogenes[2][3].

  

• HY-106991A

  Amustaline dihydrochloride	210584-54-6
  Amustaline (S-303) dihydrochloride, a nucleic acid-targeted alkylator, is an efficient pathogen inactivation agent for blood components containing red blood cells. Amustaline dihydrochloride has three components: an acridine anchor (an intercalator that targets nucleic acids non-covalently), an effector (a bis-alkylator group that reacts with nucleophiles), and a linker (a small flexible carbon chain containing a labile ester bond that hydrolyzes at neutral pH to yield non-reactive breakdown products)[1][2].

  

• HY-112861A

  Gln-AMS TFA		99.65%
  Gln-AMS (TFA) is a type Ia aminoacyl-tRNA synthetase (AARS) inhibitor. Gln-AMS inhibits glutaminyl-tRNA synthetase (GlnRS) with a Ki of 1.32 µM.

  

• HY-116364B

  AZT triphosphate tetraammonium	106060-92-8	99.45%
  AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) tetraammonium is an active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate tetraammonium exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate tetraammonium also inhibits the DNA polymerase of HBV. AZT triphosphate tetraammonium activates the mitochondria-mediated apoptosis pathway[1][2][3].

  

• HY-155583A

  RNase L-IN-1 trihydrochloride		99.56%
  RNase L-IN-1 (compound 17a) trihydrochloride is an inhibitor of RNase L or ribonuclease L. RNase L degrades RNA to prevent viral replication and mediates innate immune responses and inflammation[1].

  

• HY-B0803S1

  Lumefantrine-d9	2477594-24-2
  Lumefantrine-d9 is the deuterium labeled Lumefantrine. Lumefantrine is an antimalarial drug, used in combination with Artemether. The artemether-lumefantrine (AL) as the first- and second-line anti-malarial drugs.

  

• HY-D0186S7

  2'-Deoxyuridine-13C,15N2	369656-76-8	98.08%
  2'-Deoxyuridine-13C,15N2 is the 13C and 15N labeled 2'-Deoxyuridine[1]. 2'-Deoxyuridine could increase chromosome breakage and results in a decreased thymidylate synthetase activity. A known use of 2'-Deoxyuridine is as a precursor in the synthesis of Edoxudine[2].

  

• HY-N0470S5

  L-Lysine-d9 hydrochloride	2708343-64-8
  L-Lysine-d9 (hydrochloride) is the deuterium labeled L-Lysine. L-lysine hydrochloride is an essential amino acid for humans with various benefits including treating herpes, increasing calcium absorption, reducing diabetes-related illnesses and improving gut health.

  

• HY-N125722

  Venturicidin A	33538-71-5
  Venturicidin A (Aabomycin A1), from actinomycetes, is a membrane-active natural product inhibitor of ATP synthase. Venturicidin A potentiates the aminoglycoside antibiotic gentamicin against multidrug-resistant clinical isolates of Staphylococcus, Enterococcus, and Pseudomonas aeruginosa. Venturicidin A shows noticeable toxicity toward human embryonic-kidney (HEK)cells with an IC50 of 31 μg/mL.

  

• HY-W001957

  Glurate	3128-06-1
  Glurate (4-Acetylbutyric acid) is an acylating agent. Glurate can be used in the development of antiviral compounds, especially those targeting retroviruses such as herpes virus and HIV. Glurate can be used in the synthesis of acyclic nucleoside derivatives and 5-hydroxyhexanoic acid[1][2].

  

• HY-W004292

  1-Undecanol	112-42-5
  1-Undecanol (Undecyl alcohol) is the main product generated from the degradation of 2-tridecanone by Pseudomonas bacteria isolated from the soil. 1-Undecanol can enhance the attraction of Grapholita molesta to sex pheromone traps[1][2].

  

• HY-W008129

  H-D-cis-Hyp-OH	2584-71-6
  H-D-cis-Hyp-OH (cis-4-Hydroxy-D-proline) is a proline derivative involved in bacterial metabolic pathways and is a substrate for cis-4-hydroxy-D-proline dehydrogenase. H-D-cis-Hyp-OH is a precursor for the synthesis of conformationally constrained PNA adenine monomers and can be used to study the specificity and kinetics of D-alanine dehydrogenase[1][2].

  

• HY-W009350

  Diazolidinyl urea	78491-02-8
  Diazolidinyl urea, a broad spectrum preservative, is a formaldehyde-releasing compound that releases formaldehyde through its decomposition. Diazolidinyl urea is effective against most contaminating microorganisms, especially Pseudomonas[1][2].

  

• HY-W012126

  2,6-Dichlorodiphenylamine	15307-93-4	99.71%
  2,6-Dichlorodiphenylamine is an analogue of Diclofenac Sodium (HY-15037) and has anti-Candida albicans activity. Diclofenac Sodium is a potent and nonselective anti-inflammatory agent, acts as a COX inhibitor, with IC50s of 4 and 1.3 nM for human COX-1 and COX-2 in CHO cells.

  

• HY-W012313

  2,2'-Anhydrouridine	3736-77-4
  2,2'-Anhydrouridine is used for anticancer and antiviral research[1].

  

• HY-W012941

  2-Thiophenecarboxaldehyde	98-03-3
  2-Thiophenecarboxaldehyde (Thiophene-2-carboxaldehyde) is an antibiotic that exhibits antibacterial and nematicidal activities[1][2].

  

• HY-W014394

  Vanillyl butyl ether	82654-98-6	99.67%
  Vanillyl butyl ether is a major contributor to the characteristic flavor and fragrance of vanilla. Vanillyl butyl ether is one of the eco-friendly and nontoxic substances. Vanillyl butyl ether exhibits mutually inhibitory effects on mammalian TRPV1 and TRPM8 channels. Vanillyl butyl ether shows repellency activity against Tribolium castaneum, T. confusum and L. bostrychophila. Vanillyl butyl ether acts as a mild warming agent, providing a warming sensation and enhancing blood circulation[1][2][3].

  

• HY-W015786

  4-Ethoxyphenol	622-62-8	99.86%
  4-Ethoxyphenol is a natural compound isolated from marine gorgonian-associated bacterium Bacillus amyloliquefaciens SCSIO 00856. 4-Ethoxyphenol shows potent antilarval activity towards Bacillus amphitrite larvae with an EC50 value of 24.1 μg/mL[1].

  

• HY-W018800

  4(3H)-Quinazolinone	491-36-1
  4(3H)-Quinazolinone is a fused nitrogen heterocyclic compound whose derivatives have a wide range of antimicrobial and antitumor activities[1][2][3].

  

• HY-W019806

  Lacto-N-fucopentaose I	7578-25-8
  Lacto-N-fucopentaose I (LNFPI) is a human milk oligosaccharide (HMO), possessing antiviral and antibacterial activity. Lacto-N-fucopentaose I can reduce capsid protein VP1 to block virus adsorption, promote CDK2 and reduce cyclin E to recover cell cycle S phase block. Lacto-N-fucopentaose I inhibits ROS production and apoptosis in virus-infected cells. Lacto-N-fucopentaose I can also regulate intestinal microbiota to affect immune system development[1].

  

• HY-W020777

  Triflumizole	68694-11-1
  Triflumizole is one of imidazole fungicides that works by inhibiting ergosterol biosynthesis, and is widely used for the control of powdery mildew and scabs on various fruits and crops[1].

  

• HY-W028047

  JFD01307SC	51070-56-5
  JFD01307SC is a glutamine synthetase inhibitor and anti-tuberculosis agent. JFD01307SC acts as a mimic of L-Glutamate and thus target enzymes involved in glutamine biosynthesis[1].

  

• HY-W042181

  N-Decyl-N,N-dimethyldecan-1-aminium chloride	7173-51-5
  N-Decyl-N,N-dimethyldecan-1-aminium chloride (Didecyldimethylammonium chloride) is a dialkyl-quaternary ammonium compound that is used in numerous products for its bactericidal, virucidal and fungicidal properties[1].

  

• HY-W045071

  N-Hexanoyl-DL-homoserine lactone	106983-28-2
  N-Hexanoyl-DL-homoserine lactone is a bacterial quorum sensing molecule produced in the rhizosphere. N-Hexanoyl-DL-homoserine lactone, a bacterial quorum sensing signal, induces transcriptional changes in Arabidopsis and may contribute to tuning plant growth to the microbial composition of the rhizosphere[1].

  

• HY-W089845

  Heneicosane	629-94-7
  Heneicosane is a royal-specific pheromone of insects (such as subterranean termites) and is an identification signal for queens and kings in termites. Heneicosane mediates royal recognition and the maintenance of social division of labor by being sensed by worker ants and triggering vibrations and antennal behaviors. Heneicosane can exert anti-inflammatory, analgesic and antipyretic activities by inhibiting the release of inflammatory mediators (such as prostaglandins and cytokines). At the same time, Heneicosane can also inhibit the mycelial growth of aflatoxin-producing fungi and inhibit the production of aflatoxin. Heneicosane can be used in insect chemical ecology research to analyze the regulatory mechanism of termite social behavior, and is also a potential target for new anti-inflammatory drugs[1][2][3][4].

  

• HY-W131282

  Antimalarial agent 39	5407-57-8
  Antimalarial agent 39 (compound 1) is an intermediate in the synthesis of antimalarial agents[1].

  

• HY-W436424

  DAM-IN-1	935279-95-1
  DMA-IN-1 is a DNA adenine methyltransferase (DAM) inhibitor, IC50: 48 μM. DMA-IN-1 inhibits Caulobacter growth with an MIC of 35 μM[1].

  

• HY-W587663

  4′-DTMP	21253-58-7
  4 '-DTMP is a DHFR inhibitor with Ki of 5.1 nM (DHFRWT) and 34.3 nM (DHFRL28R), respectively. 4 '-DTMP carries a polar modification that induces additional local interactions with the enzyme. In particular, the hairpin structure on the M20 ring is related to the internal communication of the DHFR. 4 '-DTMP has potential inhibition of E.coli[1].

  

• HY-Y1093S4

  Ethyl acetoacetate-d3	1565868-21-4
  Ethyl acetoacetate-d3 is the deuterium labeled Ethyl acetoacetate. Ethyl acetoacetate (Ethyl acetylacetate) is an ester widely used as an intermediate in the synthesis of many varieties of compounds[1][2][3]. Ethyl acetoacetate is an inhibitor of bacterial biofilm[4].

  

• HY-W016819B

  5-Fluoroorotic acid monohydrate	220141-70-8
  5-Fluoroorotic acid monohydrate is the monohydrate salt form of 5-Fluoroorotic acid (HY-W016819). 5-Fluoroorotic acid monohydrate is the inhibitor for thymidylate synthase that acts as a selective agent in yeast molecular genetics. 5-Fluoroorotic acid monohydrate exhibits antimalarial activity[1][2][3].

  

• HY-15537

  Tilbroquinol	7175-09-9	98.02%
  Tilbroquinol is an orally active antiparasite agent, can be used in study of amoebiasis. tilbroquinol is also used against Vibrio cholera[1].

  

• HY-17599

  Piperazine citrate	144-29-6
  Piperazine (1,4-Diazacyclohexane) citrate is a gamma-aminobutyric acid (GABA) agonist[1]. Piperazine citrate is a vital building block and is an essential core in numerous marketed agents with diverse pharmacological activities[2].

  

• HY-60346

  2-Pyrimidinecarboxylic acid	31519-62-7	99.27%
  2-Pyrimidinecarboxylic acid is a synthetic intermediate useful for pharmaceutical synthesis[1].

  

• HY-A0071

  Tildipirosin	328898-40-4	99.81%
  Tildipirosin, a long-acting macrolide, has antibiotic activity.

  

• HY-B0222

  1-Docosanol	661-19-8
  1-Docosanol (Behenyl alcohol) is a saturated fatty alcohol with reported inhibitory activity against lipid-enveloped viruses, including herpes simplex virus (HSV)[1][2].

  

• HY-B0825

  (E)-Fenpyroximate	134098-61-6	99.81%
  (E)-Fenpyroximate is a potent acaricide[1].

  

• HY-B1036

  Decoquinate	18507-89-6	99.26%
  Decoquinate is an orally active, selective inhibitor of the mitochondrial bc1 complex, targeting Eimeria spp. sporozoites and first generation schizonts, and Plasmodium spp. Decoquinate inhibits electron transfer by competitively binding to the mitochondrial cytochrome b system, blocking the parasite's energy metabolism, thereby inhibiting its development and reproduction. Decoquinate has significant anticoccidial activity, preventing intestinal damage and improving host growth performance, and also has inhibitory effects on the liver and blood stages of Plasmodium. Decoquinate is mainly used in veterinary research to prevent and treat coccidiosis in ruminants and poultry[1][2][3].

  

• HY-B1072

  Phenothrin	26002-80-2
  Phenothrin is a synthetic pyrethroid that kills adult fleas and ticks.

  

• HY-B1094

  Aklomide	3011-89-0
  Aklomide is used to fight disease, parasites and insects that infest poultry.

  

• HY-B1133

  Sulbentine	350-12-9	99.37%
  Sulbentine (Dibenzthione) is an azole antifungal agent that has fungistatic and fungicidal activities. Sulbentine is used as a locally acting antimycotic in vivo[1][2].

  

• HY-B2015

  Carbosulfan	55285-14-8
  Carbosulfan inhibited relatively potently CYP3A4 and moderately CYP1A1/2 and CYP2C19 in pooled HLM (human livers).

  

• HY-B2053

  Tolclofos-methyl	57018-04-9	98.68%
  Tolclofos-methyl is a broad-spectrum aromatic hydrocarbon fungicide that is used as a see treatment for protection against soil-borne and seed borne fungal pathogens that caused seed decay and seedling blights.

  

• HY-B2063

  Chlorobenzuron	57160-47-1	99.50%
  Chlorobenzuron is a chitin synthetase inhibitor, acts as an insecticide. Chlorobenzuron can inhibit larvae development and pupate[1].

  

• HY-N0854

  Alisol F	155521-45-2
  Alisol F is a triterpene isolated from Alisma orinentale, has immunosuppressive and anti-virus functions. Alisol F exhibits inhibitory activity in vitro on hepatitis B virus (HBV) surface antigen (HBsAg) secretion of the HepG2.2.15 cell line with an IC50 of 0.6 μM[1].

  

• HY-N0903

  Dihydrochelerythrine	6880-91-7	99.39%
  Dihydrochelerythrine is a natural compound isolated from Corydalis yanhusuo; has antifungal activity.

  

• HY-N1103

  Vasicine	6159-55-3
  Vasicine (peganine) is a quinazoline alkaloid isolated from Justicia adhatoda. Vasicine activates PI3K/Akt signaling pathway, exhibits antioxidant, anti-inflammatory and antibacterial activities[1][2][3].

  

• HY-P1633

  Protegrin-1	168831-77-4	99.55%
  Protegrin-1 is an orally active antibacterial peptide. Protegrin-1 activates ERK, COX2, NFκB, inhibits Apoptosis, and NO production. Protegrin-1 has antibacterial activity against S. aureus, E. faecium, E. coli, P. aeruginosa and K. Pneumoniae, with MBC values between 10 and 20 µM. Protegrin-1 has antiviral activity against dengue NS2B-NS3. Protegrin-1 has anti-inflammatory activity. Protegrin-1 is used in the study of inflammatory diseases and infections[1][2][3][4][5][6][7][8].

  

• HY-113784

  Thiocarlide	910-86-1
  Thiocarlide is a potent antibacterial agent. Thiocarlide inhibits Mycobacterium tuberculosis H37Rv, Mycobacterium bovisBCG, Mycobacterium avium, and Mycobacterium aurum A+ with MICs of 2.5, 0.5, 2.0 and 2.0 μg/mL, respectively[1].

  

• HY-114591

  Spiromesifen	283594-90-1
  Spiromesifen (BSN 2060) is a broad-spectrum tetrachloro acid derivative acaricide. Spiromesifen reduces lipid biosynthesis via inhibition of acetyl-CoA carboxylase, and has no cross-resistance to any resistant mite or whitefly populations[1].

  

• HY-120097

  R-10015	2097938-51-5	99.72%
  R-10015, a broad-spectrum antiviral compound for HIV infection, acts as a potent and selective inhibitor of LIM domain kinase (LIMK) and binds to the ATP-binding pocket, with an IC50 of 38 nM for human LIMK1[1].

  

• HY-126818

  Desfuroylceftiofur	120882-22-6
  Desfuroylceftiofur is an active metabolite of Ceftiofur which is a broad-spectrum cephalosporin antibiotic. Desfuroylceftiofur is active against gram-positive and gram-negative bacteria[1][2].

  

• HY-132823

  Ledaborbactam	1842397-36-7	99.12%
  Iedaborbactam (VNRX-5236), as a β-lactamase inhibitor (WO2015191907, Example 62), can be used for the research of bacterial infections[1].

  

• HY-139663

  IHVR-17028	1428247-78-2	99.61%
  IHVR-17028 is a potent and broad-spectrum antiviral agent. IHVR-17028 exhibits antiviral activity against BVDV, TCRV and DENV with EC50 values of 0.4 μM, 0.26 μM, 0.3 μM, respectively. IHVR-17028 is a potent ER α-glucosidase I inhibitor with an IC50 of 0.24 μM. IHVR-17028 can be used for infectious diseases research[1][2].

  

• HY-147241

  Alpibectir	2285440-39-1	99.81%
  Alpibectir is an antibacterial agent[1].

  

• HY-148493

  MK-3402	2058151-78-1	99.96%
  MK-3402 (Compound303) is a metallo-beta-lactamase inhibitor, with IC50 values of 0.53, 0.25 and 0.169 nM against IMP-1, NDM-1, and VIM-1, respectively. MK-3402 can be used in bacterial research and shows a synergistic effect when used in combination with beta-lactam antibiotics[1].

  

• HY-15602B

  Ledipasvir D-tartrate	1502654-87-6	98.76%
  Ledipasvir D-tartrate is an inhibitor of the hepatitis C virus NS5A, with EC50 values of 34 pM against GT1a and 4 pM against GT1b replicon.

  

• HY-160519

  Targocil-II	955918-74-8	98.92%
  Targocil-II (Compound 2) is an ABC transporter inhibitor with a IC50 value of 137 nM. Targocil-II prevents ATP hydrolysis by binding to allosteric sites of the TM domain. Targocil-II has (antibacterial) activity[1].

  

• HY-17460A

  Garenoxacin Mesylate hydrate	223652-90-2	99.78%
  Garenoxacin (BMS284756) Mesylate hydrate is an orally active quinolone antibiotic and has a broad spectrum of activity against a wide array of gram-positive and gram-negative bacteria, anaerobes, and fastidious organisms[1].

  

• HY-B0215S

  Acetylcysteine-d3	131685-11-5
  Acetylcysteine-d3 is the deuterium labeled Acetylcysteine. Acetylcysteine (N-Acetylcysteine) is a mucolytic agent which reduces the thickness of the mucus. Acetylcysteine is a ROS inhibitor. Acetylcysteine is a cysteine precursor, prevents hemin-induced ferroptosis by neutralizing toxic lipids generated by arachidonate-dependent activity of 5-lipoxygenases. Acetylcysteine induces cell apoptosis. Acetylcysteine also has anti-influenza virus activities. In addition, Acetylcysteine is the most stable form of cysteine during drug delivery and can be used in disulfidptosis studies[1][2][3][4][5][6][7][8].

  

• HY-B1596A

  Ceftizoxime sodium	68401-82-1	99.77%
  Ceftizoxime sodium (SKF-88373) is third generation cephalosporin effective against Gram-negative and Gram-positive bacteria. It binds penicillin-binding proteins (PBPs) and inhibits the bacterial cell wall synthesis.

  

• HY-N0113B

  Hordenine hydrochloride	6027-23-2	99.82%
  Hordenine (hydrochloride), an alkaloid found in plants, inhibits melanogenesis by suppression of cyclic adenosine monophosphate (cAMP) production[1].

  

• HY-N1214R

  Squalene (Standard)	111-02-4
  Squalene (Standard) is the analytical standard of Squalene. This product is intended for research and analytical applications. Squalene (Super Squalene) is an intermediate product in the synthesis of cholesterol, and shows several pharmacological properties such as hypolipidemic, hepatoprotective, antiatherosclerotic, cardioprotective, antioxidant, and antitumour activity[1][2].

  

• HY-N12851

  4-OHE	2492-43-5
  4-OHE ((E)-4-Oxo-2-hexenal) is a mutagen formed by the peroxidation of omega-3 fats. 4-OHE has antibacterial activity[1][2].

  

• HY-U00092

  BAY-Y 3118	151213-16-0	99.22%
  BAY-Y 3118 is a new chlorofluoroquinolone with antimicrobial activity.

  

• HY-U00128

  PPA-904	30189-85-6	99.31%
  PPA-904 is a specific phenothiazine photosensitizer in photodynamic research (PDT) research, especially topical application for cutaneous leishmaniasis in vivo[1][2].

  

• HY-U00249

  Saperconazole	110588-57-3	99.35%
  Saperconazole (R66905) is a broad-spectrum antifungal triazole and has potent activity against Aspergillus with an MIC90 of 0.19 mg/L.

  

• HY-N0097S4

  Guanosine-13C10
  Guanosine-13C10 is the 13C labeled Guanosine (HY-N0097). Guanosine is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine possesses anti-HSV activity[1].

  

• HY-W001663

  4'-Hydroxy-3'-methylacetophenone	876-02-8	99.96%
  4'-Hydroxy-3'-methylacetophenone, a phenolic volatile compound, is isolated from Hawaiian green coffee beans (Coffea Arabica L.). 4'-Hydroxy-3'-methylacetophenone has potent antioxidant activities. 4'-Hydroxy-3'-methylacetophenone also can be used to synthesize heterocyclic compounds which have antimycobacterial activity[1][2].

  

• HY-W004570

  5-Nitro-1,10-phenanthroline	4199-88-6	99.88%
  5-Nitro-1,10-phenanthroline (5-NP), is a o-Phenanthroline (HY-W004544) derivative, as a mediator of glucose oxidase (GOX) with antituberculous activity. 5-Nitro-1,10-phenanthroline can be applied as redox mediators for oxidases and is suitable for the development of reagent-less biosensors and biofuel cells[1][1].

  

• HY-W012267

  2-Bromo-2'-methoxyacetophenone	31949-21-0
  2-Bromo-2'-methoxyacetophenone is an irreversible inhibitor for MurA, that inhibits MurA in E. coli with an IC50 of 0.38 μM. 2-Bromo-2'-methoxyacetophenone can be used in antibacterial research for blocking bacterial cell wall synthesis[1].

  

• HY-W012634

  Benzothiazole	95-16-9
  Benzothiazole is a natural occurring heterocyclic nuclei. Benzothiazole nucleus possesses a number of biological activities such as anticancer, antimicrobial, antidiabetic, anti-inflammatory, antileishmanial, and antiviral. Furthermore, Benzothiazole nucleus can function as an efficacious β-amyloid imaging agent[1][2][3][4].

  

• HY-W015399

  4-Methylcinnamic acid	1866-39-3	99.63%
  4-Methylcinnamic acid, a Cinnamic acid analog, can be used as a intervention catalyst for overcoming antifungal tolerance. 4-Methylcinnamic acid can improve the potency of cell wall-disrupting agents[1].

  

• HY-W041343

  4-Benzoylbenzoic acid	611-95-0	98.95%
  4-(Phenylcarbonyl)benzoic acid is a photooxidant. Upon light activation, 4-(Phenylcarbonyl)benzoic acid forms an electrophilic aromatic ketone that acts as an oxidant in organic synthesis or biological systems. 4-(Phenylcarbonyl)benzoic acid has been used in the study of amino acid oxidation, as well as the synthesis of photoactivated antibacterial and antiviral compounds123.

  

• HY-W150677

  BioA-IN-1	77820-11-2	99.24%
  BioA-IN-1 (Compound 15) is an inhibitor of BioA, a key enzyme in the biotin synthesis pathway of Mycobacterium tuberculosis, with an IC50 value of 0.195 μM. BioA-IN-1 exhibits antibacterial activity but has no cytotoxicity[1].

  

• HY-W017162R

  DL-3-Phenyllactic acid (Standard)	828-01-3
  DL-3-Phenyllactic acid (Standard) is the analytical standard of DL-3-Phenyllactic acid. This product is intended for research and analytical applications. DL-3-Phenyllactic acid is a broad-spectrum antimicrobial compound.

  

• HY-13321

  Anguizole	442666-98-0	99.53%
  Anguizole is a small molecule inhibitor of HCV replication and alters NS4B's subcellular distribution.

  

• HY-13740S

  Resiquimod-d5	2252319-44-9	99.84%
  Resiquimod-d5 is deuterium labeled Resiquimod. Resiquimod is a Toll-like receptor 7 and 8 (TLR7/TLR8) agonist that induces the upregulation of cytokines such as TNF-α, IL-6 and IFN-α[1][2].

  

• HY-17589AS

  Chloroquine-d5	1854126-41-2
  Chloroquine-d5 is deuterium labeled Chloroquine (HY-17589A). Chloroquine is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].

  

• HY-W008923

  Doxycycline monohydrate	17086-28-1
  Doxycycline monohydrate is an antibiotic and broad-spectrum metalloproteinase (MMP) inhibitor[1][2][3][4].

  

• HY-Y0248AS

  (E,​E)​-​Farnesol-d6	166447-71-8	98.56%
  (E,​E)​-​Farnesol-d6 is deuterium labeled Farnesol. Farnesol is a sesquiterpene alcohol that modulates cell-to-cell communication in Candida albicans, and has the activity in inhibiting bacteria.

  

• HY-19447

  Besifovir	441785-25-7
  Besifovir (LB80331), a parent agent converted by LB80380 (HY-19447A), further metabolizes to its active form, LB80317 (HY-106235). Besifovir is an orally active, novel antiviral agent against hepatitis B virus (HBV)[1][2].

  

• HY-19558

  IDX184	1036915-08-8	99.80%
  IDX184 is a potent and orally bioavailable inhibitor of HCV replication. IDX184 potently inhibits HCV polymerase (IC50=0.31 μM, Ki=52.3 nM)[1][2].

  

• HY-P2292

  Omiganan, FITC labeled		98.29%
  Omiganan, FITC labeled is a peptide-FITC complex composed of Omiganan and a FITC. Omiganan is a bactericidal and fungicidal cationic peptide being developed as a topical gel for prevention of catheter-associated infections. FITC is a derivative of fluorescein for the labeling of amines[1].

  

• HY-100531

  DprE1-IN-2	1615713-87-5	99.59%
  DprE1-IN-2 (compound 18) is a potent DprE1 inhibitor with an IC50 of 28 nM. DprE1-IN-2 has antituberculosis effect[1].

  

• HY-101866

  KKL-35	865285-29-6	99.47%
  KKL-35 is a trans-translation tagging reaction inhibitor with an IC50 of 0.9 μM.

  

• HY-111759

  Jaspamycin	22242-96-2	98.60%
  Jaspamycin (7-CN-7-C-Ino) is a potent activator of PKA, binding to the R site (PKAR), with an EC50 of 6.5 nM and Kd of 8 nM in Trypanosoma brucei. Jaspamycin (7-CN-7-C-Ino) does not bind with purified human PKARIα. Anti-parasite activity[1].

  

• HY-120478

  ASP6432	1282549-08-9
  ASP6432 is a potent and selective type 1 lysophosphatidic acid receptor (LPA1) antagonist with IC50s of 11 nM and 30 nM for human LPA1 and rat LPA1, respectively[1].

  

• HY-123561

  MMV008138	1679333-73-3	98.49%
  MMV008138 is a species-selective IspD (enzyme 2-C-methyl-d-erythritol 4-phosphate cytidylyltransferase)-targeting antimalarial agent, with an IC50 of 44 nM for PfIspD (P. falciparum IspD). MMV008138 inhibits the growth of P. falciparum Dd2 strain with an IC50 of 250 nM[1][2].

  

• HY-128866

  TBAJ-876	2332841-25-3
  TBAJ-876 is the inhibitor of mycobacterium tuberculosis. TBAJ-876 is the analogue of the anti-tuberculosis agent Bedaquiline. TBAJ-876 has the potential for the research of tuberculosis[1].

  

• HY-137453

  Tenofovir amibufenamide	1571076-26-0	99.67%
  Tenofovir amibufenamide (HS-10234), a Tenofovir prodrug, is an orally active antiviral agent. Tenofovir amibufenamide inhibits HBV, and can be used for chronic hepatitis B (CHB) study[1][2].

  

• HY-144300

  Rifasutenizol	1001314-13-1	99.53%
  Rifasutenizol (TNP-2198) is a dual-targeted antibacterial agent that has a good antibacterial effect on Helicobacter pylori infection. Rifasutenizol can be used in the study of microaerophilic and anaerobic bacterial infections[1].

  

• HY-144645

  SP-471P	2768011-36-3	99.46%
  SP-471P is a potent dengue virus (DENV) protease inhibitor with EC50s of 5.9 μM, 1.4 μM, 5.1 μM and 1.7 μM for DENV1, DENV2, DENV3 and DENV4, respectively and CC50 value over 100 μM. SP-471P can reduce DENV viral RNA synthesis[1].

  

• HY-124618A

  FGI-106 tetrahydrochloride	1149348-10-6	99.68%
  FGI-106 tetrahydrochloride is a potent and broad-spectrum inhibitor with inhibitory activity against multiple viruses. FGI-106 tetrahydrochloride is active against Ebola, Rift Valley and Dengue Fever viruses with EC50s of 100 nM, 800 nM and 400-900 nM, respectively. FGI-106 tetrahydrochloride also inhibits non-hemorrhagic fever viruses HCV and HIV-1 with EC50s of 200 nM and 150 nM, respectively[1].

  

• HY-133735A

  GRP-60367 hydrochloride	2803211-60-9	99.41%
  GRP-60367 hydrochloride is a first-in-class small-molecule rabies virus (RABV) entry inhibitor with nanomolar potency against some RABV strains. GRP-60367 hydrochloride specifically targets the RABV G protein[1].

  

• HY-135811A

  Desethyl chloroquine diphosphate	247912-76-1	99.72%
  Desethyl chloroquine diphosphate is a major desethyl metabolite of Chloroquine. Chloroquine diphosphate is an inhibitor of autophagy and toll-like receptors (TLRs). Desethyl chloroquine diphosphate possesses antiplasmodic activity[1][2].

  

• HY-B0458

  Cefprozil monohydrate	121123-17-9	99.82%
  Cefprozil monohydrate is a second-generation cephalosporin type antibiotic. Cefprozil monohydrate exhibits broad-spectrum antibacterial activity, and is orally active. Cefprozil monohydrate can be used for the study of pharyngitis, tonsillitis, otitis media, and uncomplicated skin infections[1][2].

  

• HY-112714

  GSK3532795	1392312-45-6
  GSK3532795 (BMS-955176) is a potent, orally active, second-generation HIV-1 maturation inhibitor, with EC50s of 1.9, 10.2, 2.7 and 13 nM for HIV-1 WT, HIV-1 WT(human serum), HIV-1 V370A, and HIV-1 ΔV370, respectively[1].

  

• HY-127102

  GSK3494245	2080410-41-7	98.56%
  GSK3494245 (DDD01305143) is a potent, orally active, and selective inhibitor of the chymotrypsin-like activity of the parasite proteasome binding in a site sandwiched between the β4 and β5 subunits (IC50=0.16 μM for WT L. donovani proteasomes). GSK3494245 moderately inhibits chymotrypsin-like activity of human proteasome (IC50: purified 26S=13 µM; enriched THP-1 extracts IC50=40µM). GSK3494245 exhibits attractive biological and biosafety properties[1][2].

  

• HY-132170

  DSM502	2426616-55-7	99.74%
  DSM502 is a pyrrole-based Dihydroorotate Dehydrogenase (DHODH) inhibitor. DSM502 exhibits nanomolar potency againsts Plasmodium DHODH and Plasmodium parasites, with no inhibition of mammalian DHODHs[1].

  

• HY-139398

  TBI-223	2071265-08-0	99.73%
  TBI-223 is an orally bioavailable oxazolidinone antibiotic and an antimicrobial. TBI-223 shows activity against Mycobacterium tuberculosis (Mtb)[1][2].

  

• HY-147263

  Dovramilast	340019-69-4	99.83%
  Dovramilast (CC-11050) is an orally active phosphodiesterase 4 (PDE4) inhibitor and can reduce the inflammatory response and improves Isoniazid (INH)-mediated bacillary clearance from the lungs. Dovramilast, as an adjunct, is used for the research of tuberculosis (TB)[1].

  

• HY-147358

  Yimitasvir diphosphate	1959593-63-5	98.09%
  Yimitasvir (Emitasvir) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection[1].

  

• HY-147411

  Ulonivirine	1591823-76-5	98.31%
  Ulonivirine (MK-8507) is an orally active non-nucleoside reverse transcriptase inhibitor with high antiviral activity. Ulonivirine can be used for the research of HIV-1 infection[1][2][3][4].

  

• HY-148191

  CL-197	1030595-07-3	99.32%
  CL-197 is an orally active and long-acting purine anti-HIV nucleoside reverse transcriptase inhibitor (NRTI). CL-197 has potential effect on the research of viral, oncological and cerebrovascular diseases[1]. CL-197 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-156685

  EDI048	2767264-57-1	99.86%
  EDI048 (compound 1.16) is an orally active Cryptosporidium PI4K inhibitor for the research of cryptosporidiosis[1].

  

• HY-19915B

  Contezolid acefosamil sodium	1807365-35-0
  Contezolid acefosamil sodium (MRX-4), a new and orally active oxazolidinone, is an antibiotic in study for complicated skin and soft tissue infections (cSSTI) caused by resistant Gram-positive bacteria. Contezolid acefosamil sodium (MRX-4) markedly reduces potential for myelosuppression and monoamine oxidase inhibition (MAOI)[1][2].

  

• HY-N1913A

  Danshensu sodium	81075-52-7	99.9%
  Danshensu (Dan shen suan A) sodium, an orally active phenolic compound, can induce Nrf2/HO-1 activation and inhibition of NF-κB pathway. Danshensu sodium reduces reactive oxygen species (ROS) production, upregulates antioxidant defense mechanism and inhibits intrinsic apoptotic pathway. Danshensu sodium displays a potent antiviral activity against SARS-CoV-2 with EC50 of 0.97 μM. Danshensu sodium has anti-oxidation, anti-apoptosis, anti-lung inflammatory and has the potential for COVID-19, cardiovascular and cerebrovascular diseases research[1][2][3].

  

• HY-P1698B

  Reltecimod TFA		99.78%
  Reltecimod (AB-103) TFA is a T-cell-specific surface glycoprotein CD28 (TP44) antagonist. Reltecimod TFA has beneficial effects against different bacterial infections, their exotoxins and endotoxins, and ionizing radiation. Reltecimod TFA modulates the inflammatory response by targeting and attenuating the critical CD28/B7-2 co-stimulatory pathway, without inhibiting it. Reltecimod TFA can be used to research necrotizing soft-tissue infections (NSTIs)[1].

  

• HY-P99337

  Ansuvimab	2375952-29-5	99.90%
  Ansuvimab (Ansuvimab-zyk) is a recombinant human monoclonal IgG1 antibody that exhibits antiviral activity against Zaire ebolavirus. Ansuvimab binds to the glycoprotein on Zaire ebolavirus to block its entry into host cells[1].

  

• HY-B0535S

  Ethambutol-d4	1129526-19-7	98.12%
  Ethambutol-d4 is the deuterium labeled Ethambutol. Ethambutol is a bacteriostatic antimycobacterial agent, which obstructs the formation of cell wall by inhibiting arabinosyl transferases.

  

• HY-N0402S

  Artemether-d3	93787-85-0
  Artemether-d3 is the deuterium labeled Artemether. Artemether is an antimalarial for the treatment of resistant strains of falciparum malaria.

  

• HY-N0570S

  Hydroxytyrosol-d4	1330260-89-3
  Hydroxytyrosol-d4 is the deuterium labeled Hydroxytyrosol. Hydroxytyrosol (DOPET) is a phenolic compound drawn from the olive tree and its leaves with anti-oxidant, anti-atherogenic, anti-thrombotic, antimicrobial, anti-inflammatory and anti-tumour effects[1][2].

  

• HY-12480

  Lanopepden	1152107-25-9	98.62%
  Lanopepden (GSK 1322322) is a peptidyl peptidase (PDF) inhibitor. Lanopepden inhibits PDF activity, preventing bacterial protein synthesis, thereby exerting antibacterial activity. Lanopepden is primarily effective against Gram-positive bacteria. Lanopepden is used in the study of acute bacterial skin and skin structure infections[1].

  

• HY-12634

  Deleobuvir	863884-77-9	99.13%
  Deleobuvir (BI 207127) is a potent non-nucleoside hepatitis C virus (HCV) NS5B polymerase inhibitor.

  

• HY-12954

  PTACH	848354-66-5	99.65%
  PTACH (NCH-51) is a potent HDAC inhibitor with IC50s of 48 nM, 32 nM, and 41 nM for HDAC1, HDAC4, and HDAC6, respectively. PTACH exerts potent growth inhibition against various cancer cells (EC50s of 1.1-9.1 μM) [1][2].

  

• HY-13025

  HIV-1 integrase inhibitor	544467-07-4
  HIV-1 integrase inhibitor is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-14987

  AX20017	329221-38-7	99.69%
  AX20017 is a small-molecule protein kinase G (PknG) inhibitor with an IC50 of 0.39 μM.

  

• HY-16487

  Temafloxacin	108319-06-8	99.65%
  Temafloxacin (TMFX) is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin is well tolerated in lower respiratory and genitourinary tract infections[1][2].

  

• HY-16721

  Cyclopropavir	632325-71-4
  Cyclopropavir (Filociclovir) is an orally active and broad-spectrum anti-herpesvirus compound. Cyclopropavir inhibits UL97 kinase activity. Cyclopropavir has antiviral activity against HCMV, MCMV, and HAdV6 viruses[1][2][3][4][5].

  

• HY-17533

  Chromafenozide	143807-66-3	99.57%
  Chromafenozide is a potent partial ecdysone receptor agonist and dibenzoylhydrazine insecticide. Chromafenozide inhibits insect feeding and causes the insect to molt prematurely, leading to death. Chromafenozide shows antagonistic activity against 20-HE. Chromafenozide shows high toxicity against Spodoptera exigua and Spodoptera littoralis[1][2][3][4][5].

  

• HY-19285

  Sulfaclozine	102-65-8
  Sulfaclozine (Sulfachloropyrazine) is an efficacious sulphonamide derivative with antibacterial and anticoccidial effects. Sulfaclozine is commonly used for the treatment of various poultry diseases (particularly, collibacteriosis, fowl cholera and coccidiosis)[1].

  

• HY-19827

  Aeroplysinin 1	28656-91-9
  Aeroplysinin 1 ((+)-Aeroplysinin-1), a secondary metabolite isolated from marine sponges, shows potent antibiotic effects on Gram-positive bacteria and exerts antiviral activity against HIV-1 (IC50=14.6 μM). Aeroplysinin 1 has anti-inflammatory, anti-angiogenic and anti-tumor activities. Aeroplysinin 1 induces apoptosis in endothelial cells[1][2].

  

• HY-20349

  Monobehenin	30233-64-8
  Monobehenin, an bacterial biofilm formation inhibitor, has strong inhibitory activity toward bacterial biofilm formation of S. mutans, X. oryzae, and Y. enterocolitica in a strain specific manner[1].

  

• HY-43575

  Oseltamivir-acetate	1191921-01-3
  Oseltamivir-acetate is an impurity of Oseltamivir. Oseltamivir is a neuraminidase inhibitor recommended for the treatment and prophylaxis of influenza A and B[1][2].

  

• HY-44358

  Remdesivir nucleoside monophosphate	1911578-74-9	99.98%
  Remdesivir nucleoside monophosphate is a metabolite of Remdesivir[1]. Remdesivir is a nucleoside analogue with effective antiviral activity against SARS-CoV and MERS-CoV[2].

  

• HY-75828

  Dibenzylideneacetone	538-58-9	99.71%
  Dibenzylideneacetone (Dibenzalacetone) is a potent inhibitor of chitinase with an IC50 value of 13.10 μM. The MIC value of Dibenzylideneacetone against Botrytis cinerea is 32 μg/mL, and the EC50 values for inhibiting mycelium growth and spore germination are 16.29 and 14.64 μg/mL, respectively. Dibenzylideneacetone can be used in research on fruit and vegetable preservatives[1].

  

• HY-76293

  I2906	331963-29-2	99.92%
  I2906 showed antimycobacterial and cytotoxic activity against mycobacterium tuberculosis.

  

• HY-B0213

  Sulfameter	651-06-9	99.94%
  Sulfameter (Sulfametoxydiazine; 5-Methoxysulfadiazine) is an effective long-acting sulfonamide antibiotic with antibacterial activities. Sulfameter can be used for the research of urinary tract infections and lepriasis[1].

  

• HY-B0755

  Etimicin sulfate	362045-44-1	99.59%
  Etimicin (sulfate), a fourth-generation aminoglycoside antibiotic, is now widely clinically used due to its high efficacy and low toxicity.

  

• HY-B0843

  Metalaxyl	57837-19-1	98.45%
  Metalaxyl is a fungicide agent that inhibits the protein synthesis in fungi. Metalaxyl against downy mildews and soil-borne diseases by Phytium ssp. and Phytophthora ssp.[1][2].

  

• HY-B0875

  Cefmenoxime hydrochloride	75738-58-8	99.29%
  Cefmenoxime (SCE-1365) hydrochloride is a new semisynthetic cephalosporin antibiotic. Cefmenoxime has antibacterial activity against a wide variety of gram-positive and gram-negative bacteria[1][2].

  

• HY-B1282

  Sulfaquinoxaline	59-40-5
  Sulfaquinoxaline is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections[1][2].

  

• HY-B1414

  Chloroxylenol	88-04-0	99.24%
  Chloroxylenol is a broad-spectrum antibacterial agent that can be used to control bacteria, algae, fungi and viruses[1][2].

  

• HY-B1437

  Acetarsol	97-44-9	99.87%
  Acetarsol (Stovarsol) is a potent and orally active anti-infective agent. Acetarsol shows anti-parasite activity. Acetarsol has the potential for the research of proctitis[1].

  

• HY-B1537

  Azaribine	2169-64-4
  Azaribine (2',3',5'-Tri-O-acetyl-6-azauridine) is a potent orotidine monophosphate decarboxylase (OMPD) inhibitor. Azaribine is an antiviral inhibitor of several RNA viruses and inhibits viral genome replication and gene transcription. Azaribine shows broad-spectrum antiviral activity (EC50=3.80 nM-1.73 μM against influenza A and B viruses; EC50=1.62 μM against ZIKV Paraiba). Azaribine, a triacetate salt of Azauridine, has the potential for psoriasis research[1][2].

  

• HY-B1784

  Sulfisomidin	515-64-0	99.75%
  Sulfisomidin (Sulfaisodimidine) is an orally active short-acting sulfonamide antibacterial. Sulfisomidin can be used for the research of lower urinary tract infections[1][2].

  

• HY-B1858

  Isoprothiolane	50512-35-1	99.87%
  Isoprothiolane is a blast fungicide with antifungal, anti-inflammatory and insecticidal activities. Isoprothiolane primarily acts on fungi during the penetration and growth stages of infecting hyphae. Isoprothiolane can be used as an insecticide, pesticide, etc. In addition, Isoprothiolane can reduce serum phospholipid and total lipid concentrations, regulating lipid metabolism. Isoprothiolane is also used in the research of fatty liver[1][2][3][4].

  

• HY-B1878

  Faltan	133-07-3	98.52%
  Faltan is a dicarboximide fungicide, widely used on vines and several vegetable crops, and is also cytotoxic effect on human bronchial epithelial cells[1].

  

• HY-B1881

  Pirimiphos-methyl	29232-93-7	98.00%
  Pirimiphos-methyl is an organophosphorus insecticide and acaricide that can inhibit AChE in target organisms. Pirimiphos-methyl is often used for prevention and control of beetles, snout beetles, moths and Ephestia cautella during storage of agricultural grains[1][2][3].

  

• HY-D0948

  Celestine Blue	1562-90-9
  Celestine Blue is a electroactive indicator in DNA biosensors. Celestine Blue is strongly adsorbed on the spinel phases and CNT (carbon nanotubes), facilitates dispersion, acts as a capping agent and allows for the fabrication of spinel decorated CNT. Celestine Blue is an efficient charge transfer mediator, which allows for significant improvement of capacitive behavior. TiO2 nanoparticles doped with Celestine Blue can be used as a label in a sandwich immunoassay for the hepatitis C virus (HCV) core antigen[1][2][3].

  

• HY-I0179

  ITMN 4077	790305-05-4	99.65%
  ITMN 4077 is a macrocyclic inhibitor against Hepatitis C Virus (HCV) NS3 protease (EC50: 2131 nM)[1][2].

  

• HY-I0501

  2'-Aminoacetophenone	551-93-9	99.82%
  2'-Aminoacetophenone is an orally active inducer of apoptosis and respiratory biomarker. 2'-Aminoacetophenone can be used to detect Pseudomonas aeruginosa infections in the lungs of cystic fibrosis patients. 2'-Aminoacetophenone can inhibit the protein levels of LC3BII and p62 in macrophages infected with pqsA or mvfR and regulate autophagy. 2'-Aminoacetophenone can disrupt mitochondrial function by inducing oxidative stress and apoptosis signaling, leading to dysfunction in mouse skeletal muscle[1][2][4].

  

• HY-N0363

  (+)-Columbianetin	3804-70-4	99.04%
  (+)-Columbianetin is an isomer of Columbianetin. Columbianetin is a phytoalexin associated with celery (Apium graveolens) resistance to pathogens during storage. Columbianetin exhibits excellent anti-fungal and anti-inflammatory activity[1][2].

  

• HY-N0772

  Isomangiferin	24699-16-9	99.82%
  Isomangiferin, a natural product, is reported to have antiviral activity.

  

• HY-N0858

  Gomisin G	62956-48-3	99.95%
  Gomisin G is an ethanolic extract of the stems of Kadsura interior; exhibits potent anti-HIV activity with EC50 and therapeutic index (TI) values of 0.006 microgram/mL and 300, respectively.

  

• HY-N1136

  (+)-Totarol	511-15-9	98.23%
  (+)-Totarol is a diterpenoid compound isolated from Podocarpus spp.. (+)-Totarol is a potent antioxidant and antibacterial agent[1].

  

• HY-N1474

  Picfeltarraenin IA	97230-47-2	99.83%
  Picfeltarraenin IA, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IA can be used for the treatment of herpes infections, cancer and inflammation[1].

  

• HY-N1910

  4'-O-Methylbavachalcone	20784-60-5
  4'-O-Methylbavachalcone is a chalcone isolated from Psoralea corylifolia, inhibits severe acute respiratory syndrome coronavirus (SARS-CoV) papain-like protease (PLpro) activity, with an IC50 of 10.1 μM[1].

  

• HY-N2061

  Lindenenol	26146-27-0	99.85%
  Lindenenol is isolated from Radix linderae, with antioxidant and antibacterial activities[1].

  

• HY-N2216

  Polygalasaponin XXXI	79103-90-5
  Polygalasaponin XXXI (Onjisaponin F) is an effective adjuvant for intranasal administration of influenza Influenza hemagglutinin (HA) vaccine to protect influenza virus infection[1].

  

• HY-N2589

  Isosaponarin	19416-87-6	99.59%
  Isosaponarin is a flavone glycoside isolated from wasabi leaves. Isosaponarin is a P4HA2 enzymatic agonist. Isosaponarin increases collagen synthesis via up-regulated TGF-β type II receptor (TβR-II) and prolyl 4-hydroxylase (P4H) proteins production, promoting skin health and wound healing. Isosaponarin-rich plants exhibit strong antimicrobial, antioxidant, anti-hyaluronidase, antiplatelet, anti-atopic dermatitis, and anti-tumor effects[1][2][3][4][5].

  

• HY-N2795

  9-Hydroxycalabaxanthone	35349-68-9	99.14%
  9-Hydroxycalabaxanthone (Xanthone I) is a known xanthone isolated from Garcinia mangostana Linn. 9-Hydroxycalabaxanthone has quorum-sensing inhibitory, anti-microbial, and anti-malarial activities (IC50=1.2-1.5 μM)[1].

  

• HY-N2923

  β-Amyrin acetate	1616-93-9	99.47%
  β-Amyrin acetate is a triterpenoid with potent anti-inflammatory, antifungal, anti-diabetic, anti-hyperlipidemic activities. β-Amyrin acetate can inhibit HMG-CoA reductase activity by locating in the hydrophobic binding cleft of HMG CoA reductase[1][2][3][4].

  

• HY-N2925

  β-Amyrone	638-97-1	99.87%
  β-Amyrone (β-Amyron) is a triterpene compound which has anti-inflammatory activity through inhibiting the expression of COX-2. β-Amyrone has antifungal activity , as well as antiviral activity against Chikungunya virus. β-Amyrone also inhibits α-glucosidase and acetylcholinesterase (AChE) activity. β-Amyrone can be used in the research of disease like inflammation, infection, and obesity[1][2][3][4].

  

• HY-N3035

  Tetrahydroepiberberine	38853-67-7	99.20%
  Tetrahydroepiberberine is a isoquinoline alkaloid isolated from Corydalis impatiens (Pall). Tetrahydroepiberberine has antifungal and selective inhibition against the PI-3 virus activities[1].

  

• HY-N3196

  Neotuberostemonine	143120-46-1	99.93%
  Neotuberostemonine, one of the main antitussive alkaloids in the root of Stemona tuberosa Lour, attenuates bleomycin-induced pulmonary fibrosis by suppressing the recruitment and activation of macrophages[1].

  

• HY-N3394

  Lecanoric acid	480-56-8
  Lecanoric acid is a histidine-decarboxylase inhibitor isolated from fungus. The inhibition by lecanoric acid is competitive with histidineand noncompetitive with pyridoxal phosphate. Lecanoric acid did not inhibit aromatic amino acid decarboxylase[1].

  

• HY-N3557

  Cauloside A	17184-21-3
  Cauloside A (Leontoside A) is a saponin isolated from Dipsacus asper roots. Cauloside A has potent antifungal activity[1][2].

  

• HY-N3963

  Gomisin M2	82425-45-4
  Gomisin M2 ((+)-Gomisin M2) is a lignan isolated from the fruits of Schisandra rubriflora with anti-HIV activity (EC50 of 2.4 μM). Gomisin M2 exhibits anti-cancer and anti-allergic activities and has the potential for Alzheimer’s disease research[1][2].

  

• HY-N3990

  Hardwickiic acid	1782-65-6
  Hardwickiic acid ((-)-Hardwikiic acid) is an antinociceptive compound that blocks Tetrodotoxin-sensitive voltage-dependent sodium channels. Hardwickiic acid shows insecticidal activity[1][2].

  

• HY-N4106

  Dihydroartemisinic acid	85031-59-0	99.58%
  Dihydroartemisinic acid (Dihydroqinghao acid) is a biosynthetic precursor to the antimalarial agent Artemisinin[1].

  

• HY-N4116

  Xanthyletin	553-19-5	98.58%
  Xanthyletin is a coumarin isolated from Stauranthus perforatus, with anti-tumor and anti-bacterial activities. Xanthyletin also inhibits symbiotic fungus cultivated by leaf-cutting ants[1].

  

• HY-N4203

  Isopropyl ferulate	59831-94-6	99.97%
  Isopropyl ferulate, isolated from Notopterygium incisum, is used in the reduction of pharmaceuticals, preparation of antifungal agents, cosmetics and as antioxidant agent and so forth[1].

  

• HY-N4238

  Dehydrocorydaline nitrate	13005-09-9	99.90%
  Dehydrocorydaline nitrate (13-Methylpalmatine nitrate) is an alkaloid. Dehydrocorydaline regulates protein expression of Bax, Bcl-2; activates caspase-7, caspase-8, and inactivates PARP[1]. Dehydrocorydaline nitrate elevates p38 MAPK activation. Anti-inflammatory and anti-cancer activities.[2]. Dehydrocorydaline nitrate shows strong anti-malarial effects (IC50 =38 nM), and low cytotoxicity (cell viability > 90%) using P. falciparum 3D7 strain[3].

  

• HY-N5029

  Isofebrifugine	32434-44-9	98.90%
  Isofebrifugine is a natural quinazolinone alkaloid with important physiological activities and good pharmacological effects. Antimalarial effect[1].

  

• HY-N6025

  Clemastanin B	112747-98-5
  Clemastanin B, a lignin, has potent anti-influenza activities by inhibiting the virus multiplication, prophylaxsis and blocking the virus attachment. Clemastanin B targets viral endocytosis, uncoating or ribonucleoprotein (RNP) export from the nucleus. Clemastanin B has antioxidant and anti-inflammatory activities[1][2][3].

  

• HY-N6690

  Destruxin B	2503-26-6	99.86%
  Destruxin B, isolated from entomopathogenic fungus Metarhizium anisopliae, is one of the cyclodepsipeptides with insecticidal and anticancer activities. Destruxin B induces apoptosis via a Bcl-2 Family-dependent mitochondrial pathway in human nonsmall cell lung cancer cells[1]. Destruxin B significantly activates caspase-3 and reduces tumor cell proliferation through caspase-mediated apoptosis, not only in vitro but also in vivo[2].

  

• HY-N6717

  Tentoxin	28540-82-1
  Tentoxin is a cyclic tetrapeptide isolated from Alternaria tenuis, acts as a herbicide, causes seedling chlorosis, inhibits cyclic photophosphorylation and functions as an energy transfer inhibitor[1].

  

• HY-N6723

  Fumonisin B2	116355-84-1
  Fumonisin B2, a mycotoxin produced by Fusarium moniliforme in various grains, is a potent inhibitor of sphingosine N-acyltransferase (ceramide synthase) and disrupts de novo sphingolipid biosynthesis[1][2].

  

• HY-N6741

  β-Zearalenol	71030-11-0	99.96%
  β-Zearalenol is a non-steroidal estrogenic mycotoxin synthesized by Fusarium species. β-Zearalenol potentially influences transcription and effects gene expression on translational level[1].

  

• HY-N6842

  ArnicolideC	34532-67-7
  ArnicolideC is a sesquiterpene lactone isolated Centipeda minima[1]. ArnicolideC exertes a cytotoxic effect on the panel of Nasopharyngeal carcinoma (NPC) cells, significantly inhibiting cell growth in a dose- and time- dependent manner. ArnicolideC also exhibits inhibitory effects on NPC proliferation[2].

  

• HY-N6924

  Zingibroside R1	80930-74-1	99.75%
  Zingibroside R1 is dammaranae-type triterpenoid saponin, isolated from rhizomes, taproots, and lateral roots of Panax japonicas C. A. Meyer, shows excellent anti-tumor effects as well as anti-angiogenic activity[1]. Zingibroside R1 possesses some anti-HIV-1 activity. Zingibroside R1 has inhibitory effects on the 2-deoxy-D-glucose (2-DG) uptake by EAT cells (IC50=91.3 μM)[2].

  

• HY-N7023

  7-Prenyloxycoumarin	10387-50-5	99.87%
  7-Prenyloxycoumarin (7-O-Prenylumbelliferone) is a secondary metabolite from the endophytic fungus of Annulohypoxylon ilanense[1].

  

• HY-N7120

  Penicillin G procaine hydrate	6130-64-9	99.52%
  Penicillin G Procaine hydrate (PGP hydrate), a β-lactam antibiotic, is a crystalline complex produced by chemically combining penicillin G with procaine[1][2].

  

• HY-N7227

  Anonaine	1862-41-5
  Anonaine is an antiparasitic agent. Anonaine also is a glutathione S-transferase (GST) inhibitor[1].

  

• HY-N8105

  Protoneogracillin	191334-50-6	99.96%
  Protoneogracillin, a furostanol glycoside, shows anti-fungal activity against the plant pathogenic fungus P.oryzae (MMDC=94.0 μM) and cytotoxic activity on K562 cancer cells (IC50=6.6 μM)[1][2].

  

• HY-N8156

  Soyasapogenol C	595-14-2
  Soyasapogenol C is an oleanane-type triterpenoid. Soyasapogenol C exhibits anti-HSV-1 activity, with an IC50 of 18.9 μM[1].

  

• HY-N8343

  Arjunglucoside I	62319-70-4	99.77%
  Arjunglucoside I, a natural compound, possesses antimicrobial activity with a MIC of 1.9 μg/mL[1].

  

• HY-N8593

  Undecane	1120-21-4
  Undecane has anti-allergic and anti-inflammatory activities on sensitized rat basophilic leukemia (RBL-2H3) mast cells and HaCaT keratinocytes. In sensitized mast cells, Undecane inhibits degranulation and the secretion of histamine and TNF-α[

  

• HY-P0310

  SV40 large T antigen NLS	163815-24-5	98.98%
  SV40 large T antigen NLS is from Large T antigen residue 47 to 55, enables protein import into cell nucleus.

  

• HY-P1065

  Apelin-36(rat, mouse)	230299-95-3	99.12%
  Apelin-36(rat, mouse) is an endogenous orphan G protein-coupled receptor APJ agonist. Apelin-36(rat, mouse) binds to APJ receptors with an IC50 of 5.4 nM, and potently inhibits cAMP production with an EC50 of 0.52 nM. Apelin-36(rat, mouse) blocks entry of some HIV-1 and HIV-2 strains into NP-2/CD4 cells expressing APJ[1][2].

  

• HY-P1774

  Hepatitis B Virus Core (128-140)	160015-13-4	99.56%
  Hepatitis B Virus Core (128-140) is a peptide of hepatitis B virus core protein.

  

• HY-P1823

  C-Reactive Protein (CRP) (174-185)	147516-85-6	99.88%
  C-Reactive Protein (CRP) is an anti-pneumococcal plasma protein that can serve as an inflammatory marker. C-Reactive protein can protect mice from pneumococcal infection by activating complement. C-Reactive protein can inhibit the activation of caspase-3/9 through the CD64/AKT/mTOR pathway, thereby promoting chemotherapy resistance in mice with tongue squamous cell carcinoma[1][5].

  

• HY-P4511

  Serylleucine	6665-16-3	98.31%
  Serylleucine (L-ser-L-leu) is a dipeptide. Serylleucine's core 1 o-glycosylated peptide (SLC1G) can be detected in urine as a metabolite and is a biomarker in TB studies[1].

  

• HY-P4648

  H-Trp-Trp-Trp-OH	59005-82-2	99.87%
  H-Trp-Trp-Trp-OH is a tripeptide consisting of tryptophan. H-Trp-Trp-Trp-OH has antibacterial activity[1].

  

• HY-P5581

  Alloferon 1	347884-61-1	99.97%
  Alloferon 1 is an antiviral and antitumoral peptide. Alloferon 1 stimulates natural cytotoxicity of human peripheral blood lymphocytes. Alloferon 1 also induces IFN synthesis, and enhances antiviral and antitumor resistance in mice. Alloferon 1 also shows anti-inflammatory activity in λ-carrageenan-induced paw edema model. Alloferon 1 can be isolated from the blood of the blow fly Calliphora vicina (Diptera)[1][2][3].

  

• HY-P9957

  Raxibacumab	565451-13-0	98.88%
  Raxibacumab (ABthrax) is a human IgG1 monoclonal antibody against Bacillus anthracis protective antigen (PA). Raxibacumab blocks the toxin’s deleterious effects by preventing binding of the protective antigen component of the anthrax toxin to its receptors in host cells, thereby blocking the toxin’s deleterious effects. Raxibacumab can be used for anti-anthrax research[1][2].

  

• HY-Y0123

  DL-Tyrosine	556-03-6
  DL-Tyrosine is an aromatic nonessential amino acid synthesized from the essential amino acid phenylalanine. DL-Tyrosine is a precursor for several important neurotransmitters (epinephrine, norepinephrine, dopamine)[1].

  

• HY-100028

  AT-130	211364-06-6	98.39%
  AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC50 of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells[1][2][3].

  

• HY-100943

  Cinanserin hydrochloride	54-84-2	99.48%
  Cinanserin hydrochloride (SQ 10643) is a potent, selective and highly affinity 5-HT2 receptor antagonist with a Ki of 41 nM. Cinanserin hydrochloride has a much higher binding affinity for the 5-HT2 than for the 5-HT1 receptor (Ki of 3500 nM). Cinanserin is also an inhibitor of 3C-like proteinase of severe acute respiratory syndrome coronavirus and strongly reduces virus replication in vitro[1][2][3].

  

• HY-105017

  Evodenoson	844873-47-8	99.74%
  Evodenoson is a selective agonist of the A2A adenosine receptor. Evodenoson’s primary actions include reducing inflammatory responses, decreasing intestinal fluid secretion, edema, tissue damage, and neutrophil infiltration induced by Clostridium difficile toxin A. Evodenoson’s protective effect is achieved by reducing myeloperoxidase (MPO) and adenosine deaminase (ADA) activities, and by lowering the production of tumor necrosis factor-alpha (TNF-α)[1].

  

• HY-106296

  WIN 54954	107355-45-3	98.14%
  WIN 54954 is an orally active and broad-spectrum antipicornavirus agent. WIN 54954 is effectiveness against human rhinovirus, echovirus 9 and enterovirus infections[1][2].

  

• HY-107126

  Ibrexafungerp	1207753-03-4	99.83%
  Ibrexafungerp (MK 3118) is an orally active β-1,3-glucan synthesis inhibitor, with potential antifungal activity. Ibrexafungerp can be used for research of Candida and Aspergillus infections[1].

  

• HY-107833

  A40926	102961-72-8
  A40926 is a glycopeptide antibiotic that targets the bacterial cell wall peptidoglycan precursor D-alanyl-D-alanine (D-Ala-D-Ala). A40926 irreversibly inhibits cell wall synthesis by competitively binding to this target, and has high bactericidal activity against Gram-positive bacteria (such as Staphylococcus, Streptococcus) and Neisseria gonorrhoeae, with MIC=0.06-2 μg/mL, and is also effective against penicillin-resistant strains. A40926 blocks peptidoglycan cross-linking, destroys cell wall integrity, and causes bacterial lysis and death. A40926 has a fat-soluble fatty acid structure, which can increase serum concentrations and prolong the duration of action (e.g., the terminal half-life in rats is 61.22 h)[1][2].

  

• HY-107858

  Veratryl alcohol	93-03-8
  Veratryl alcohol (3,4-Dimethoxybenzyl alcohol) is a secondary metabolite of lignin-degrading fungi, commonly used as a substrate for lignin peroxidase (LiP) to measure lignin degradation activity. Veratryl alcohol protects LiP from inactivation by H2O2 and prevents the accumulation of LiP III compounds. Veratryl alcohol also acts as a stabilizer for manganese-dependent peroxidases (MnP). Veratryl alcohol is a quorum-sensing inhibitor (QSI) and exhibits antibacterial efficacy[1][2][3][4].

  

• HY-108447

  BC-11 hydrobromide	443776-49-6
  BC-11 hydrobromide is a selective TMPRSS2 inhibitor (TMPRSS2 is a key host cellular factor for viral entry and SARS-CoV-2 pathogenesis), and a selective urokinase (uPA) inhibitor (IC50=8.2 μM). BC-11 hydrobromide is cytotoxic to triple-negative MDA-MB231 breast cancer cells. BC-11 hydrobromide is used in research on viral infections and cancer[1][2][3].

  

• HY-108880

  Carindacillin sodium	26605-69-6
  Carindacillin (Carbenicillin indanyl) sodium is an orally active and broad-spectrum antimicrobial agent. Carindacillin sodium can be hydrolyzed to Carbenicillin in vivo. Carindacillin sodium can be used for the research of urinary-tract infection[1][2].

  

• HY-109571

  HZ-1157	1009734-33-1	98.16%
  HZ-1157 inhibits HCV NS3/4A protease with an IC50 of 1.0 μmol/L. HZ-1157 (4a) has a high dengue virus inhibitory activity (EC50 = 0.15 μM) and is a relatively nontoxic (CC50 > 10 μM) dengue antiviral agent[1][2].

  

• HY-111071

  Nilofabicin	934628-27-0	99.58%
  Nilofabicin is an enoyl-(acyl-carrier protein) reductase (FabI) inhibitor. Nilofabicin had an MIC(90) of 0.5 microg/ml for Staphylococcus aureus strains and was more potent than either linezolid or vancomycin[1].

  

• HY-111641

  3'-Azido-3'-deoxy-5-fluorocytidine	2095417-18-6	99.90%
  3'-Azido-3'-deoxy-5-fluorocytidine (Compound 12) is a cytidine derivative. 3'-Azido-3'-deoxy-5-fluorocytidine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-112657

  Xanthorrhizol	30199-26-9	98.46%
  Xanthorrhizol, isolated from Curcuma xanthorrhiza Roxb, is a potential antibacterial agent.

  

• HY-114621

  DB772	1451058-50-6	99.72%
  DB772 hydrate is a bovine viral diarrhoea virus (BVDV) inhibitor. DB772 also has anti-prion activity[1].

  

• HY-115661

  Bisdionin C	74857-22-0	98.97%
  Bisdionin C is a potent GH18 chitinases inhibitor, with an IC50 of 0.2 μM for A. fumigatus ChiB1 (AfChiB1). Bisdionin C inhibits HCHT (human macrophage chitotriosidase) and acidic mammalian chitinase (AMCase) with IC50s of 8.3 and 3.4 μM, respectively[1].

  

• HY-116838

  TAM-16	2030241-59-7	99.84%
  TAM-16 is a potent and orally active polyketide synthase 13 (Pks13) inhibitor with an IC50 value of 0.32 μM. TAM-16 has promising activity against Mycobacterium tuberculosis. TAM-16 inhibits hERG cardiac ion channel[1][2].

  

• HY-118065

  Fenhexamid	126833-17-8	99.60%
  Fenhexamid, a botryticide, is a sterol biosynthesis inhibitor. Fenhexamid shows fungicide efficient against the plant pathogenic fungus Botryotinia fuckeliana (Botrytis cinerea)[1].

  

• HY-118224

  BPH-715	1059677-23-4	99.62%
  BPH-715 is a bisphosphonate, inhibits Plasmodium liver-stage growth, with an IC50 of 10 μM for Plasmodium exoerythrocytic forms in HepG2 cells[1].

  

• HY-118383

  Agathisflavone	28441-98-7	99.62%
  Agathisflavone is a flavonoid with antioxidant, anti-inflammatory, antiviral, antiparasitic, cytotoxic, neuroprotective, and hepatoprotective activities. Agathisflavone can improve tissue repair in a spinal cord injury model in rats[1][2][3].

  

• HY-120397

  Bis-propargyl-PEG4	159428-42-9
  Bis-propargyl-PEG4 is a PEG-based PROTAC linker used in the synthesis of PROTACs. Bis-propargyl-PEG4 is used for the synthesis of demethylvancomycin dimers[1][2]. Bis-propargyl-PEG4 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-120734

  Quinoxyfen	124495-18-7
  Quinoxyfen (DE-795) is a powdery mildew fungicide[1].

  

• HY-12082A

  GSK369796 Dihydrochloride	1010411-21-8	99.56%
  GSK369796 Dihydrochloride is an affordable and effective antimalarial and inhibits hERG potassium ion channel repolarization with an IC50 of 7.5 μM.

  

• HY-121513

  Torcitabine	40093-94-5	99.61%
  Torcitabine (2'-Deoxy-L-cytidine) is an antiviral agent. Torcitabine has the potential for chronic hepatitis B virus infection treatment[1][2].

  

• HY-123581

  Quinocetone	81810-66-4	98.00%
  Quinocetone is a potent synthetic antimicrobial agent that is used for improving the feed efficiency and controlling dysentery in food-producing animals[1].

  

• HY-124819

  D13-9001	957471-96-4
  D13-9001 is a potent AcrB (AcrAB-TolC efflux pump subunit) and MexB (MexAB-OprM efflux pump subunit) inhibitor with the KD values of 1.15 μM and 3.57 μM in E. coli and P. aeruginosa, respectively[1]. D13-9001 exhibits antibiotic activities[2].

  

• HY-125028

  Hck-IN-1	1473404-51-1	98.53%
  Hck-IN-1 (compound B9), a diphenylpyrazolo compound, is a selective Nef-dependent Hck inhibitor with IC50s of 2.8 μM, >20 μM for Nef:Hck complex and Hck, respectively. Hck-IN-1 is a direct and wide HIV-1 Nef antagonists with an IC50 of 100-300 nM for wild-type HIV-1 replication. Hck-IN-1 binds pocket residue Asn126 and has anti-retroviral activity[1].

  

• HY-125365

  Rifamycin S	13553-79-2	98.82%
  Rifamycin S, a quinone, is an antibiotic against Gram-positive bacteria (including MRSA). Rifamycin S is the oxidized forms of a reversible oxidation-reduction system involving two electrons. Rifamycin S generates reactive oxygen species (ROS) and inhibits microsomal lipid peroxidation. Rifamycin S can be used for tuberculosis and leprosy[1][2][3].

  

• HY-125604

  WCK-4234	1804915-68-1
  WCK-4234 is a potent β-lactamase inhibitor. WCK-4234 inhibits class A, C, and D β-lactamases activity. WCK-4234 lacks direct antibacterial activity. WCK-4234 potentiates imipenem and meropenem against Enterobacteriaceae with OXA-48/OXA-181 or KPC enzymes, or with combinations of impermeability and AmpC or ESBL activity. WCK-4234 distinctively overcomes resistance mediated by OXA-type carbapenemases[1][2].

  

• HY-125703

  Ferutinin	41743-44-6
  Ferutinin, a natural terpenoid compound, is an estrogen receptor ERα agonist and estrogen ERβ-receptor agonist/antagonist with IC50s of 33.1 nM and 180.5 nM, respectively. Ferutinin acts as an electrogenic Ca2+-ionophore that increases calcium permeability of lipid bilayer membranes, mitochondria. Ferutinin possesses estrogenic, antitumor, antibacterial and antiinflammatory activities[1][2].

  

• HY-125713

  Ganoderic acid Y	86377-52-8
  Ganoderic acid Y is a α-glucosidase inhibitor with an IC50 of 170 μM for yeast α-glucosidase. Ganoderic acid Y inhibits enterovirus 71 (EV71) replication through blocking EV71 uncoating[1][2].

  

• HY-125941

  PNU-101603	168828-60-2	98.83%
  PNU-101603 is a sulfoxide metabolite of Sutezolid (HY-10392). PNU-101603 alone or combined with SQ109 (HY-14989) shows excellent activity against Mycobacterium tuberculosis (MTB), as well as against agent-susceptible and multidrug-resistant TB[1][2].

  

• HY-126114

  Lupeol acetate	1617-68-1
  Lupeol acetate is a derivative of Lupeol. Lupeol acetate is an anti-inflammatory, antibacterial, anti-trypanosomic and anticancer agent with oral activity. Lupeol acetate significantly improves the symptoms of rheumatoid arthritis by down-regulating the expression of inflammatory cytokines and osteoclast production. Lupeol acetate inhibits spermatogenesis in male rats and eventually led to infertility[1][2][3][4].

  

• HY-126562

  Piperlonguminine	5950-12-9
  Piperlonguminine is an alkaloid amide isolated from the Piper species. Piperlonguminine shows various biological properties, including anti-inflammatory, antitumor, neuroprotective, anti-platelet, anti-melanogenic, antifungal and antibacterial activities[1][2][3][4].

  

• HY-12828A

  KH-CB20	1354448-60-4	99.80%
  KH-CB20, an E/Z mixture, is a potent and selective inhibitor of CLK1 and the closely related isoform CLK4, with an IC50 of 16.5 nM for CLK1. KH-CB20 can also inhibit DYRK1A (IC50=57.8 nM) and CLK3 (IC50=488 nM)[1].

  

• HY-128384

  Benzyldodecyldimethylammonium chloride dihydrate	147228-80-6
  Benzyldodecyldimethylammonium chloride dihydrate is a quaternary ammonium compound (QAC) and can be used as a biocide to target antibiotic-resistant bacteria, such as methicillin-resistant Staphylococcus aureus (MRSA), multidrug-resistant (MDR) P. aeruginosa et. al. Benzyldodecyldimethylammonium chloride dihydrate, an antimicrobial agent, bacteriostatic or bactericidal properties depending on the concentration.

  

• HY-129041

  Procaterol hydrochloride hemihydrate	81262-93-3	99.88%
  Procaterol hydrochloride hemihydrate is an orally active β2 adrenoreceptor agonist. Procaterol hydrochloride hemihydrate can be used for the research of asthma[1][2][3].

  

• HY-129060

  Flutrimazole	119006-77-8	99.34%
  Flutrimazole is an imidazole antifungal with dual anti-inflammatory and antifungal activity. Flutrimazole shows scarce transdermal penetration. Flutrimazole has the advantageous in the research of topical fungal infections with an inflammatory component[1].

  

• HY-129077

  FR179642	168110-44-9	99.84%
  FR179642 is a key intermediate in the synthesis of the echinocandin antifungal Micafungin[1]. FR179642 is the cyclic peptide nucleus of the echinocandin-like antifungal lipopeptide FR901379[2].

  

• HY-129337

  Reveromycin A	134615-37-5
  Reveromycin A, a benzoquinoid antibiotic isolated from the genus Streptomyces, is a selective inhibitor of protein synthesis in eukaryotic cells. Reveromycin A inhibits bone resorption by inducing apoptosis specifically in osteoclasts. Reveromycin A has antiproliferative activity against tumor cell lines and antifungal activity[1][2].

  

• HY-129605

  Ferulenol	6805-34-1
  Ferulenol, a sesquiterpene prenylated coumarin derivative, specifically inhibits succinate ubiquinone reductase at the level of the ubiquinonecycle. Ferulenol shows good antimycobacterial activity and haemorrhagic action[1][2][3].

  

• HY-134909

  AS-136A	949898-66-2	99.67%
  AS-136A is an orally active non-nucleoside inhibitor of the measles virus RNA-dependent RNA polymerase (RdRp) with an IC50 of 2 µM for measles virus[1].

  

• HY-135174

  L-Cysteine-glutathione disulfide	13081-14-6
  L-Cysteine-glutathione disulfide is a metabolite in plasma that can be used in biomarker studies for tuberculosis cure[1].

  

• HY-135578

  Artelinic acid	120020-26-0	99.96%
  Artelinic acid, a derivative of Artemisinin, is an antimalarial agent for the treatment of multidrug resistant strains of Plasmodium falciparum. Artelinic acid can be administered by various routes of administration, including intravenous, intramuscular and oral routes[1][2].

  

• HY-135646

  Eleutheroside B1	16845-16-2	98.73%
  Eleutheroside B1, a coumarin compound, has a wide spectrum of anti-human influenza virus efficacy, with an IC50 value of 64-125 µg/ml. Eleutheroside B1 mediates its anti-influenza activity through POLR2A and N-glycosylation. Eleutheroside B1 inhibits the mRNA expression of several chemokine genes and the influenza nucleoprotein (NP) gene, and exhibits low cytotoxicity. Antiviral and anti-inflammatory activities[1].

  

• HY-135842

  Aspoxicillin	63358-49-6	99.56%
  Aspoxicillin is a broad-spectrum antimicrobial agent against 68 isolates of Actinobacillus pleuropneumoniae with an MIC90 value of <= 0.05 μg/ml. Aspoxicillin has a long half-life in mouse serum of 55 minutes[1][2].

  

• HY-135847

  Desmethyl ferroquine	903546-18-9	98.02%
  Desmethyl ferroquine (SSR97213) is the active and major metabolite of Ferroquine. Ferroquine is an antimalarial. Desmethyl ferroquine shows significant activity against Chloroquine-susceptible and resistant P. falciparum strains[1].

  

• HY-136330

  Oxazosulfyl	1616678-32-0	99.88%
  Oxazosulfyl is a potent agricultural fungicide. Oxazosulfyl can be used as an insecticide against major rice pests[1].

  

• HY-136355

  Picoxystrobin	117428-22-5	99.76%
  Picoxystrobin is a primary strobilurin fungicide that is widely applied for plant disease control. Picoxystrobin inhibits mitochondrial respiration via blocking electron transfer at the Qo center of cytochrome b and c1[1].

  

• HY-136440

  Hydroxymetronidazole	4812-40-2
  Hydroxymetronidazole (Metronidazole-OH) is a metabolite of Metronidazole belonging to the class of nitroimidazoles. Hydroxymetronidazole can be used for the research of certain bacterial and protozoal diseases in poultry, swine dysentery and genital trichomoniasis in cattle[1].

  

• HY-13735B

  Quinacrine hydrochloride hydrate	6151-30-0	98.05%
  Quinacrine hydrochloride hydrate (Mepacrine hydrochloride hydrate) is an antimalarial agent, which possess anticancer effect both in vitro and vivo. Quinacrine hydrochloride hydrate suppresses NF-κB and activates p53 signaling, which results in the induction of the apoptosis[1].

  

• HY-137445

  Modoflaner	1331922-53-2	98.01%
  Modoflaner is an isophenylamide insecticide. Modoflaner may act through allosteric regulation of gamma-aminobutyric acid-gated chloride channels[1][2].

  

• HY-138137

  Menaquinone 6	84-81-1
  Menaquinone 6 is a active product found in Wolinella succinogenes. Menaquinone 6 is a form of vitamin K2 (HY-109569) that has antimicrobial activity[1].

  

• HY-138580

  2'-OMe-A(Bz) Phosphoramidite	110782-31-5
  2'-OMe-A(Bz) Phosphoramidite is a modified phosphoramidite monomer, which can be used for the oligonucleotide synthesis[1].

  

• HY-139262

  FNC-TP	2457357-99-0
  FNC-TP is the intracellular active form of FNC. FNC is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV[1]. FNC-TP is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-139745

  FPI-1523 sodium	1452459-52-7	99.79%
  FPI-1523 sodium, a derivative of Avibactam, is a potent β-lactamase inhibitor, with Kds of 4 nM and 34 nM for CTX-M-15 and OXA-48, respectively. FPI-1523 sodium also inhibits PBP2, with an IC50 of 3.2 μM. FPI-1523 sodium exhibits considerable antimicrobial activity[1].

  

• HY-144770

  SARS-CoV-2-IN-13	56961-10-5	98.90%
  SARS-CoV-2-IN-13 (compound 5) is a potent inhibitor of SARS-CoV-2 with an IC50 of 0.057 μM. SARS-CoV-2-IN-13 is a niclosamide analogue. SARS-CoV-2-IN-13 contains higher stability in human plasma and liver S9 enzymes assay than niclosamide, which can improve bioavailability and half-life when administered orally[1].

  

• HY-145374

  AL-611	2481279-61-0	99.93%
  AL-611 is an HCV NS5B polymerase inhibitor (EC50 = 5 nM).

  

• HY-146446

  PXYC1	865098-81-3	98.98%
  PXYC1 is a ribosomal protein S1 (RpsA) antagonist with Kds of 0.81 and 0.31 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb)[1].

  

• HY-147089

  PRRSV/CD163-IN-1	560995-89-3	98.55%
  PRRSV/CD163-IN-1 is a PRRSV/CD163 inhibitor. PRRSV/CD163-IN-1 can inhibit the interaction between the PRRSV glycoprotein (GP2a or GP4) and the CD163-SRCR5 domain. PRRSV/CD163-IN-1 can be used for the research of porcine reproductive and respiratory syndrome (PRRS) [1].

  

• HY-147274

  Funobactam	2365454-12-0	99.47%
  Funobactam (XNW4107) is a β-lactamase inhibitor, can be used for researching anti-bacteria[1].

  

• HY-147360

  Tribendimidine	115103-15-6
  Tribendimidine is an orally active, broad-spectrum anthelmintic agent, with particularly high activity against A. lumbricoides and N. americanus. Tribendimidine is also an L-type nicotinic acetylcholine receptor (nAChR) agonist[1][2][3].

  

• HY-147428

  Zolunicant	188125-42-0	99.29%
  Zolunicant (MM-110) is a potent inhibitor against nicotinic α3β4 receptors with an IC50 of 0.90 μM to combat addiction. Zolunicant can decrease the self-administration of several addictive agents including morphine, methamphetamine, nicotine, and ethanol in rat model. Zolunicant can be studied as a potential research for multiple forms of agent abuse[1]. Zolunicant also reveals a potent leishmanicide effect against Leishmania amazonensis[2].

  

• HY-147761

  GAK inhibitor 2	2396706-31-1	98.58%
  GAK inhibitor 2 (Compound 14g) is a potent cyclin G-associated kinase (GAK) inhibitor with an IC50 of 0.024 μM. GAK inhibitor 2 shows antiviral activity with an EC50 of 1.049 μM against dengue virus (DENV)[1].

  

• HY-14805S

  Tecovirimat-d4		99.14%
  Tecovirimat-d4 (ST-246-d4) is a deuterium-labelled Tecovirimat (HY-14805). Tecovirimat is an orally bioavailable and selective compound against orthopoxviruses [including vaccinia, monkeypox, camelpox, cowpox, ectromelia (mousepox), smallpox and variola viruses]. Tecovirimat is evaluated against vaccinia, cowpox virus, ectromelia virus with EC50 values of 0.01 μM, 0.48 μM and 0.05 μM, respectively. Tecovirimat targets the orthopoxvirus protein VP37 which is necessary for membrane envelopment of intracellular mature virus particles to form enveloped virus. Tecovirimat exerts antiviral activity on the target of the cowpox virus V061 gene, which is homologous to vaccinia virus F13L, encoding a major envelope protein (p37) required for production of extracellular virus. Tecovirimat could be used in the study for orthopoxvirus-induced diseases[1][2][3][4][5].

  

• HY-148187

  NLRP3-IN-11	2769040-91-5	98.79%
  NLRP3-IN-11 is a NLR family pyrin domain containing 3 (NLRP3) proteins inhibitor. NLRP3-IN-11 has biological activity for NLRP3 with an IC50 value of <0.3 μM. NLRP3-IN-11 can be used for the researh of inflammatory and degenerative diseases including NASH, atherosclerosis and other cardiovascular diseases, Alzheimer's disease, Parkinson's disease, diabetes, gout, and numerous other autoinflammatory diseases[1].

  

• HY-148348

  AB-836	2445597-31-7	99.13%
  AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein[1].

  

• HY-149954

  SARS-CoV-2-IN-39	2882823-03-0	99.79%
  SARS-CoV-2-IN-39 (compound 21) is a SARS-CoV-2 inhibitor with an EC50 of 1 μM. SARS-CoV-2-IN-39 against SARS-CoV-2 by inhibiting of SKP2 protein and stabilizing BECN1[1].

  

• HY-150062

  SARS-CoV-2 nsp3-IN-1	2892105-43-8
  SARS-CoV-2 nsp3-IN-1 (Compound 15c) is a Mac1 (SARS-CoV-2 nsp3 macrodomain) inhibitor with the IC50 value of 6.1 μM. SARS-CoV-2 nsp3-IN-1 can inhibit Mac1 ADP-ribosylhydrolase activity. SARS-CoV-2 nsp3-IN-1 demonstrates notable selectivity for coronavirus macrodomains, especially towards SARS-CoV-2 Mac1[1].

  

• HY-150686

  Chitin synthase inhibitor 4	2755847-31-3	99.48%
  Chitin synthase inhibitor 4 (compound 4fh) is a chitin synthase inhibitor with fungicidal effect. Chitin synthase inhibitor 4 is a potential chitin synthase-based fungicide in agriculture[1].

  

• HY-150734

  ODN 2007	455348-63-7
  ODN 2007, a class B CpG ODN (oligodeoxynucleotide), is a Toll-like receptor (TLR) ligand. ODN 2007 can be used as an immunomodulator, vaccine adjuvant, and enhance immune responses in mammals, fish, and humans. ODN 2007 sequence: 5'-TCGTCGTTGTCGTTTTGTCGTT-3'[1][2][3].

  

• HY-150759

  HIV-1 inhibitor-45	2677762-43-3	99.54%
  HIV-1 inhibitor-45 (compound IA-6) is a potent HIV-1 RNase H inhibitor with an IC50 value of 0.067 μM. HIV-1 inhibitor-45 shows an antiviral activity[1].

  

• HY-151402

  Antimicrobial agent-8	2978694-22-1
  Antimicrobial agent-8 (Compound 15) is a potent antimicrobial agent, and shows potent antimicrobial activity with an MIC range of 2-8 μg/mL against Gram-negative and Gram-positive bacteria. Antimicrobial agent-8 shows anti-inflammatory activity against lipopolysaccharide-induced inflammation.

  

• HY-151537

  Gol-NTR	2968461-58-5	99.44%
  Gol-NTR is a Golgi-targetable probe with high selectivity and sensitivity. Gol-NTR is Nitroreductase (NTR)-activated and has visualization acute lung injury (ALI) and repair function. Gol-NTR has a low detection limit of 54.8 ng/mL. Gol-NTR can be used for the research for monitoring and assessing research response of sepsis-induced ALI[1].

  

• HY-152959

  STING agonist-26	2868261-48-5	99.56%
  STING agonist-26 (CF508) is a non-nucleotide small-molecule STING agonist. STING agonist-23 activates STING, increases phosphorylation of STING, TBK1 and IRF3. STING agonist-23 promotes the levels of IFN-β, IL-6, CXCL-10, TNF-α, ISG-15, and CCL-5 in tumor cells. STING agonist-23 exhibits activity against SARS-CoV series strains[1].

  

• HY-153612

  MMV009085	298217-59-1
  MMV009085 is a potent PfHT1 (Plasmodium falciparum hexose transporter)-specific inhibitor and a potential anti-malarial agent . MMV009085 is also a human glucose transporter inhibitor, it has high potency in inhibiting both glucose uptake (IC50: 2.6 μM in glucose uptake assay) and growth of the parasites (EC50: 1.23±0.04 μM against 3D7)[1].

  

• HY-155007

  DNA gyrase B-IN-2		99.77%
  DNA gyrase B-IN-2 (Compound E) is a 2-aminobenzothiazole-based DNA gyrase B inhibitor with promising activity against ESKAPE bacterial pathogens. DNA gyrase B-IN-2 showed low nanomolar inhibition of DNA gyrase (IC50 < 10 nM) and broad-spectrum antibacterial activity against pathogens belonging to the ESKAPE group, with the minimum inhibitory concentration < 0.03 μg/mL for most Gram-positive strains and 4–16 μg/mL against Gram-negative E. coli, Acinetobacter baumannii, Pseudomonas aeruginosa, and Klebsiella pneumoniae.DNA gyrase B-IN-2 can be used for the research of infection[1].

  

• HY-156613

  Frunexian	1803270-60-1
  Frunexian (EP-7041) is a selective and potent inhibitor of coagulation factor XI/activated factor XI, targeting to factor XIa. Frunexian exhibits antithrombotic activity, with no bleeding liability in rat mesenteric arterial puncture model. Frunexian can be used in extracorporeal membrane oxygenation (ECMO) research[1].

  

• HY-159688

  Cefditoren	104145-95-1	98.14%
  Cefditoren is an orally active antibiotic with broad-spectrum antibacterial activity, capable of inhibiting both Gram-negative and Gram-positive bacteria. It has a MIC50 of 0.25-0.5 mg/L against Streptococcus pneumoniae strains. Cefditoren is effective against respiratory tract infections and skin infections[1][2][3].

  

• HY-159700

  AA3-DLin	3027565-91-6
  AA3-DLin is an ionizable cationic lipid with a pKa value of 5.8. AA3-DLin is used to delivery mRNA combined with lipid nanoparticles (LNPs). AA3-DLin LNP COVID-19 vaccines encapsulating SARS CoV-2 spike mRNAs successfully induces strong immunogenicity in a BALB/c mouse model[1].

  

• HY-161059

  ZB-R-55	2416593-55-8	98.84%
  ZB-R-55 is an orally active RIPK1 inhibitor. ZB-R-55 can be used for sepsis study[1].

  

• HY-161178

  LK-60		99.70%
  LK-60 is a potent DprE1 inhibitor. LK-60 effectively inhibits the proliferation of Mycobacterium tuberculosis. LK-60 has good safety profiles to gut microbiota and human cells[1].

  

• HY-161619

  RMC-113	2258606-34-5	99.54%
  RMC-113 is a PIP4K2C and PIKfyve inhibitor with the Ki vaules of 46 nM and 370 nM. RMC-113 reverses SARS-CoV-2-induced impairment of autophagic flux. RMC-113 shows antiviral activity[1].

  

• HY-162238

  OSM-S-106	2650846-59-4	99.34%
  OSM-S-106 is a pro-inhibitor and that inhibition of PfAsnRS occurs via enzyme-mediated production of an Asn-OSM-S-106 adduct. OSM-S-106 inhibits protein translation and activates the amino acid starvation response. OSM-S-106 exhibits selective activity against Plasmodium blood and liver stages and low intrinsic clearance by human microsomes[1].

  

• HY-162485

  DV-B-120		98.49%
  DV-B-120 is a competitive inhibitor for dengue virus (DENV) with IC50s of 5.35, 7.39, 10.49 and 8.58 μM, for DENV-1, DENV-2, DENV-3 and DENV-4, respectively, by inhibiting NS2B-NS3 protease. DV-B-120 exhibits antiviral activity through inhibition of DENV replication[1].

  

• HY-163109

  Carbonic anhydrase inhibitor 16	4479-70-3	98.00%
  Carbonic anhydrase inhibitor 16 (compound 1) is a dengue protease inhibitor with inhibitory activity against carbonic anhydrase hCA I and hCA II (Ki: 28.5 nM, 2.2 nM)[1].

  

• HY-17373R

  Posaconazole (Standard)	171228-49-2
  Posaconazole (Standard) is the analytical standard of Posaconazole. This product is intended for research and analytical applications. Posaconazole is a broad-spectrum, second generation, triazole compound with antifungal activity.

  

• HY-19285A

  Sulfaclozine sodium	23307-72-4	99.02%
  Sulfaclozine sodium (Sulfachloropyrazine sodium) is an efficacious sulphonamide derivative with antibacterial and anticoccidial effects. Sulfaclozine sodium is commonly used for the treatment of various poultry diseases (particularly, collibacteriosis, fowl cholera and coccidiosis)[1].

  

• HY-59121A

  Isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-alaninate	1337529-56-2
  Isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-alaninate can be used to synthesis Sofosbuvir (HY-15005) to avoid the production of sofibuvir degradation impurities[1].

  

• HY-B0132S

  Norfloxacin-d5	1015856-57-1	99.91%
  Norfloxacin-d5 is the deuterium labeled Norfloxacin. Norfloxacin is a broad-spectrum antibiotic that is active against both Gram-positive and Gram-negative bacteria, which functions by inhibiting DNA gyrase[1][2].

  

• HY-B0198A

  Cefaclor monohydrate	70356-03-5
  Cefaclor is a well-absorbed orally active cephalosporin antibiotic. Cefaclor can specifically bind to specific for penicillin-binding protein 3 (PBP3). Cefaclor can be used for the research of depression and kinds of infections caused by bacteria, such as respiratory tract infections, bacterial bronchitis, pharyngitis and skin infections[1][2][3][4].

  

• HY-B0691A

  Ecabet sodium	86408-72-2
  Ecabet sodium (TA-2711) is currently applied to some gastrointestinal disease by inhibiting the ROS production and improving Helicobacter pylori eradication[1]. Ecabet sodium reduces apoptosis[2].

  

• HY-B1119S

  Triclosan-d3	1020719-98-5	98.22%
  Triclosan-d3 is the deuterium labeled Triclosan. Triclosan is an antibacterial and antifungal agent found in consumer products, including soaps, detergents, toys, and surgical cleaning treatments[1][2].

  

• HY-B1624A

  Debrisoquin hemisulfate	581-88-4	99.94%
  Debrisoquin (Isocaramidine) hemisulfate is a TMPRSS2 inhibitors that inhibits SARS-CoV-2 entry into human lung cell line by a TMPRSS2-depedent manner, with an IC50 of 22μM. Debrisoquin hemisulfate can be used for antiviral research[1].

  

• HY-B1690A

  Methdilazine hydrochloride	1229-35-2
  Methdilazine hydrochloride is an orally active antibiotic (histamine antagonist). Methdilazine hydrochloride can inhibit various mycobacterium with MIC values at 5-15 μg/mL in vitro and in vivo, which can be used for the research of infectious diseases[1][2].

  

• HY-D0143B

  Quinine hemisulfate hydrate	207671-44-1	99.42%
  Quinine hemisulfate hydrate, an alkaloid derived from the bark of the cinchona tree, acts as an anti-malaria agent. Quinine hemisulfate hydrate is a potassium channel inhibitor that inhibits WT mouse Slo3 (KCa5.1) channel currents evoked by voltage pulses to +100 mV, with an IC50 of 169 μM[1][2].

  

• HY-N0150R

  Monensin (sodium) (Standard)	22373-78-0
  Monensin (sodium) (Standard) is the analytical standard of Monensin (sodium). This product is intended for research and analytical applications. Monensin (Monensin A) sodium, an orally active antibiotic, is an ionophore that mediates Na+/H+ exchange. Monensin sodium is a potent Wnt signaling inhibitor. Monensin sodium causes a marked enlargement of the multivesicular bodies (MVBs) and regulates exosome secretion. Monensin sodium can be used for bacterial, fungal, and parasitic infections research, and shows anticancer effects[1][2][3][4].

  

• HY-N10096

  Epoxyazadiradione	18385-59-6	99.21%
  Epoxyazadiradione is a limonoid purified from neem (Azadirachta indica) fruits. Epoxyazadiradione inhibits the tautomerase activity of MIF of both human (huMIF) and malaria parasites (Plasmodium falciparum (PfMIF) and Plasmodium yoelii (PyMIF)) non-competitively in a reversible fashion (Ki, 2.11-5.23 μM). Epoxyazadiradione has the potential against proinflammatory reactions induced by MIF of both malaria parasites and human[1].

  

• HY-N10264

  Avrainvillamide	269741-97-1
  Avrainvillamide ((+)-Avrainvillamide) is a naturally occurring alkaloid with antiproliferative effects, binds to the nuclear chaperone nucleophosmin, a proposed oncogenic protein that is overexpressed in many different human tumors. Avrainvillamide affects cell biology both by directly binding NPM1 and Crm1 as well as by inhibiting the association of these proteins with certain native cellular partners. Avrainvillamide, an antibiotic, inhibits growth of multi-agent resistant Staphylococcus aureus, Streptococcus pyogenes, and Enterococcus faecalis, with MICs of 12.5, 12.5 and 25 μg/ml, respectively[1][2][3].

  

• HY-N10534

  Lewis X trisaccharide	71208-06-5
  Lewis X trisaccharide (Lewis X, Lex) is a potent TH2 regulator, antagonizes LPS-induced IL-12 immune expression. Lewis X trisaccharide is a human histo-blood group antigen, plays an key role in cell-cell adhesion, and servers as a tumor marker. Lewis X trisaccharide is highly expressed in the outer membrane of the parasite, can be used for the immunology research of schistosomiasis[1][2][3].

  

• HY-N8015S

  Octanal-d16	1219794-66-7
  Octanal-d16 is the deuterium labeled Octanal. Octanal is a fragrant aldehyde with antioxidant and antibacterial activity. Its antifungal effect against G. citri-aurantii may be related to the disruption of cell membrane integrity and the leakage of cellular components. Additionally, Octanal exhibits cytotoxicity towards HeLa cells, with an IC50 value of 3.5 μg/mL[1][2].

  

• HY-N8515C

  UDP-3-O-acyl-GlcNAc disodium
  UDP-3-O-acyl-GlcNAc (UDP-3-O-(3-hydroxytetradecanoyl)-N-acetylglucosamine) disodium is an E. coli metabolite that is involved in 3-deoxy-D-manno-octulosonate (KDO) biosynthesis pathway[1].

  

• HY-P0263A

  Dermaseptin TFA	646451-06-1	99.21%
  Dermaseptin TFA, a peptide isolated from frog skin, exhibits potent antimicrobial activity against bacteria, fungi, and protozoa at micromolar concentration[1].

  

• HY-P0285A

  Rabies Virus Glycoprotein TFA		98.32%
  Rabies Virus Glycoprotein (TFA) is a 29-amino-acid cell penetrating peptide derived from a rabies virus glycoprotein that can cross the blood-brain barrier (BBB) and enter brain cells[1].

  

• HY-P10056

  HEP-1	174641-44-2	98.01%
  HEP-1 (Human ezrin peptide (324 - 337)) is an orally active peptide with antiviral, anti-inflammatory, and immunomodulatory activities. HEP-1 is effective against infections by various viruses such as HIV, HCV, herpes viruses, HPV, and influenza viruses. As an immunomodulator, HEP-1 can enhance the adaptive immunity mediated by B cells and T cells. HEP-1 can also increase the antibody titers after hepatitis B vaccination. HEP-1 can be used in the research of viral infections and inflammation-related diseases[1][2].

  

• HY-P1028A

  Hexa-D-arginine TFA	958204-56-3	98.42%
  Hexa-D-arginine TFA (Furin Inhibitor II TFA) is a stable furin inhibitor with Ki values 106 nM, 580 nM and 13.2 μM for furin, PACE4 and prohormone convertase-1 (PC1), respectively. Hexa-D-arginine TFA blocks Pseudomonas exotoxin A and anthrax toxins toxicity in vitro and in vivo[1][2][3].

  

• HY-P10857

  Microcin J25	145538-47-2	98.46%
  Microcin J25 (MccJ25) is a cyclic peptide antibiotic consisting of 21 unmodified amino acid residues. Microcin J25 inhibits DNA-dependent RNA polymerase (RNAP) of Gram-negative bacteria. Microcin J25 has antibacterial activity[1][2].

  

• HY-P1513A

  LL-37 scrambled peptide acetate		99.79%
  LL-37 scrambled peptide acetate is a scrambled version of cathelicidin anti-microbial peptide LL-37. LL-37 scrambled peptide acetate can be used as a negative control of LL-37 peptide studies.

  

• HY-P2260B

  Tat-beclin 1 scrambled		99.01%
  Tat-beclin 1 scrambled is the scrambled part and a scrambled control of Tat-beclin 1 (HY-P2260), which is derived from a region of the autophagy protein, beclin 1. beclin 1 induces autophagy via binding human immunodeficiency virus, HIV-1 Nef and interacting with negative regulator GAPR-1 (GLIPR2). Tat-beclin 1 decreases the accumulation of polyglutamine expansion protein aggregates and the replication of several pathogens, such as HIV-1. Tat-beclin 1 also reduces mortality in mice infected with chikungunya or West Nile virus[1].

  

• HY-P3459A

  Tet-213 TFA		99.90%
  Tet-213 TFA is a antimicrobial peptide. Tet-213 TFA has broad spectrum antibacterial activity. Tet-213 TFA can promote infected wound repair[1].

  

• HY-P5089A

  Enterotoxin STp (E. coli) TFA		99.50%
  Enterotoxin STp (E. coli) TFA is a heat-stable enterotoxin that can be used in vaccine research[1].

  

• HY-P99102

  Zinlirvimab	2417213-75-1	98.87%
  Zinlirvimab is a human IgG1-λ2, HIV neutralising antibody targeting to HIV-1 gp120 envelope glycoprotein (IIIB gp120 V3 loop)[1][2].

  

• HY-P99423

  Adintrevimab	2516243-54-0
  Adintrevimab (ADG 20) is a human IgG1 monoclonal SARS-CoV (SARS-CoV) antibody. Adintrevimab inhibits SARS-CoV-2 variants and other SARS-like coronaviruses with pandemic potential[1].

  

• HY-100540B

  Golgicide A-2	1394285-50-7	99.53%
  Golgicide A-2 (GCA-2), a Golgicide A (GCA) derivative, is the most active enantiomer of GCA. Golgicide A-2 displays high selectivity and efficiency in killing An. stephensi larvae and can be used for the research of dengue virus related diseases[1].

  

• HY-101441A

  ST-193 hydrochloride	2320274-72-2	98.76%
  ST-193 hydrochloride is a potent broad-spectrum arenavirus inhibitor; inhibits Guanarito, Junin, Lassa and Machupo virus with IC50 values of 0.44, 0.62, 1.4 and 3.1 nM, respectively.

  

• HY-106257A

  Ceftolozane TFA	1628046-32-1	98.17%
  Ceftolozane TFA is a cephalosporin antibiotic that can be used to inhibit Gram-negative bacterial infections. Ceftolozane TFA can be used to synthesize new antibiotic that are more potent and safer[1].

  

• HY-108402A

  Cefodizime sodium	86329-79-5	99.88%
  Cefodizime sodium is a third generation cephalosporin antibiotic with a broad spectrum of antibacterial activity. Cefodizime sodium has no renal toxic effect, good tolerance and immune regulation activity, and can be used for the research of severe infections of the respiratory and urinary tracts[1][2].

  

• HY-115448A

  Bio-AMS TFA
  Bio-AMS (TFA) is a potent bacterial biotin protein ligase inhibitor. Bio-AMS (TFA) possesses selective activity against Mycobacterium tuberculosis (Mtb) and arrests fatty acid and lipid biosynthesis[1].

  

• HY-136298A

  X77	2455518-33-7	99.95%
  X77 is a potent non-covalent inhibitor of the main protease of SARS-CoV-2 (SARS-CoV-2 Mpro)[1]. X77 binds to SARS-CoV-2 Mpro with a Kd value of 0.057 μM[2].

  

• HY-137989A

  Voriconazole N-oxide hydrochloride		99.52%
  Voriconazole N-oxide (Voriconazole oxynitride) (hydrochloride) is the main metabolite of Voriconazole (HY-76200) , a widely used triazole antibiotic (fungal). Voriconazole N-oxide (hydrochloride) provides information on the patient's drug metabolism capacity[1].

  

• HY-139554A

  Zifanocycline TFA		99.79%
  Zifanocycline (KBP-7072) TFA is an orally active, semi-synthetic aminomethylcycline antibiotic that inhibits the normal function of bacterial ribosomes. Zifanocycline TFA has broad spectrum in vitro antimicrobial activity against Gram-positive and Gram-negative bacteria, including many multidrug-resistant pathogens. Zifanocycline TFA is indicated for the study of acute bacterial skin and skin structure infections, community-acquired bacterial pneumonia, and complicated intra-abdominal infections[1][2].

  

• HY-141535A

  IL-17 modulator 1 disodium	2446803-91-2	98.38%
  IL-17 modulator 1 (disodium) is an orally active, highly efficacious IL-17 modulator extracted from patent WO 2020127685. IL-17 modulator 1 (disodium) can be used for the research of diseases including psoriasis, ankylosing spondylitis and psoriatic arthritis[1].

  

• HY-150734A

  ODN 2007 sodium
  ODN 2007 sodium, a class B CpG ODN (oligodeoxynucleotide), is a Toll-like receptor (TLR) ligand. ODN 2007 sodium can be used as an immunomodulator, vaccine adjuvant, and enhance immune responses in mammals, fish, and humans. ODN 2007 sequence: 5'-TCGTCGTTGTCGTTTTGTCGTT-3'[1][2][3].

  

• HY-150736A

  ODN 20844 sodium
  ODN 20844 sodium, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 sodium disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3'[1].

  

• HY-157346A

  LB Agar
  LB Agar is a growth media for the cultivation of a wide variety of microorganisms[1].

  

• HY-17514S1

  Itraconazole-d3	1217512-35-0	99.62%
  Itraconazole-d3 is the deuterium labeled Itraconazole (HY-17514)[1].

  

• HY-B0272S2

  Rifampicin-d4		99.69%
  Rifampicin-d4 is the deuterium labeled Rifampicin. Rifampicin is a potent and broad spectrum antibiotic against bacterial pathogens. Rifampicin has anti-influenza virus activities.

  

• HY-B0497S1

  Niclosamide-13C6	1325808-64-7
  Niclosamide-13C6 is the 13C6 labeled Niclosamide. Niclosamide (BAY2353) is an orally bioavailable chlorinated salicylanilide, with anthelmintic and potential antineoplastic activity. Niclosamide (BAY2353) inhibits STAT3 with IC50 of 0.25 μM in HeLa cells and inhibits DNA replication in a cell-free assay.

  

• HY-B0537AS

  Pentamidine-d4 dihydrochloride	1276197-32-0
  Pentamidine-d4 (dihydrochloride) is the deuterium labeled Pentamidine dihydrochloride. Pentamidine dihydrochloride (MP-601205 dihydrochloride) is an antimicrobial agent and interferes with DNA biosynthetics. Pentamidine dihydrochloride inhibits parasite Leishmania infantum with an IC50 of 2.5 μM. Pentamidine dihydrochloride is a potent and selective protein tyrosine phosphatases (PTPases) and phosphatase of regenerating liver (PRL) inhibitor. Pentamidine dihydrochloride has the potential for Gambian trypanosomiasis, antimony-resistant leishmaniasis, and Pneumocystis carinii pneumonia treatment. Antitumor and antibacterial activities[1][2][3][4].

  

• HY-B1374S1

  Florfenicol-d3	2213400-85-0	99.90%
  Florfenicol-d3 is the deuterium labeled Florfenicol. Florfenicol, a commonly used veterinary antibiotic, is currently indicated for bovine respiratory disease, and also used in aquaculture for the control of enteric septicemia in catfish. Florfenicol can induce early embryonic death in eggs, with an LC50 of 1.07 μg/g.

  

• HY-U00007A

  Stilbamidine dihydrochloride	6935-63-3
  Stilbamidine dihydrochloride is a diamidine compound derived from Stilbene and used chiefly in the form of its crystalline isethionate salt in treating various fungal infections.

  

• HY-W010649

  Isoxazole	288-14-2
  Isoxazole is a member of the five-membered heterocycle drug scaffold. Isoxazole has been used as a BET bromodomain inhibitor and can improve β-cell function in a diabetic mouse model. Isoxazole and its derivatives exhibit broad biological activities (such as antimicrobial, antibacterial, antifungal, antiviral, anticancer, anti-inflammatory, immunomodulatory, analgesic, anti-tuberculosis, and anti-diabetic effects). For example, the bicyclic Isoxazole can act as an HSP90 inhibitor, and the tricyclic Isoxazole is promising as a selective multidrug resistance protein (MRP1) inhibitor​[1][2][3][4][5].

  

• HY-W011117

  Danofloxacin	112398-08-0	98.47%
  Danofloxacin is a third generation fluoroquinolone and orally active antimicrobial agent. Danofloxacin shows a broad spectrum of activity against most Gram-negative and Gram-positive bacteria, mycoplasma and chlamydia species, and plays an antimicrobial role by inhibition of bacterial DNA-gyrase. Danofloxacinh has the potential for respiratory diseases in cattle, swine, and chickens treatment[1][2].

  

• HY-W011138

  Ibacitabine	611-53-0
  Ibacitabine, an antiviral compound, can be used for gene sequencing[1].

  

• HY-W011517

  2-Fluoroadenosine	146-78-1
  2-Fluoroadenosine (2FA) is a nucleoside analogue. 2-Fluoroadenosine has antibacterial activity with IC50 value of 0.842 mM for Vibrio microvibrio[1].

  

• HY-W015954

  (2R,3R)-Butane-2,3-diol	24347-58-8	99.17%
  (2R,3R)-Butane-2,3-diol is a non-covalent, reversible agonist targeting lanthanum (La3+)-sensitive calcium channels in bacteria (e.g., Escherichia coli) with an EC50 of approximately 25 mM. (2R,3R)-Butane-2,3-diol binds to calcium channel proteins or related complexes, induces channel opening, promotes extracellular calcium influx, and triggers intracellular calcium transients, which may regulate bacterial physiological activities such as growth, metabolism, and signal transduction. (2R,3R)-Butane-2,3-diol mediates bacterial-host cell signaling interactions and affects the metabolic balance of intestinal microorganisms, and can be used to study lactose intolerance and other related diseases[1].

  

• HY-W017194

  2-Phenylbutanoic acid	90-27-7
  2-Phenylbutanoic acid is a monocarboxylic acid. 2-Phenylbutanoic acid interacts with proteins. 2-Phenylbutanoic acid is used in the study of malignant lymphoma and HIV virus-related diseases[1][2].

  

• HY-W019852

  Flutriafol	76674-21-0	98.08%
  Flutriafol is a triazole fungicide with broad spectrum fungicidal activity.

  

• HY-W035051

  TSPP tetrasodium	39050-26-5
  TSPP tetrasodium is a photosensitizer that has shown impressive effects in in vivo regression of cancer and microorganism infections (Ex: 413 nm, Em: 640 nm)[1][2].

  

• HY-W073074

  Mesoporphyrin IX dihydrochloride	68938-72-7
  Mesoporphyrin IX (dihydrochloride) is a photosensitizer that can be used to modify liposomes. Mesoporphyrin IX (dihydrochloride) can insert into lipid vesicles and disrupt the viral membrane structure in vesicular stomatitis virus (VSV), inducing cross-linking of VSV glycoproteins, thereby inhibiting viral activity[1].

  

• HY-W102322

  5'-O-DMT-2'-TBDMS-Uridine	81246-80-2	99.11%
  5'-O-DMT-2'-TBDMS-Uridine is a deoxyribonucleoside used for the oligonucleotide synthesis.

  

• HY-W108875

  Mupirocin lithium	73346-79-9
  Mupirocin (BRL-4910A) lithium is an orally active antibiotic isolated from Pseudomonas fluorescens. Mupirocin lithium apparently exerts its antimicrobial activity by reversibly inhibiting isoleucyl-transfer RNA, thereby inhibiting bacterial protein and RNA synthesis[1][2][3][4][5].

  

• HY-W588256

  12-Tridecenoic acid	6006-06-0
  12-Tridecenoic acid is a metabolite of intestinal flora, which can promote the expression of acetyl-CoA carboxylase α (ACC) and inhibit the expression of carnitine palmitoyltransferase 1A (CPT1A), thereby aggravating hepatic steatosis. 12-Tridecenoic acid aggravates hepatic steatosis by affecting the ACC-CPT1A axis[1].

  

• HY-W749867

  Ca(II)-EDTA disodium dihydrate	6766-87-6
  CaⅡ-EDTA disodium dihydrate (Calcium disodium EDTA dihydrate) is an orally active metal chelating reagent, exhibits bactericidal activities against periodontal pathogens Aggregatibacter actinomycetemcomitans, Prevotella intermedia and Porphyromonas gingivalis[1]. CaⅡ-EDTA disodium dihydrate is effective chelating antidotes for lead- and cadmium poisoning[2][3].

  

• HY-W790014

  Z-FG-NHO-BzOME	180313-86-4	98.14%
  Z-FG-NHO-BzOME is a cysteine protease inhibitor that selectively inhibits cathepsin B, cathepsin L, cathepsin S, and papain[1].

  

• HY-138615S2

  Deoxythymidine-5'-triphosphate-13C10 dilithium
  Deoxythymidine-5'-triphosphate-13C10 (dTTP-13C10) dilithium is 13C-labeled Deoxythymidine-5'-triphosphate (HY-138615). Deoxythymidine-5'-triphosphate (dTTP) is one of the four nucleoside triphosphates. Deoxythymidine-5'-triphosphate (dTTP) is used in the synthesis of DNA.

  

• HY-W002620A

  Emoxypine succinate	127464-43-1	99.88%
  Emoxypine succinate is an antioxidant. Emoxypine succinate can be used for the research of post-traumatic[1].

  

• HY-W013605A

  4-Methoxycinnamaldehyde	1963-36-6	99.30%
  4-Methoxycinnamaldehyde (p-Methoxycinnamaldehyde), an active constituent of Agastache rugosa, exhibits cytoprotective activity against respiratory syncytial virus (RSV) in human larynx carcinoma cell line. 4-Methoxycinnamaldehyde effectively inhibits cytopathic effect of RSV with an estimated IC50 of 0.055 μg/mL[1].

  

• HY-14990

  Sudoterb	676266-31-2	98.38%
  Sudoterb (LL 3858) is an orally active anti-Tuberculosis agent[1].

  

• HY-15975

  GNF179	1261114-01-5	98.17%
  GNF179 is an optimized 8,8-dimethyl imidazolopiperazine analog that exhibits antimalarial potency (IC50 of 4.8 nM against the multidrug resistant strain W2). GNF179 is orally active[1].

  

• HY-16102

  Bismuth subcitrate potassium	880149-29-1
  Bismuth subcitrate potassium is a compound bismuth salt with oral activity. Bismuth subcitrate potassium has antibacterial activity and can inhibit the growth of Campylobacter pyloridis with a MIC50 of 8 μg/mL. Bismuth subcitrate potassium can be used in the study of gastrointestinal diseases infected by Campylobacter pyloridis[1][2][3].

  

• HY-18601

  (±)-BI-D	1416258-16-6	98.06%
  (±)-BI-D is a potent ALLINI(An allosteric IN inhibitor) that binds integrase at the LEDGF/p75 binding site.

  

• HY-21745

  MurA-IN-4	318280-69-2
  MurA-IN-4 has antibacterial activity and is a MurA inhibitor that inhibits bacterial cell wall synthesis[1].

  

• HY-79635

  Methyl indole-3-carboxylate	942-24-5	99.89%
  Methyl indole-3-carboxylate is a natural product isolated from Sorangium cellulosum strain Soce895. Methyl indole-3-carboxylate shows a weak activity against the Gram-positive Nocardia sp with a MIC value of 33.33 μg/mL[1].

  

• HY-B0187

  Doripenem	148016-81-3	99.94%
  Doripenem (S 4661), a 1β-methyl parenteral carbapenem, has very broad-spectrum activity against Gram-positive and Gram-negative aerobic bacteria[1][2].

  

• HY-B0894

  Resorcinol monoacetate	102-29-4
  Resorcinol monoacetate (Acetylresorcinol) is a derivative of Resorcinol (HY-B0907). Resorcinol monoacetate can be used in research of skin infections such as acne, seborrheic dermatitis and tinea pedis[1].

  

• HY-B0930

  Efloxate	119-41-5	99.73%
  Efloxate (Angorlisin) is a vasodilator used in the research of chronic coronary insufficiency and angina pectoris. Efloxate binds to Staphylococcus aureus sortase A[1].

  

• HY-B1093

  Fenchlorphos	299-84-3	99.87%
  Fenchlorphos, an organophosphate, is an insecticide. Fenchlorphos is an inhibitor of the enzyme acetylcholinesterase (AChE). Fenchlorphos is able to cause mitochondrial dysfunction[1][2].

  

• HY-B1111

  Amitraz	33089-61-1
  Amitraz is a non-systemic acaricide and insecticide with alpha-adrenergic agonist activity that interacts with octopamine receptors in the central nervous system and inhibits monoamine oxidase and prostaglandin synthesis[1][2].

  

• HY-B1166

  Cefamandole nafate	42540-40-9
  Cefamandole nafate (Cefamandole formate sodium) is a second-generation broad-spectrum cephalosporin antibiotic[1].

  

• HY-B1177

  Crotamiton	483-63-6
  Crotamiton is a drug that is used both as a scabicidal (for treating scabies) and as a general antipruritic.

  

• HY-B1466

  Mezlocillin sodium	42057-22-7	98.06%
  Mezlocillin (BAY-f 1353) sodium is a β-lactam antibiotic, a semisynthetic and extended-spectrum antibiotic. Mezlocillin sodium is active against both gram-negative and gram-positive bacteria. Mezlocillin sodium can be used in bacterial infection research[1][2].

  

• HY-B1629

  Dichlorodiphenylmethane	2051-90-3
  Dichlorodiphenylmethane is a drug intermediate, which is widely used in the fields of pesticide, dye and medicine[1].

  

• HY-B1703

  Nifursol	16915-70-1	98.17%
  Nifursol is an orally active veterinary antibiotic. Nifursol inhibits Histomonas meleagridis. Nifursol prevents histomoniasis in turkeys. Nifursol is widely used in studies of Escherichia coli gastroenteritis in Salmonella-infected poultry and aquatic animals[1][2][3].

  

• HY-B1870

  Metaldehyde	108-62-3
  Metaldehyde is a commonly used pesticide for mollusks such as slugs and snails.

  

• HY-D0179

  Cyclam	295-37-4
  Cyclam is a metal chelator that forms metal complexes with a variety of metal ions. Cyclam metal complexes exhibits anti-HIV (such as AMD3100), nitric oxide (NO) releasing and scavenging (such as Zn(II)-Cyclam and Ru(II)-Cyclam), and SOD mimetic (such as Mn(III)-Cyclam and Zn(II)-Cyclam) activities[1].

  

• HY-N2145

  4',7-Dimethoxyisoflavone	1157-39-7	98.20%
  4',7-Dimethoxyisoflavone is isolated from the leaves of Albizzia lebbeck, which shows antifungal activity[1].

  

• HY-P5589

  Plantaricin A	131463-18-8	99.45%
  Plantaricin A is an antimicrobial peptide derived from LactobacifZus plantarum against bacteria[1].

  

• HY-Y1777

  2-Phenylacetophenone	451-40-1	99.96%
  2-Phenylacetophenone has broad-spectrum efflux pump inhibition activity. 2-Phenylacetophenone is a benzoin derivative used as a photoinitiator in vinyl polymerization[1].

  

• HY-107483

  Cambendazole	26097-80-3	98.83%
  Cambendazole is one of the most effective agents for the research of human strongyloidiasis and [1].

  

• HY-10844S

  Pretomanid-d4	1346617-34-2
  Pretomanid-d4 is the deuterium labeled Pretomanid. Pretomanid (PA-824) is an antibiotic used for the research of multi-drug-resistant tuberculosis affecting the lungs. Pretomanid exhibits a sub-micromolar MIC against M. tuberculosis (MTB). The MIC values of PA-824 against a panel of MTB pan-sensitive and Rifampin mono-resistant clinical isolates range from 0.015 to 0.25 μg/mL[1][2].

  

• HY-117397

  Fenazaquin	120928-09-8	99.78%
  Fenazaquin (XDE-436; EL-436) is a quinazoline acaricide[1].

  

• HY-122046

  Amb123203	956571-77-0	98.87%
  Amb123203 is an antiviral compound with the activity of inhibiting viral budding. Amb123203 exerts its effect by blocking the interaction between mVP40 and Nedd4 proteins. Amb123203 has a significant inhibitory effect on the budding of VP40 virus-like particles (VLPs) of Marburg (MARV) and Ebola viruses. Amb123203 can effectively target RNA viruses that rely on the PPxY L domain for efficient budding, showing broad-spectrum antiviral activity. The discovery of Amb123203 provides an important basis for the development of new broad-spectrum antiviral compounds[1].

  

• HY-133825

  Cyazofamid	120116-88-3	98.15%
  Cyazofamid exerts its bactericidal effect by impairing ATP production. Cyazofamid inhibits organic cation transporter 3 (OCT3) and OAT1, with IC50 values ​​of 1.54 and 17.3 μM, respectively[1][2][3].

  

• HY-134891

  HMBPP lithium	396726-03-7
  HMBPP lithium is an intermediate in isoprenoid biosynthesis that can be produced by bacteria and protozoa that use the non-mevalonate pathway for isoprenoid biosynthesis. HMBPP lithium is a ligand of the internal domain of BTN3A1 and is an activator for human Vγ9/Vδ2 T cells. HMBPP lithium exhibits phagostimulant property in mosquitos[1][2][3][4].

  

• HY-139587

  Umifoxolaner	2021230-37-3	99.97%
  umifoxolaner (ML-878) is a γ-aminobutyric acid (GABA) regulated chloride channels antagonist. Umifoxolaner is an anti-parasitic agent[1].

  

• HY-157478

  CSNK2A-IN-1	3029550-24-8	98.46%
  CSNK2A-IN-1 (compound 7C) is a selective CSNK2A inhibitor. CSNK2A-IN-1 has antiviral activity and improved selectivity over PIM3[1].

  

• HY-161762

  RA-0002034	3038542-51-4	99.48%
  RA-0002034 is a Chikungunya virus (CHIKV) nsP2 protease inhibitor with an IC50 of 58 nM. RA-0002034 covalently modifies the catalytic cysteine in a site-specific manner[1].

  

• HY-164051

  1650-M15	850935-88-5	99.33%
  1650-M15 is an inhibitor of lipoteichoic acid synthase (LtaS). It has inhibitory activity against Gram-positive bacteria but has no significant inhibitory effect against Gram-negative bacteria. The IC50s of 1650-M15 against MRSA and MSSA are 62.44 μM and 66.42 μM, respectively, and the MICs are both 200 μM[1].

  

• HY-17363R

  Dimethyl fumarate (Standard)	624-49-7
  Dimethyl fumarate (Standard) is the analytical standard of Dimethyl fumarate. This product is intended for research and analytical applications. Dimethyl fumarate (DMF) is an orally active and brain-penetrant Nrf2 activator and induces upregulation of antioxidant gene expression. Dimethyl fumarate induces necroptosis in colon cancer cells through GSH depletion/ROS increase/MAPKs activation pathway, and also induces cell autophagy. Dimethyl fumarate can be used for multiple sclerosis research[1][2].

  

• HY-B0200A

  Cephalexin hydrochloride	59695-59-9	99.77%
  Cephalexin (Cefalexin) hydrochloride is a potent, orally active new semisynthetic cephalosporin antibiotic with a broad antibacterial spectrum. Cephalexin (Cefalexin) hydrochloride has antibacterial activity against a wide variety of gram-positive and gram-negative bacteria. Cephalexin (Cefalexin) hydrochloride targets penicillin-binding proteins (PBPs) to inhibit bacterial cell wall assembly. Cephalexin (Cefalexin) hydrochloride is used for the research of pneumonia, strep throat, and bacterial endocarditis, et al[1][2].

  

• HY-B0215A

  Acetylcysteine (extracted from plants)	616-91-1	100.45%
  Acetylcysteine (N-Acetylcysteine) extracted from plants is derived from plants and is an antioxidant and mucolytic agent that enhances the reserve of free radical scavengers in cells. It has been reported to prevent neuronal apoptosis while inducing apoptosis in smooth muscle cells. In addition, it inhibits HIV replication and serves as a substrate for microsomal glutathione transferase. This endogenous aminothiol is found in human plasma and urine and is commonly used as a mucolytic agent in clinical settings, usually administered by inhalation.

  

• HY-B0239R

  Chloramphenicol (Standard)	56-75-7
  Chloramphenicol (Standard) is the analytical standard of Chloramphenicol. This product is intended for research and analytical applications. Chloramphenicol is an orally active, potent and broad-spectrum antibiotic. Chloramphenicol shows antibacterial activity. Chloramphenicol represses the oxygen-labile transcription factor and hypoxia inducible factor-1 alpha (HIF-1α) in hypoxic A549 and H1299 cells. Chloramphenicol suppresses the mRNA levels of vascular endothelial growth factor (VEGF) and glucose transporter 1, eventually decreasing VEGF release. Chloramphenicol can be used for anaerobic infections and lung cancer research[1][2][3].

  

• HY-B0417A

  Lincomycin hydrochloride	859-18-7
  Lincomycin Hydrochloride(U10149A) is an antibiotic produced by Streptomyces lincolnensis var.

  

• HY-B0490R

  Hygromycin B (Standard)	31282-04-9
  Hygromycin B (Standard) is the analytical standard of Hygromycin B. This product is intended for research and analytical applications. Hygromycin B is an aminoglycoside antibiotic active against prokaryotic and eukaryotic cells.

  

• HY-B0519B

  Tylosin phosphate	1405-53-4	99.27%
  Tylosin phosphate is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin tartrate exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin phosphate is widely used as a feed additive for promoting animal growth. Tylosin phosphate is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle[1][2][3].

  

• HY-B1894A

  Cefetamet pivoxil hydrochloride	111696-23-2
  Cefetamet pivoxil hydrochloride is an oral third generation cephalosporin antibiotic.

  

• HY-B1923S

  Piperacillin-d5
  Piperacillin-d5 is deuterium labeled Piperacillin. Piperacillin is kind of semisynthetic penicillins. Piperacillin has a broad spectrum of activity against Gram-positive and Gram-negative aerobic and anaerobic bacteria. Piperacillin has shown greater activity against β-lactamase-producing organisms than the other penicillins[1].

  

• HY-N0709R

  Coumarin (Standard)	91-64-5
  Coumarin (Standard) is the analytical standard of Coumarin. This product is intended for research and analytical applications. Coumarin is a potent and orally active anti-inflammatory agent. Coumarin shows an antinociceptive effect. Coumarin shows antibacterial, antifungal and anticancer activity[1][2].

  

• HY-N12513

  Cyclo(L-Phe-trans-4-OH-L-Pro)	118477-06-8	99.76%
  Cyclo(L-Phe-trans-4-OH-L-Pro) is an antifungal peptides[1].

  

• HY-P10396

  Elf18	849352-44-9	99.28%
  Elf18 is a peptide fragment of bacterial translation elongation factor Tu (EF-Tu). Elf18 can be recognized by plant pattern recognition receptors, thereby inducing an immune response. Elf18 can enhance plants' resistance to pathogens and can be used in research related to plant immune responses[1][2].

  

• HY-P5062A

  DEC-RVRK-CMK TFA
  DEC-RVRK-CMK (Decanoyl-Arg-Val-Arg-Lys-chloromethylketone) TFA is a peptide-based CMK (chloromethylketone) inhibitor that targets and inactivates the secreted soluble kexin (Kex2) (Ki=8.45 μM). The yeast enzyme Kex2 (kexin, EC 3.4.21.61) is a calcium-dependent transmembrane protease and belongs to the mammalian protease family of the serine protease subtilisin family. The binding mechanism of Kex2 with different CMK inhibitors depends on substrate selectivity, particularly the selective differences between lysine and arginine at the P1 position[1].

  

• HY-Y0264R

  4-Hydroxybenzoic acid (Standard)	99-96-7
  4-Hydroxybenzoic acid (Standard) is the analytical standard of 4-Hydroxybenzoic acid. This product is intended for research and analytical applications. 4-Hydroxybenzoic acid, a phenolic derivative of benzoic acid, could inhibit most gram-positive and some gram-negative bacteria, with an IC50 of 160 μg/mL.

  

• HY-106233B

  Tiviciclovir hydrochloride		99.36%
  Tiviciclovir (AM188) hydrochloride is an antiviral guanosine analog and a hepatitis B virus inhibitor[1].

  

• HY-109025R

  Baloxavir marboxil (Standard)	1985606-14-1
  Baloxavir marboxil (Standard) is the analytical standard of Baloxavir marboxil. This product is intended for research and analytical applications. Baloxavir marboxil (S-033188) is a selective inhibitor of influenza cap-dependent endonuclease. Baloxavir marboxil, a potent antiviral agent, shows activity against influenza A and B virus[1].

  

• HY-B0210AR

  Cefoperazone (sodium salt) (Standard)	62893-20-3
  Cefoperazone (sodium salt) (Standard) is the analytical standard of Cefoperazone (sodium salt). This product is intended for research and analytical applications. Cefoperazone sodium salt (CP 52640-2), a semisynthetic cephalosporin, has a broad spectrum of antibacterial activity[1].

  

• HY-P10233A

  SAAP 148 TFA		99.72%
  SAAP 148 TFA is an antimicrobial and antibiofilm agent, and exhibits inhibitory efficacy against antibiotic-resistant pathogens, with LC50 of 0.8-12.8 μM[1].

  

• HY-W006672

  Dibenzo[b,e]oxepin-11(6H)-one	4504-87-4
  Dibenzo[b,e]oxepin-11(6H)-one (Compound 1a) is a dibenzoxepinone derivative that exhibits significant antiparasitic activity[1].

  

• HY-W012017

  2-Hydroxytetradecanoic acid	2507-55-3
  2-Hydroxytetradecanoic acid is a hydroxy fatty acid that inhibits cleavage between the enterovirus capsid proteins VP4 and VP2. 2-Hydroxytetradecanoic Acid has anti-virus activity[1].

  

• HY-W013158

  Trimethyloctadecylammonium bromide	1120-02-1
  Trimethyloctadecylammonium bromide is an inhibitor of dynamin, with an IC50 value of 1.9 μM for dynamin I. Trimethyloctadecylammonium bromide exhibits antibacterial activity against Staphylococcus aureus[1][2].

  

• HY-W015461

  2-Aminooctanoic acid	644-90-6
  2-Aminooctanoic acid (DL-α-Aminocaprylic acid) is a fatty acid with an amino functional group that can be directly coupled at both the C-terminal and N-terminal with antimicrobial peptides (AMP) derived from lactoferrin B to enhance antibacterial activity[1].

  

• HY-W016034

  Acetaminophen glucuronide sodium salt	120595-80-4
  Acetaminophen glucuronide is a safe and effective antipyretic analgesic. Acetaminophen glucuronide is potentially toxic to liver and kidney [1].

  

• HY-W017241

  1-Naphthalenemethanol	4780-79-4
  1-Naphthalenemethanol is a hydroxyl-substituted naphthalene derivative. 1-Naphthalenemethanol can be extracted from the root of Annona senegalensis. 1-Naphthalenemethanol is a photolysis product of 1-napthaleneacetic acid. 1-Naphthalenemethanol, together with PAPS, provides some protection against the irreversible inactivation of AST IV caused by N-OH-2AF. 1-Naphthalenemethanol can be used in antibacterial research[1][2][3][4].

  

• HY-W089538

  2-Ethyl-6-methylphenol	1687-64-5	98.79%
  2-Ethyl-6-methylphenol, an alkylphenol, is isolated form the tumorigenic neutral subfraction of cigarette smoke condensate. 2-Ethyl-6-methylphenol exhibits insecticidal and bactericidal activities[1][2].

  

• HY-W248907

  Gentisyl alcohol	495-08-9	98.91%
  Gentisyl alcohol has anti-Staphylococcus aureus activity[1].

  

• HY-W269306

  Bonaphthone	6954-48-9
  Bonaphthone is an antiviral agent with anti-DNA and -RNA viral activities[1].

  

• HY-W714137

  (6-Isothiocyanatohexyl)(methyl)sulfane	4430-39-1
  (6-Isothiocyanatohexyl)(methyl)sulfane (Lesquerellin; 6-Methylthiohexyl isothiocyanate) is an isothiocyanate found in wasabi (W. japonica) and has various biological activities. (6-Isothiocyanatohexyl)(methyl)sulfane is active against the bacterium Bacillus subtilis and the fungus T. mentagrophytes (MIC=25 μg/mL). (6-Isothiocyanatohexyl)(methyl)sulfane also has anthelmintic activity against blue mussel (M. edulis). (6-Isothiocyanatohexyl)(methyl)sulfane has antifouling activity when applied to polyvinyl chloride (PVC) panels at a concentration of 50 μmol/cm2 in a conventional immersion test.

  

• HY-W017522S

  Adipic acid-d10	25373-21-1	99.93%
  Adipic acid-d10 (Hexanedioic acid-d10) is the deuterium labeled Adipic acid (HY-W017522). Adipic acid (Hexanedioic acid) is an orally active compound with anti-HSV-1 activity. Adipic acid has low toxicity and can be used as a food additive and a gelling agent. Adipic acid can also be used in the synthesis of lubricants, artificial resins, plastics, etc[1][2].

  

• HY-W031471A

  Pyrazine-2-amidoxime	51285-05-3	99.90%
  Pyrazine-2-amidoxime is a structural analogue of pyrazine-2-carboxamide with antimicrobial activity. Pyrazine-2-amidoxime shows killing and inhibiting properties against Candida albicans, fungal pathogen and Gram-positive bacteria[1].

  

• HY-W250308A

  ε-Poly-L-lysine (hydrochloride) (MV 2000-5000)
  ε-Poly-L-lysine hydrochloride (MV 2000-5000) is an antimicrobial peptide that can be produced by bacteria such as Streptomyces. Epsilon-polylysine hydrochloride inhibits the growth of microorganisms such as bacteria, yeasts and molds and is therefore often used as a green food additive and preservative in various food and beverage products. Epsilon-polylysine hydrochloride has a variety of properties, including thermal stability, resistance to acidic conditions, and broad-spectrum antimicrobial activity. Epsilon-polylysine hydrochloride can be loaded on other materials to form nanoparticles or form nanofiber membranes for targeted delivery to exert sustained antibacterial efficacy. Epsilon-polylysine hydrochloride is also used as a liposome stabilizer[1][2][3][4].

  

• HY-W017522S1

  Adipic acid-13C6	942037-55-0
  Adipic acid-13C6 (Hexanedioic acid-13C6) is the 13C labeled Adipic acid (HY-W017522). Adipic acid (Hexanedioic acid) is an orally active compound with anti-HSV-1 activity. Adipic acid has low toxicity and can be used as a food additive and a gelling agent. Adipic acid can also be used in the synthesis of lubricants, artificial resins, plastics, etc[1][2].

  

• HY-W017522S2

  Adipic acid-d4	121311-78-2
  Adipic acid-d4 (Hexanedioic acid-d4) is the deuterium labeled Adipic acid (HY-W017522). Adipic acid (Hexanedioic acid) is an orally active compound with anti-HSV-1 activity. Adipic acid has low toxicity and can be used as a food additive and a gelling agent. Adipic acid can also be used in the synthesis of lubricants, artificial resins, plastics, etc[1][2].

  

• HY-N0895

  Britannilactone	33620-72-3	98.56%
  Britannilactone(Desacetylinulicin) is a methanol extract of the dried flower of Inula britannica L.

  

• HY-17520

  Penthiopyrad	183675-82-3
  Penthiopyrad (MTF-753) is a chiral carboxamide antifungal agent with a broad spectrum of fungicidal activity. Penthiopyrad can be used for controlling foliar and soil-borne plants diseases on a broad range of agricultural crops and turfgrass[1].

  

• HY-P0328

  VSV-G tag Peptide	103425-05-4	99.03%
  VSV-G Peptide is a 11 amino acid peptide derived from the Vesicular Stomatitis viral glycoprotein.

  

• HY-13207A

  ONX-0914 TFA
  ONX-0914 (PR-957) TFA is a selective inhibitor of low-molecular mass polypeptide-7 (LMP7), the chymotrypsin-like subunit of the immunoproteasome. ONX-0914 TFA blocks cytokine production and attenuates progression of experimental arthritis. ONX-0914 TFA is a noncompetitive irreversible inhibitor of the mycobacterial proteasome (Ki=5.2 μM). ONX-0914 TFA reactivates latent HIV-1 through p-TEFb activation mediated by HSF-1[1][2][3].

  

• HY-13579A

  BTZ043 Racemate	957217-65-1	98.77%
  BTZ043 Racemate (BTZ10526038) is the racemate of BTZ043. BTZ043 is an inhibitor of decaprenyl-phosphoribose-epimerase (DprE1), and the antimicrobial activity of BTZ043 is more potent than BTZ043 Racemate[1].

  

• HY-12946

  BI 653048	1198784-72-3	99.84%
  BI 653048 is a selective and orally active nonsteroidal glucocorticoid (GC) agonist with an IC50 value of 55 nM[1]. BI 653048 inhibits CP1A2, CYP2D6, CYP2C9, CYP2C19 and CYP3A4 isoforms’ activity and reduces affinity for the hERG ion channel (IC50>30 μM)[2]. BI 653048 is extracted from patent WO2005028501A1 (Compound 103), is also a HCV NS3 protease inhibitor that can reduce viral loads infected with the hepatitis C virus[3].

  

• HY-B0879

  Suramin	145-63-1
  Suramin is a reversible and competitive protein-tyrosine phosphatases (PTPases) inhibitor[1]. Suramin is a potent inhibitor of sirtuins: SirT1 (IC50=297 nM), SirT2 (IC50=1.15 μM), and SirT5 (IC50=22 μM)[2]. Suramin is a competitive inhibitor of reverse transcriptase (DNA topoisomerase II: IC50=5 μM)[3][4]. Suramin is a potent SARS-CoV-2 RNA-dependent RNA polymerase (RdRp) inhibitor[5].Suramin efficiently inhibits IP5K and is an antiparasitic, anti-neoplastic and anti-angiogenic agent[6][7][8].

  

• HY-B1454

  Clindamycin palmitate hydrochloride	25507-04-4
  Clindamycin palmitate hydrochloride is a hydrochloride salt of the ester of clindamycin and palmitic acid and it is an antibacterial agent. Clindamycin palmitate hydrochloride is inactive in vitro, rapid in vivo hydrolysis converts this compound to the antibacterially active clindamycin[1].

  

• HY-100586

  Ibuprofen L-lysine	57469-77-9	99.91%
  Ibuprofen ((±)-Ibuprofen) L-lysine is a potent orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen L-lysine inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen L-lysine is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen L-lysine can be used in the research of pain, swelling, inflammation, infection, immunology, cancers[1][2][3][4][5][6][7][8].

  

• HY-103583

  KDU731	1610610-48-4	99.52%
  KDU731, an orally active C. parvum PI4K inhibitor with an IC50 value of 25 nM, blocks Cryptosporidium infection in vitro and in vivo[1][2]. KDU731 is a promising agent candidate for the treatment of diarrhea caused by Cryptosporidium and meets a broad range of safety[2].

  

• HY-114314

  BA-53038B	2306195-65-1	98.73%
  BA-53038B is a HBV core protein allosteric modulator (CpAM), binding to the HAP pocket and modulating HBV capsid assembly. BA-53038B has antiviral activity for hepatitis B virus (HBV) with an EC50 value of 3.32 μM. BA-53038B can be used for the research of chronic hepatitis B[1].

  

• HY-120060

  GNF6702	1799329-72-8	98.48%
  GNF6702 is a selective inhibitor of the kinetoplastid proteasome. GNF6702 clears parasites in murine models of leishmaniasis, Chagas disease, and human African trypanosomiasis[1].

  

• HY-124679

  DS86760016	1853176-89-2	99.25%
  DS86760016 is a potent leucyl-tRNA synthetase (LeuRS) inhibitor with activity against multidrug-resistant (MDR) Gram-negative bacteria, such as Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa. DS86760016 inhibits LeuRS enzymes from Escherichia coli, Pseudomonas aeruginosa, and Acinetobacter baumannii, with IC50s of 0.38, 0.62, and 0.16 μM, respectively[1][2].

  

• HY-131059

  CBS1117	959245-08-0	99.76%
  CBS1117 is a virus entry inhibitor with an IC50 of 70 nM for influenza A virus, A/Puerto Rico/8/34 (H1N1). CBS1117 interferes with the hemagglutinin (HA)-mediated fusion process[1].

  

• HY-135655

  Fobrepodacin disodium	1384984-20-6	99.53%
  Fobrepodacin (SPR720) disodium is an orally active and potent phosphate proagent of SPR719 (VXc-486; HY-12930). Fobrepodacin disodium has potent bactericidal activities in vivo[1].

  

• HY-P0274A

  PGLa TFA		99.80%
  PGLa TFA, a 21-residue peptide, is an antimicrobial peptide. PGLa TFA is a member of the magainin family of antibiotic peptides found in frog skin and its secretions[1].

  

• HY-126810A

  NP213 TFA		99.80%
  NP213 TFA is a rapidly acting, novel, first-in-class synthetic antimicrobial peptide (AMP), has anti-fungal activities. NP213 TFA targets the fungal cytoplasmic membrane and plays it role via membrane perturbation and disruption. NP213 TFA is effective and well-tolerated in resolving nail fungal infections[1][2].

  

• HY-135867A

  NHC-triphosphate tetrasodium
  NHC-triphosphate tetrasodium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form[1]. NHC-triphosphate tetrasodium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA[1][2].

  

• HY-15256

  Faldaprevir	801283-95-4	98.58%
  Faldaprevir (BI 201335) is a potent, orally active and selective noncovalent inhibitor of NS3/4A protease of HCV (hepatitis C virus) genotypes 1a and 1b, with Ki values of 2.6 and 2.0 nM, respectively. Faldaprevir inhibits HCV RNA replication, with EC50 values of 6.5 and 3.1 nM, respectively. Faldaprevir has potent antiviral activity against chronic HCV infection[1][2].

  

• HY-B0159

  Balofloxacin	127294-70-6	98.26%
  Balofloxacin (Q-35) is an orally active fluoroquinolone antibiotic with broad-spectrum antibacterial activity against gram-negative, gram-positive, and anaerobic bacteria. Balofloxacin can be used for the research of respiratory, intestinal, and urinary tract infections[1][2].

  

• HY-101663

  Ruzasvir	1613081-64-3
  Ruzasvir (MK-8408) is an orally active inhibitor for genotypic HCV nonstructural protein 5A (NS5A), which inhibits the replication of NS5A mutants GT1a, GT1a L31V, GT1a Y93H, GT2b, GT3a and GT4a with EC90 ranging from 0.003 to 0.067 nM. Ruzasvir exhibits good pharmacokinetic characters in rhesus monkey model[1].

  

• HY-102068

  Clathrin-IN-1	1332879-52-3
  Clathrin-IN-1 is a selective clathrin-mediated endocytosis (CME) inhibitor. Clathrin-IN-1 selectively inhibits amphiphysin association of clathrin terminal domain (TD) with an IC50 value of 12 μM. Clathrin-IN-1 acutely interferes with receptor-mediated endocytosis, entry of HIV, and synaptic vesicle recycling[1].

  

• HY-124768

  PDE12-IN-3	1803357-22-3	98.02%
  PDE12-IN-3 is a phosphodiesterase 12 (PDE12) inhibitor with a pXC50 of 7.68. Antiviral activity[1].

  

• HY-130613

  MAC-545496	838810-96-1	98.01%
  MAC-545496 is a nanomolar inhibitor of glycopeptide-resistance-associated protein R (GraR). MAC-545496 displays strong binding affinity to the full-length GraR protein (Kd ≤ 0.1 nM). MAC-545496 is an antivirulence agent that reverses β-lactam resistance in Methicillin-resistant strains (MRSA)[1].

  

• HY-131179

  Influenza A virus-IN-1	2250313-14-3	99.88%
  Influenza A virus-IN-1 is a dihydropyrrolidones derivative and is a potent inhibitor against wide subtypes of influenza A virus (IAV) with IC50 values from 3.11 μM to 7.13 μM. Influenza A virus-IN-1 efficiently inhibits replication of IAV, up-regulates the expression of key antiviral cytokines IFN-β and antiviral protein MxA[1].

  

• HY-136149

  Mpro inhibitor N3	884650-98-0	99.96%
  Mpro inhibitor N3 is a potent SARS-CoV-2 MPro inhibitor with an EC50 value of 16.77 µM. Mpro inhibitor N3 shows antiviral activities against HCoV-229E, FIPV, IBV and MHV-A59[1][2][3].

  

• HY-139311

  YH-53	1471484-62-4	98.78%
  YH-53 is a potent 3CLpro inhibitor with Ki values of 6.3 nM, 34.7 nM for SARS-CoV-1 3CLpro and SARS-CoV-2 3CLpro, respectively. YH-53 strongly blocks the SARS-CoV-2 replication. YH-53 is a peptidomimetic compound with a unique benzothiazolyl ketone. YH-53 has the potential for COVID-19 research[1][2].

  

• HY-14648G

  Dexamethasone (GMP)	50-02-2
  Dexamethasone (Hexadecadrol) (GMP) is Dexamethasone (HY-14648) produced by using GMP guidelines. GMP small molecules works appropriately as an auxiliary reagent for cell therapy manufacture. Dexamethasone is an agonist of glucocorticoid receptor[1][2][3][4].

  

• HY-153094

  BDM-2	1643876-33-8	99.09%
  BDM-2 is an IN-LEDGF allosteric inhibitor (INLAI) of HIV-1 integrase (IN refers to integrase) (IC50=47 nM) with potent anti-Retroviral (ARV) activity. BDM-2 shows IN multimerization activation effect with an AC50 value of 20 nM. BDM-2 blocks the interaction between the catalytic core domain of IN (IN-CCD) and the Integrase binding domain of LEDGF/p75 (IBD), with an IC50 value of 0.15 μM. BDM-2 exhibits highly selective and favorable cytotoxicity[1].

  

• HY-B0887S

  Permethrin-d5	1794760-19-2
  Permethrin-d5 (NRDC-143-d5) is the deuterium labeled Permethrin. Permethrin (NRDC-143) is an insecticide, acaricide, and insect repellent; functions as a neurotoxin, affecting neuron membranes by prolonging sodium channel activation[1][2].

  

• HY-P99214

  Panobacumab	885053-97-4	98.24%
  Panobacumab (KBPA101) is a fully human IgM/κ monoclonal antibody generated by immortalizing human B lymphocytes against the LPS O polysaccharide of serotype O11 of P. aeruginosa[1].

  

• HY-P99343

  Atoltivimab	2135632-29-8	98.66%
  Atoltivimab (REGN3470), or maftivimab/odesivimab (Inmazeb) is the first Food and agent Administration (FDA)-approved monoclonal antibody to target Zaire ebolavirus (EBOVs) infection[1].

  

• HY-P99693

  Lenvervimab	2055006-79-4
  Lenvervimab (GC1102) is a IgG1-type recombinant human hepatitis B Immunoglobulin. Lenvervimab can be used for research of hepatitis B virus infection[1][2].

  

• HY-P99764

  Odesivimab	2135632-30-1	99.64%
  Odesivimab is a human monoclonal antibody, targeting Ebola virus glycoprotein with a KD value of 7.74 nM for recombinant histidine-tagged Makona strain Ebola virus glycoprotein ectodomain protein. Odesivimab can be used in research of Ebola virus infection[1].

  

• HY-P99999

  Anti-Mouse CD4 Antibody (YTS 191)
  Anti-Mouse CD4 Antibody (YTS 191) is anti-mouse CD4 IgG2b antibody inhibitor derived from host Rat.

  

• HY-112762A

  (E)-LHF-535		99.21%
  (E)-LHF-535 is the E-isomer of LHF-535. LHF-535 is an antiviral agent extracted from patent WO2013123215A2, Compound 38, has EC50s of <1 μM, <1 μM, <1 μM, and 1-10 μM for Lassa, Machupo, Junin, and VSVg virus, respectively[1].

  

• HY-145569A

  Fipravirimat dihydrochloride	2442512-14-1
  Fipravirimat dihydrochloride is a potent HIV-1 inhibitor. Fipravirimat dihydrochloride has the potential for HIV and AIDS research[1].

  

• HY-100033

  NSC5844	140926-75-6
  NSC5844 (RE-640) is a 4-aminoquinoline derivative, with antitumor and antimalarial activity.

  

• HY-112585

  Darunavir-d9	1133378-37-6
  Darunavir-d9 (TMC114-d9) is the deuterium labeled Darunavir. Darunavir (TMC114), an orally active next generation HIV protease inhibitor, has a similar antiviral activity against the mutant and the wild-type viruses. Darunavir (TMC114) is potent against laboratory HIV-1 strains and primary clinical isolates (IC50 = 0.003 μM; IC90 = 0.009 μM) with minimal cytotoxicity[1][2].

  

• HY-14648S

  Dexamethasone-d5	358731-91-6
  Dexamethasone-d5 is the deuterium labeled Dexamethasone. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses[1][2].

  

• HY-A0281S

  4-Phenylbutyric acid-d11	358730-86-6	99.30%
  4-Phenylbutyric acid-d11 is the deuterium labeled 4-Phenylbutyric acid. 4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.

  

• HY-B0356S

  Ciprofloxacin-d8 hydrochloride	1216659-54-9
  Ciprofloxacin-d8 (hydrochloride) is the deuterium labeled Ciprofloxacin. Ciprofloxacin (Bay-09867) hydrochloride is a fluoroquinolone antibiotic, exhibiting potent antibacterial activity.

  

• HY-B0712S

  Ceftriaxone-d3 disodium	1132650-38-4
  Ceftriaxone-d3 (disodium) is the deuterium labeled Ceftriaxone. Ceftriaxone is a third-generation cephalosporin antibiotic with excellent activity against many gram-negative, and reasonable activity against most gram-positive microorganisms. Anti-inflammatory and antioxidant characteristics[1][2].

  

• HY-W019776

  Sudan I-d5	752211-63-5	99.00%
  Sudan I-d5 is a the deuterated Sudan I. Sudan I is a diazo-conjugate red dye and can be used as an additive to products such as oils, solvents or polishes. Sudan I inhibits growth of bacterial strains Clostridium perfringens and L. rhamnosus[1].

  

• HY-12641

  Pyrantel tartrate	33401-94-4	98.69%
  Pyrantel tartrate is an orally active anthelmintic and an agonist of the nicotinic acetylcholine receptor (nAChR). Pyrantel tartrate can cause spasmodic muscle paralysis in parasites. Pyrantel tartrate can be used in the study of parasitic infections such as ascariasis, hookworm infections, intestinal worms (pinworm infections), trichinosis and trichinosis[1][2].

  

• HY-15349

  Trovirdine	149488-17-5	99.43%
  Trovirdine inhibits HIV-1 RT with an IC50 of 7 nM when employing heteropolymeric primer/template (oligo-DNA/ribosomal RNA)and dGTP as substrate.

  

• HY-16485

  Telavancin hydrochloride	560130-42-9
  Telavancin hydrochloride is the hydrochloride form of Telavancin (HY-112959). Telavancin hydrochloride is a semisynthetic derivative of vancomycin, and exhibits antibacterial efficacy through inhibition of cell wall synthesis and disruption of cell membrane barrier function. Telavancin hydrochloride is efficient against antibiotic resistant S. aureus strains MRSA, VISA, and hVISA. Telavancin hydrochloride attenuates gram positive bacteria induced complicated skin and skin structure infections (cSSSI)[1].

  

• HY-16779

  Fosravuconazole	351227-64-0	99.86%
  Fosravuconazole (BMS-379224), a proagent of Ravuconazole, is an orally active broad spectrum antifungal agent. Fosravuconazole can be used for candidiasis, onychomycosis and parasitemia research[1][2][3].

  

• HY-16784

  Samatasvir	1312547-19-5	99.39%
  Samatasvir (IDX71) is a potent, orally active NS5A inhibitor of HCV replication. Samatasvir is effective and selective against infectious HCV and replicons, with EC50s falling within a tight range of 2 to 24 pM in genotype 1 through 5 replicons[1].

  

• HY-17532

  Haloxon	321-55-1
  Haloxon is an anti-parasitic agent. Haloxon can be used for the research of infections of Parascaris equorum, Oxyuris equi and Strongylus vulgaris. Haloxon also can be used in control of ascarids and hookworms in domesticated animals in combination with Bidimazium[1][2].

  

• HY-18563

  4-Phenoxybenzylamine	107622-80-0
  4-Phenoxybenzylamine inhibits the function of the NS3 protein by stabilizing an inactive conformation with an IC50 of about 500 μM against FL NS3/4a.

  

• HY-19400

  DPC-681	284661-68-3	99.89%
  DPC-681 is a potent and selective inhibitor of HIV protease with IC90s for wild-type HIV-1 of 4 to 40 nM.

  

• HY-30263

  4-Heptyloxyphenol	13037-86-0	99.44%
  4-Heptyloxyphenol (p-(heptyloxy)phenol) has antibacterial activity agaisnt P. gingivalis, S. artemidis, Str. sobrinus (MIC: 0.10, 0.21, 0.14 mM)[1].

  

• HY-76648

  NBD-556	333353-44-9	99.57%
  NBD-556, a CD4 mimetic, is a potent HIV-1 entry inhibitor that blocks the gp120-CD4 interaction. NBD-556 shows potent cell fusion and virus-cell fusion inhibitory activity at low micromolar levels[1][2].

  

• HY-B0024

  Prulifloxacin	123447-62-1
  Prulifloxacin (NM441) is an orally active fluoroquinolone antibiotic with a broad spectrum of activity against Gram-positive and -negative bacteria. Prulifloxacin is a proagent of a thiazeto-quinoline carboxylic acid derivative Ulifloxacin (NM394). Prulifloxacin has the potential for lower urinary tract infections and exacerbations of chronic bronchitis[1][2].

  

• HY-B0055

  Azulene	275-51-4
  Azulene (Cyclopentacycloheptene) is as an isomer of naphthalene with high anti-HIV activity. Azulene, isolated from the distillation of chamomile oil, is a scaffold in medicinal chemistry[1][2][3].

  

• HY-B0488

  Clorsulon	60200-06-8
  Clorsulon (L631529; MK401) is an orally active flukicidal agent against liver flukes (Fasciola hepatica and Fasciola gigantica) infections in calves and sheep. Clorsulon is also a competitive inhibitor of both 3-phosphoglycorate and ATP andinhibits glucose utilization and acetate and propionate formation by mature Fasciola hepatica in vitro[1][2].

  

• HY-B0921

  Succinylsulfathiazole	116-43-8
  Succinylsulfathiazole is a sulfonamide, it is an ultra long acting drug.

  

• HY-B1147

  Diloxanide furoate	3736-81-0	99.80%
  Diloxanide furoate is the proagent of Diloxanide. Diloxanide furoate is a potent and orally active anti-protozoal agent and can be used for the research of amebiasis, mild intestinal amebiasis or asymptomatic cyst carriers[1].

  

• HY-B1408

  Salicylanilide	87-17-2	99.20%
  Salicylanilide demonstrates a wide range of biological activities including antiviral potency which can inhibit HIV virus by targeting HIV-1 integrase or reverse transcriptase.

  

• HY-B1497

  Silver sulfadiazine	22199-08-2
  Silver sulfadiazine (AgSD), a sulfonamide antibiotic, effects a dual inhibitory action on bacterial growth by its sulfa moiety (SD-SDZ) that prevents bacterial folate absorption and subsequent DNA synthesis. The silver that is released from Silver sulfadiazine binds and disrupts the DNA structure, precluding bacterial DNA replication[1].

  

• HY-B1599

  Chloramphenicol palmitate	530-43-8	98.25%
  Chloramphenicol palmitate is an orally active broad spectrum antibiotic and has a broad spectrum of activity against gram positive and gram negative bacteria. Chloramphenicol palmitate inhibits bacterial protein synthesis by blocking the peptidyl transferase step. Chloramphenicol palmitate can be used as bacterial selection agent in transformed cells containing chloramphenicol resistance genes[1].

  

• HY-B1837

  Cyfluthrin	68359-37-5	99.52%
  Cyfluthrin is a type II pyrethroid and has effects on various insects. Cyfluthrin is a modulator of Nav1.8 sodium channels by repetitive stimulation. Cyfluthrin can be applied in agriculture,veterinary, insecticide,pyrethroid and stored product[1][2].

  

• HY-B2067

  Cymoxanil	57966-95-7	99.55%
  Cymoxanil is a fungicidal cyanooxime against plant diseases caused by fungi belonging to the Perenosporales. Cymoxanil affects growth, DNA and RNA synthesis in Phytophthora[1].

  

• HY-B2072

  Cephaloridine	50-59-9
  Cephaloridine is a broad-spectrum antibacterial antibiotic. Cephaloridine has certain dose-related nephrotoxicity[1][2].

  

• HY-N0306

  Hederasaponin B	36284-77-2	99.28%
  Hederasaponin B, isolated from Hedera helix, has broad-spectrum antiviral activity against various subgenotypes of Enterovirus 71 (EV71).

  

• HY-N0381

  Maackiain	19908-48-6	98.03%
  Maackiain (DL-Maackiain) is isolated from Maackia amurensis Rupr.et Maxim. Maackiain (DL-Maackiain) is a larvicidal agent against Aedes aegypti mosquito.xp Parasitol with a LD50 of  21.95 µg/mL[1]. Maackiain (DL-Maackiain) induces fragmentations of DNA to oligonucleosomal-sized fragments that like a characteristic of apoptosis in the HL-60 cells[2].

  

• HY-N0672

  Pseudolaric Acid C	82601-41-0	99.59%
  Pseudolaric C is a diterpenoid isolated from the root bark of Pseudolarix amabilis, has antifungal activity[1].

  

• HY-N0685

  Pseudohypericin	55954-61-5	99.23%
  Pseudohypericin and its congener Hypericin are the major hydroxylated phenanthroperylenediones present in Hypericum species. Pseudohypericin shows anti-HIV activity[1][2].

  

• HY-N0867

  13-Oxyingenol-13-dodecanoate	54706-70-6	99.37%
  13-Oxyingenol-dodecanoate (13OD) is a tumor suppressor agent. 13-Oxyingenol-dodecanoate has anti-HIV-1 activity with EC50 value of 33.7 nM[1].13-Oxyingenol-dodecanoate can induce the expression of ULK1 to effect mitochondrial dysfunction and cellular autophagy. 13-Oxyingenol-dodecanoate also increases the expression of BAX and suppresses the expression of BCL-2 to effect apoptosis[2].

  

• HY-N1371

  Clinodiside A	916347-31-4	99.71%
  Clinodiside A is isolated from the Chinese medicinal herb Clinopodium chinensis[1].

  

• HY-N1927

  Menisdaurin	67765-58-6
  Menisdaurin is a cyanogenetic glucoside isolated from Flueggea virosa[1].

  

• HY-N1997

  Pyromeconic acid	496-63-9	98.26%
  Pyromeconic acid is an antifungal substance[1].

  

• HY-N2036

  Mosloflavone	740-33-0	98.87%
  Mosloflavone is a flavonoid isolated from Scutellaria baicalensis Georgi with ?anti-EV71 activity. Mosloflavone? inhibits VP2 virus replication and protein expression during the initial stage of virus infection and inhibits viral VP2 capsid protein synthesis. Mosloflavone is a promising biocide and inhibits P. aeruginosa virulence and biofilm formation.

  

• HY-N2432

  Paederoside	20547-45-9	99.18%
  Paederoside is a monoterpene S-methyl thiocarbonate isolated from Paederia pertomentosa. Paederoside shows a high anti-tumor promoting activity against the Epstein-Barr virus activation[1].

  

• HY-N2492

  (E)-Methyl 4-coumarate	19367-38-5	99.87%
  (E)-Methyl 4-coumarate (Methyl 4-hydroxycinnamate), found in several plants, such as Allium cepa or Morinda citrifolia L. leaves. (E)-Methyl 4-coumarate cooperates with Carnosic Acid in inducing apoptosis and killing acute myeloid leukemia cells, but not normal peripheral blood mononuclear cells. Antioxidant and antimicrobial activity.

  

• HY-N2544

  Dehydroglaucine	22212-26-6	98.49%
  Dehydroglaucine is a potent antimicrobial alkaloid[1].

  

• HY-N2590

  Lupenone	1617-70-5
  Lupenone is an orally active lupine-type triterpenoid that can be isolated from Musa basjoo. Lupenone Lupenone plays a role through the PI3K/Akt/mTOR and NF-κB signaling pathways. Lupenone has anti-inflammatory, antiviral, antidiabetic and anticancer activities[1][2][3].

  

• HY-N2598

  Methyl oleate	112-62-9
  Methyl oleate is a fatty acid methyl ester (FAME) with anti-extended spectrum β-Lactamase (ESBL) potential, anticancer and antibacterial activities. Methyl oleate substantially improves the antioxidation ability but markedly impaired the antiwear capacity of zinc dialkyldithiophosphate (ZDDP). Methyl oleate is promising for research of ESBL producing multi drug resistant (MDR) pathogens[1][2][3].

  

• HY-N2848

  α-Lapachone	4707-33-9	99.65%
  α-Lapachone shows trypanocidal activity[1].

  

• HY-N2947

  Boeravinone B	114567-34-9
  Boeravinone B, a dual inhibitor of NorA bacterial efflux pump of Staphylococcus aureus and human P-Glycoprotein, reduces the biofilm formation and intracellular invasion of bacteria. Boeravinone B act as anti-aging and anti-apoptosis phyto-molecules during oxidative stress[1][2].

  

• HY-N3373

  Loganetin	29748-10-5	98.51%
  Loganetin is a non-toxic natural product that may be applied in the antibacterial agent development for treating multidrug-resistant Gram negative infections.

  

• HY-N3506

  Wilfortrine	37239-48-8	98.83%
  Wilfortrine is a bioactive sesquiterpene alkaloid. Wilfortrine exhibits immunosuppresive effects. Wilfortrine also can inhibit leukaemia cell growth in mice and shows anti-HIV activity[1].

  

• HY-N3570

  Cerebroside B	88642-46-0
  Cerebroside B, a sphingolipid compound, is a non-racespecific elicitor, which elicits defense responses in rice[1].

  

• HY-N3907

  Fraxidin	525-21-3
  Fraxidin is a class of coumarin isolated from the roots of Jatropha podagrica, exhibits antibacterial activity against Bacillus subtilis with an inhibition zone of 12 mm at a concentration of 20 µg/disk[1][2].

  

• HY-N3920

  Gancaonin G	126716-34-5	98.73%
  Gancaonin G is a 6-prenylated isoflavanone that can be isolated from Glycyrrhiza uralensis. Gancaonin G has antibacterial activity against Streptococcus mutants and MRSA strains[1].

  

• HY-N4107

  Phyllanthin	10351-88-9	99.96%
  Phyllanthin is an effective oral anticancer agent. Phyllanthin inhibits MOLT-4 cell viability, increases apoptosis, inhibits cell migration and invasion. Phyllanthin exerts anti-fibrotic effects by down-regulating TGF signaling pathway via ALK5 and Smad2/3. Phyllanthin also has anti-inflammatory and antibacterial properties [1] [2] [3].

  

• HY-N4132

  17-Hydroxyisolathyrol	93551-00-9	99.33%
  17-Hydroxyisolathyrol is a macrocychc lathyrol derivative isolated from seeds of Euphorbla luthyrrs[1].

  

• HY-N4167

  3-O-Methylgalangin	6665-74-3	99.54%
  3-O-Methylgalangin (Galangin 3-methyl ether) is a natural flavonoid compound from the rhizome of Alpinia officinarum (AO) with antibacterial activities, which also inhibits pancreatic lipase[1][2].

  

• HY-N4181

  Kanzonol C	151135-82-9
  Kanzonol C, a flavonoid isolated from the twigs of Dorstenia barteri (Moraceae), has potential to treat bacterial and fungal infections[1].

  

• HY-N4184

  Licoflavone B	91433-17-9	99.91%
  Licoflavone B is a flavonoid isolated from Glycyrrhiza inflata, inhibits S. mansoni ATPase (IC50, 23.78 µM) and ADPase (IC50, 31.50 µM) activity. Anti-schistosomiasis activity[1].

  

• HY-N4307

  Laetanine	72361-67-2
  Laetanine, a noraporphine alkaloid from Litsea laeta, exhibits antiplasmodial activity[1].

  

• HY-N5005

  Guanfu base H	4758-99-0	99.80%
  Guanfu base H (Atisinium chloride) is a diterpenoid alkaloid isolated from Aconitum coreanum and has antiplasmodial activity against the malarial Plasmodium falciparum strains TM4/8.2 (wild type) and K1CB1 with IC50 values of 4 μM and 3.6 μM, respectively[1][2].

  

• HY-N5008

  Macranthoside B	146100-02-9
  Macranthoside B, isolated from Flos Lonicerae, possesses anti-bacterial activity[1].

  

• HY-N5107

  Epimagnolin A	41689-51-4	98.12%
  Epimagnolin A, a furfuran lignan, shows mild antiplasmodial activities (IC50=5.7 μg/mL) without noticeable toxicity on mammalian normal cells[1].

  

• HY-N6033

  Ferruginol	514-62-5
  Ferruginol ((+)-Ferruginol), a natural diterpenoid, is an inhibitor of the activation of Epstein-Barr virus early antigen (EBV-EA). Ferruginol inhibits the growth of thyroid cancer cells through the induction of mitochondrial apoptosis. Ferruginol has antitumor, cardioprotective, antioxidant, gastroprotective, and neuroprotective activities[1][2][3].

  

• HY-N6055

  Nuezhenidic acid	183238-67-7	99.56%
  Nuezhenidic acid can be isolated from the fruits of Ligustrum lucidum, posseses inhibitory activities against influenza A virus[1].

  

• HY-N6237

  Aspulvinone O	914071-54-8
  Aspulvinone O is a natural inhibitor of aspartate transaminase 1 (GOT1). GOT1 plays an important role in energy metabolism and Reactive Oxygen Species (ROS) balance. GOT1 may serve as an important target in PDAC. Aspulvinone O suppresses pancreatic ductal adenocarcinoma cells growth by interfering glutamine metabolism[1].

  

• HY-N6580

  Ginsenoside Rg4	126223-28-7	99.94%
  Ginsenoside Rg4 is a major protopanaxatriol type ginsenoside isolated from the leaves of Panax ginseng C. A. Meyer. The protopanaxatriol type ginsenosides (such as Ginsenoside Rg4) exhibits various biological activities including anti-septic, anti-diabetic, wound healing, immune-stimulatory, and anti-antioxidant activity[1][2].

  

• HY-N6744

  Chaetoglobosin A	50335-03-0	98.40%
  Chaetoglobosin A, the active principle within the extract of Penicillium aquamarinium, is a member of the cytochalasan family. Chaetoglobosin A preferentially induces apoptosis. Chaetoglobosin A targets filamentous actin in CLL cells and thereby induces cell-cycle arrest and inhibits membrane ruffling and cell migration[1].

  

• HY-N6829

  Retusin	1245-15-4
  Retusin (Quercetin-3,3',4',7-tetramethylether), a natural compound isolated from the leaves of Talinum triangulare, possesses antiviral and anti-inflammatory activities[1].

  

• HY-N6908

  Continentalic acid	19889-23-7	98.89%
  Continentalic acid from Aralia continentalis has minimum inhibitory concentrations (MICs) of approximately 8-16 µg/mL against S. aureus, including the Methicillin (HY-121544) susceptible Staphylococcus aureus (MSSA) and Methicillin-resistant Staphylococcus aureus (MRSA) standard strains[1].

  

• HY-N6935

  Sennidin B	517-44-2	99.25%
  Sennidin B, a stereoisomer isolated from the leaves of Cassia angustifolia, has lower activity than Sennidin A. Sennidin A inhibits HCV NS3 helicase, with an IC50 of 0.8 μM. Sennidin A induces phosphorylation of Akt and glucose transporter 4 (GLUT4) translocation. Sennidin A stimulates the glucose incorporation [1][2].

  

• HY-N6980

  Licorice glycoside C2	202657-55-4	99.07%
  Licorice glycoside C2 is a oleanane-type triterpene oligoglycoside isolated from Glycyrrhiza uralensis. Various biological activities are associated with licorice extracts, such as anti-viral, anti-microbial, antioxidant, anti-inflammatory, anti-ulcer, anti-cancer and anti-HIV effects[1].

  

• HY-N7068

  Mupirocin calcium hydrate	115074-43-6	98.05%
  Mupirocin (BRL-4910A, Pseudomonic acid) calcium hydrate is an orally active antibiotic isolated from Pseudomonas fluorescens. Mupirocin calcium hydrate apparently exerts its antimicrobial activity by reversibly inhibiting isoleucyl-transfer RNA, thereby inhibiting bacterial protein and RNA synthesis[1][2].

  

• HY-N7096

  Ceftezole sodium	41136-22-5	98.75%
  Ceftezole sodium (CTZ sodium) is a broad-spectrum cephem antibiotic against many species of gram-positive and gram-negative bacteria. Ceftezole sodium (CTZ sodium) is an alpha-glucosidase inhibitor with in vivo anti-diabetic activity[1][2].

  

• HY-N7097

  Sulbenicillin disodium	28002-18-8
  Sulbenicillin disodium is the disodium salt of Sulbenicillin. Sulbenicillin is a Penicillin antibiotic with antibacterial activity against a number of mucoid and non-mucoid strains of Pseudomonas aeruginosa[1].

  

• HY-N7111

  Sultamicillin tosylate	83105-70-8
  Sultamicillin tosylate is a broad-spectrum and orally active beta-lactamase inhibitor, an antibiotic with antibacterial activity[1].

  

• HY-N7115

  Sultamicillin	76497-13-7	98.37%
  Sultamicillin is a broad-spectrum and orally active beta-lactamase inhibitor, an antibiotic with antibacterial activity[1].

  

• HY-N7504

  Isopsoralenoside	905954-18-9	99.50%
  Isopsoralenoside is a benzofuran glycoside from Psoralea corylifolia. Isopsoralenoside can be quickly metabolized to Psoralen (HY-N0053) in digestive tract contents. Isopsoralenoside show estrogen-like activity, osteoblastic proliferation accelerating activity, antitumor effects and antibacterial activity[1].

  

• HY-N7515

  Pinocembrin chalcone	4197-97-1
  Pinocembrin chalcone (2',4',6'-Trihydroxychalcone) is an antibacterial compound from Helichrysum Trilineatum. Pinocembrin chalcone facilitates AMP-activated protein kinase (AMPK) activation, improves glucose tolerance, increases muscle FAO and reduces fat accumulation in the liver and skeletal muscles in high-fat diet-induced (HFD) diabetic mice. Pinocembrin chalcone is promising for research of gastric ulcers and diabetes[1][2].

  

• HY-N7516

  4'-Hydroxy-2,4-dimethoxychalcone	151135-64-7	99.76%
  4'-Hydroxy-2,4-dimethoxychalcone is a natural chalcone derivatives in the red herbal resin of Dracaena cochinchinensis. 4'-Hydroxy-2,4-dimethoxychalcone displays a wide range of biological activities including antimalarial, antiprotozoal, antibacterial, antifungal activity[1][2].

  

• HY-N7543

  Schisantherin D	64917-82-4	99.66%
  Schisantherin D is a dibenzocyclooctadiene lignan isolated from the fruit of Schisandra sphenanthera. Schisantherin D shows anti-HIV replication activities with an EC50 of 0.5 μg/mL. Schisantherin D inhibits endothelin receptor B (ETBR) and has hepatoprotective effects[1][2].

  

• HY-N7626

  Eleutherol	480-00-2	99.94%
  Eleutherol is a naphthalene isolated from E. americana with antifungal activities[1]. Eleutherol is against yeasts Candida albicans, C. tropicalis, Saccharomyces cerevisiae and Cryptococcus neoformans with MIC values between 7.8 µg/mL and 250 µg/mL[1]. Eleutherol inhibits α-glucosidase function with an IC50>1.00 mM[2].

  

• HY-N7934

  Trachelogenin	34209-69-3	99.56%
  Trachelogenin ((-)-Trachelogenin) is an HCV entry inhibitor without genotype specificity, and with low cytotoxicity. Trachelogenin inhibits HCVcc infection and HCVpp cell entry in a dose-dependent manner with an IC50 of 0.325 and 0.259 μg/mL in HCVcc and HCVpp models, respectively. Trachelogenin exhibits effective antiviral, anti-inflammatory and analgesic effects[1].

  

• HY-N7996

  Matairesinoside	23202-85-9	99.88%
  Matairesinoside is a lignan with antibacterial and antioxidant activities. Matairesinoside also shows virus-cell fusion inhibitory activity[1][2].

  

• HY-N8024

  Rubinaphthin A	448962-05-8	99.72%
  Rubinaphthin A is a naphthohydroquinone that can be found in the roots of Rubia yunnanensis. Rubinaphthin A exhibits inhibitory activity against tobacco mosaic virus (TMV)[1][2].

  

• HY-N8131

  Pangelin	33783-80-1
  Pangelin is a coumarin that can be found in Ducrosia anethifolia. Pangelin exhibits anti-mycobacterial and anti-tumor activities[1][2].

  

• HY-N8411

  Aromadendrene	489-39-4
  Aromadendrene can be isolated from Eucalyptus globulus. Aromadendrene has antimicrobial activity[1].

  

• HY-N8420

  Thalifoline	21796-15-6	99.19%
  Thalifoline is an alkaloid and displays antifungal activity[2].

  

• HY-N8435

  Desoxo-narchinol A	53859-06-6
  Desoxo-narchinol A is an orally active and potent anti-inflammatory agent. Desoxo-narchinol A can be isolated from the roots and rhizomes of Nardostachys jatamansi. Desoxo-narchinol A can be used for septic shock and inflammatory diseases research[1][2][3].

  

• HY-N8517

  Malabaricone B	63335-24-0
  Malabaricone B, a naturally occurring plant phenolic, is an orally active α-glucosidase inhibitor with an IC50 of 63.7 µM. Malabaricone B has anticancer, antimicrobial, anti-oxidation and antidiabetic activities[1][2][3].

  

• HY-N9357

  Granilin	40737-97-1	99.85%
  Granilin, a sesquiterpene lactone, can be found in the flower buds of Carpesium triste. Granilin can be used as the bactericide and fungicide[1].

  

• HY-N9487

  (R)-(-)-α-Phellandrene	4221-98-1
  (R)-(-)-α-Phellandrene ((-)-α-Phellandrene) is an the (R)-(-)-stereoisomer of α-phellandrene. α-phellandrene is an orally active cyclic monoterpene that attenuates inflammatory response, and induces DNA damage[1][2][3].

  

• HY-P0285

  Rabies Virus Glycoprotein		99.69%
  Rabies Virus Glycoprotein is a 29-amino-acid cell penetrating peptide derived from a rabies virus glycoprotein that can cross the blood-brain barrier (BBB) and enter brain cells.

  

• HY-P0305

  PrP (106-126)	148439-49-0	99.59%
  PrP (106-126) is a peptide corresponding to the prion protein (PrP) amyloidogenic region, and its biochemical properties resemble the infectious form of prion protein.

  

• HY-P1407

  Z-VRPR-FMK TFA
  Z-VRPR-FMK (TFA) (VRPR), a tetrapeptide, is a selective and irreversible MALT1 (Mucosa-associated lymphoid tissue lymphoma translocation protein 1) inhibitor. Z-VRPR-FMK (TFA) can protect against influenza A virus (IAV) infection[1].

  

• HY-P1743

  Acyl Carrier Protein (ACP) (65-74)	66851-75-0	98.16%
  Acyl Carrier Protein (ACP) (65-74) is a key coenzyme fragment of fatty acid synthase (FAS) and participates in fatty acid synthesis as an acyl carrier. Acyl Carrier Protein (ACP) (65-74) mediates condensation, reduction and other cyclic reactions in fatty acid synthesis by covalently binding to acyl chains to form acyl-ACP intermediates, promoting acyl chain extension. Acyl Carrier Protein (ACP) (65-74) can regulate the synthesis ratio of saturated and unsaturated fatty acids. Acyl Carrier Protein (ACP) (65-74) can be used to study the mechanism of bacterial fatty acid synthesis and is a potential target for antibiotics (such as inhibiting the FAS system of pathogens)[1][2][3].

  

• HY-P2148

  P-113	190673-58-6	98.59%
  P-113 is an antimicrobial peptide (AMP) derived from the human salivary protein histatin 5. P-113 is active against clinically important microorganisms such as Pseudomonas spp., Staphylococcus spp., and C. albicans[1].

  

• HY-P2261

  STAD 2	1542100-77-5	98.39%
  STAD 2 is a potent and selective disruptor of PKA-RII, with a Kd of 6.2 nM. STAD 2 disrupts interactions between PKA and AKAP in an isoform-selective manner. STAD 2 displays antimalarial activity through a PKA-independent mechanism[1][2].

  

• HY-P2320

  IDR-1	940291-10-1	99.01%
  IDR-1 is an antimicrobial peptide that is active against Gram-positive and Gram-negative bacteria. IDR-1 counters infection by selective modulation of innate immunity without obvious toxicities. IDR-1 has anti-inflammatory and anti-infective properties, enhances the levels of monocyte chemokines, and attenuates pro-inflammatory cytokine release[1][2].

  

• HY-P2834

  Penicillin amidase, E. coli	9014-06-6
  Penicillin amidase (EC 3.5.1.11) (Penicillin acylase) is an enzyme that cleaves the acyl side chains of penicillins. Penicillin amidase can be used for the production of 6-aminopenicillanic acid. Penicillin amidase can also be used in the resolution of racemic mixtures, peptide synthesis, and synthesis of semi-synthetic β-lactam antibiotics[1][2][3].

  

• HY-P3021

  Human milk lysozyme	12671-19-1	98.00%
  Human milk lysozyme is the lysozyme found in human milk. Human milk lysozyme is thought to be a key defense factor in protecting the gastrointestinal tract of newborns against bacterial infection[1].

  

• HY-P3601

  Brain Derived Basic Fibroblast Growth Factor (1-24)	211362-85-5	99.86%
  Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research[1].

  

• HY-P3823

  Asp-Asp-Asp-Asp-Asp-Asp	145224-96-0	98.72%
  Asp-Asp-Asp-Asp-Asp-Asp is a polyaspartic acid. The specificity of the catalytic and antigenic sites of influenza virus neuraminidase is related to the number of specific amino acids.

  

• HY-P4200

  Lugdunin	1989698-37-4
  Lugdunin is an antibiotic peptide. Lugdunin inhibits bacteria by dissipating their membrane potential. Lugdunin is active against Gram-positive bacteria, such as S. aureus, and reduces S. aureus skin and nasal colonization. Lugdunin induces LL-37 and CXCL8/MIP-2 in human keratinocytes and mouse skin[1].

  

• HY-P5932

  Maculatin 1.1 TFA
  Maculatin 1.1 TFA is an antimicrobial peptide with an MIC against Staphylococcus aureus of 7 μM. Maculatin 1.1 TFA can perforate the bacterial membrane of Staphylococcus aureus, causing bacterial death[1].

  

• HY-P5957

  Omphalotin A	186511-50-2
  Omphalotin A is a cyclic peptide, and shows nematicidal activity[1].

  

• HY-100039

  YYA-021	144217-65-2	98.96%
  YYA-021 is a small-molecule CD4 mimic that inhibits HIV entry, with high anti-HIV activity and low cytotoxicity[1][2].

  

• HY-100577

  Ticarcillin sodium	29457-07-6
  Ticarcillin sodium is an injectable antibiotic for the treatment of Gram-negative bacteria, particularly Pseudomonas aeruginosa. It is also one of the few antibiotics capable of treating Stenotrophomonas maltophilia infections[1].

  

• HY-101188

  INCB38579	1246207-65-7	99.97%
  INCB38579 is an orally active, highly brain penetrable, and selective histamine H4 receptor (HH4R) antagonist (hH4R IC50=4.8 nM, mH4R IC50=42 nM, rH4R IC50=32 nM). INCB38579 shows anti-inflammatory pain and anti-pruritic activities[1].

  

• HY-105268

  AzddMeC	87190-79-2	98.96%
  AzddMeC (CS-92) is an antiviral nucleoside analogue and a potent potent, selective and orally active HIV-1 reverse transcriptase and HIV-1 replication inhibitor. In HIV-1-infected human PBM cells and HIV-1-infected human macrophages, the EC50 values of AzddMeC are 9 nM and 6 nM, respectively[1][2]. AzddMeC is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

  

• HY-106784

  Ajoene	92285-01-3
  Ajoene, a garlic-derived compound, is an antithrombotic and antifungal agent. Ajoene inhibits proliferation and induces apoptosis of human leukaemia CD34-negative cells including HL-60, U937, HEL and OCIM-I. Anticancer activities[1][2].

  

• HY-106892

  BW 348U87	127142-14-7	99.62%
  BW 348U87 is an inhibitor for ribonucleotide reductase, which exhibits synergistic effect with Acyclovir (HY-17422), potentiate the antiviral activity of Acyclovir against herpes simplex virus (HSV) in athymic nude mouse model[1].

  

• HY-107566

  Conessine	546-06-5
  Conessine is an orally active and BBB-penetrable selective histamine H3 receptor antagonist. The pKi values of Conessine for rat and human H3 receptors are 7.61 and 8.27, respectively. Conessine is an inhibitor of the multidrug efflux pump system in Pseudomonas aeruginosa and can enhance the activity of antibiotics. Conessine has antimalarial activity. Conessine can also be used in the research of muscle atrophy[1][2][3][4][5].

  

• HY-107577

  Gedunin	2753-30-2
  Gedunin is a limonoid with anti-cancer, anti-viral, anti-inflammatory and insecticidal activities. Gedunin acts as a potent Hsp90 inhibitor and induces the degradation of Hsp90-dependent client proteins. Geduni may obstructs the entry of SARS-CoV-2 virus into human host cells and can be used for COVID-19 research[3].

  

• HY-107798

  Potassium guaiacolsulfonate hemihydrate	78247-49-1	99.83%
  Potassium guaiacolsulfonate hemihydrate is an orally active expectorant used for acute respiratory tract infections. Potassium guaiacolsulfonate hemihydrate helps loosen mucus and used for a cough caused by the common cold, infections or allergies in combination with other agents[1][2].

  

• HY-108004

  Decamethoxine	38146-42-8
  Decamethoxine (Septefril) is a cationic gemini surfactant. Decamethoxine exhibits strong bactericidal and fungicidal effects. Decamethoxine modifies the permeability of the microbial cell membrane, resulting in the destruction and death of diverse microorganisms[1][2].

  

• HY-108012

  ME1111	1391758-52-3	99.95%
  ME1111 is an antifungal agent that is active against dermatophytes. ME1111 is an inhibitor of the succinate dehydrogenase of Trichophyton species. ME1111 has an excellent ability to penetrate human nails and is used for onychomycosis research[1][2].

  

• HY-108288

  Sulbactam pivoxil	69388-79-0
  Sulbactam pivoxil is a proagent of sulbactam. Sulbactam is a β-lactamase inhibitor which poorly adsorbed from gastrointestinal tract. Sulbactam pivoxil has a better absorption than the parent agent and provides high serum levels after oral administration[1].

  

• HY-108437

  exo-IWR-1	1127442-87-8	98.75%
  exo-IWR-1, an inactive stereoisomer of Endo-IWR-1, is a negative control of IWR-1 (HY-12238). IWR-1 is a tankyrase inhibitor which inhibits Wnt/β-catenin signaling pathway[1][2].

  

• HY-10863S

  Anandamide-d8	924894-98-4	99.90%
  Anandamide-d8 is a deuterated labeled Anandamide[1]. Anandamide is an endocannabinoid. Anandamide modulates both neuronal and immune functions through two protein-coupled cannabinoid receptors (CB1 and CB2). Anandamide can activate numerous other receptors like PPARS, TRPV1, and GPR18/GPR55. Anandamide also has potential anti-fungal and anti-inflammatory activities. Anandamide can be used for the research of Alzheimer’s disease (AD) and ulcerative colitis[2][3][4][5][6].

  

• HY-108938

  SDZ285428	174262-13-6	98.00%
  SDZ285428 is a CYP51 inhibitor. SDZ285428 inhibits Trypanosoma cruzi (TC) CYP51 with I/E2 <1 (5 min) and I/E2=9 (1 h). SDZ285428 inhibits Trypanosoma brucei (TB) CYP51 with I/E2 <1 (5 min) and I/E2=35 (1 h)[1].

  

• HY-108971

  Demecycline	987-02-0
  Demecycline, a tetracycline antibiotic, is the C6-demethylated derivative of Tetracycline (HY-A0107) against bacterial infections including pneumonia and other respiratory tract infections[1].

  

• HY-109004

  Enzaplatovir	1323077-89-9	99.98%
  Enzaplatovir (BTA-C585) is an orally bioavailable Inhibitor for respiratory syncytial virus (RSV) infection[1].

  

• HY-109987

  ISPA-28	1006335-39-2
  ISPA-28 is a specific plasmodial surface anion channel (PSAC) antagonist. ISPA-28 binds directly and reversibly to CLAG3[1][2].

  

• HY-111912

  Tribenuron-methyl	101200-48-0
  Tribenuron-methyl, a sulfonylurea herbicide agent, can be used as the fungicide agent. Tribenuron-methyl plays an important role in controlling the weeds and diseases in wheat field[1].

  

• HY-112142

  AB-423	1572510-80-5	99.31%
  AB-423 is an inhibitor of HBV capsid assembly, and potent inhibits HBV replication with EC50/EC90 of 0.08-0.27 μM/0.33-1.32 μM in cells.

  

• HY-112254

  ZINC03129319	1777807-64-3
  ZINC03129319 is a dengue virus (DENV) NS2B-NS3 protease inhibitor extracted from patent US20150141521A1, has inhibition constants (Ki1) of 92 μM and Ki3 of 20 μM.

  

• HY-112665

  Virginiamycin Complex	11006-76-1
  Virginiamycin Complex (Streptogramin) is an antibiotic containing two streptogramins, virginiamycin M (VM) and virginiamycin S (VS), which are produced by S. virginiae. As a complex, these two antibiotics in Virginiamycin Complex act synergistically. The action of VM is persistent and catalytic, and it can alter the affinity of ribosomes for VS. Virginiamycin Complex irreversibly inhibits protein synthesis in bacteria and has antibacterial activity[1].

  

• HY-112712

  Cyclophilin inhibitor 1	1509904-96-4	99.55%
  Cyclophilin inhibitor 1 is a potent and orally bioavailable cyclophilin A inhibitor, with a Kd of 5 nM, shows effective anti-HCV activity, with an EC50 of 98 nM for HCV 2a[1].

  

• HY-113430

  5-n-Heneicosylresorcinol	70110-59-7
  5-n-Heneicosylresorcinol (5-Heneicosylresorcinol) is an active n-alkyl(enyl)resorcinols (AR) occurring in cereal products from Colombia. Antifungal activity[1].

  

• HY-113640

  BC-7013	1028291-66-8	99.04%
  BC-7013 is a novel semi-synthetic pleuromutilin derivative. BC-7013 has excellent activity against Gram-positive pathogenic bacteria. BC-7013 exhibits potent antibacterial properties against both Staphylococcus, Streptococcus and penicillin-resistant Streptococcus pneumoniae. BC-7013 has activity against Gram-positive pathogenic bacteria, BC-7013 is useful in the research of acute bacterial skin and skin structure infection (ABSSSI)[1].

  

• HY-113715

  Niclofolan	10331-57-4	99.55%
  Niclofolan (BAY 9015) is an orally active anthelmintic agent. Niclofolan can be used in the research of parasite infection[1][2][3].

  

• HY-113764

  N-Butanoyl-DL-homoserine lactone	98426-48-3
  N-Butanoyl-DL-homoserine lactone ((Rac)-C4-HSL) is a racemic mixture of N-Butanoyl-D-homoserine lactone and N-Butanoyl-L-homoserine lactone. N-Butanoyl-L-homoserine lactone is a cleavable ADC linker used in the synthesis of antibody-drug conjugates (ADCs). N-Butanoyl-L-homoserine lactone has antibacterial activity and is used in antibacterial biofilm. N-Butanoyl-L-homoserine lactone aptamers blocks qurom sensing and inhibits biofilm formation in Pseudomonas aeruginosa[1][2].

  

• HY-114437

  Fusion Inhibitory Peptide	75539-79-6	99.93%
  Fusion Inhibitory Peptide (Z-D-Phe-Phe-Gly-OH, FIP, Virus Replication Inhibitory Peptide) is a potent inhibitor of the virus replication, by inhibiting the membrane fusing activity of a viral glycoprotein[1].

  

• HY-114495

  Caerulomycin A	21802-37-9
  Caerulomycin A (Cerulomycin; Caerulomycin), an antifungal compound, induces generation of T cells, enhances TGF-β-Smad3 protein signaling via suppressing interferon-γ-induced STAT1 signaling. Antifungal and antibiotic activity, and used in autoimmune diseases[1].

  

• HY-114818

  4-(tert-Butyl)-benzhydroxamic Acid	62034-73-5	99.49%
  4-(tert-Butyl)-benzhydroxamic Acid is a PqsR antagonist with IC50s of 12.5 μM and 23.6 μM for E. coli and P. aeruginosa, respectively. 4-(tert-Butyl)-benzhydroxamic Acid reduces the production of the virulence factor pyocyanin in P. aeruginosa with an IC50 of 87.2 μM[1].

  

• HY-115249

  Metronidazole acetic acid	1010-93-1	99.88%
  Metronidazole acetic acid is a metabolite of Metronidazole with mutagenic activity in bacteria. Metronidazole is a nitroimidazole antibiotic, amebicide, and antiprotozoal agent used particularly for anaerobic bacteria and protozoa[1][2][3].

  

• HY-115550

  Chalcone 4 hydrate	1202866-96-3
  Chalcone 4 hydrate is an anti-parasite agent, inhibits the growth of Babesia and Theileria[1].

  

• HY-115574

  RSV L-protein-IN-1	851658-10-1	98.09%
  RSV L-protein-IN-1 (compound D) is a potent inhibitor of Respiratory syncytial virus (RSV) (EC50=0.021 μM). RSV L-protein-IN-1 inhibits Polymerase (IC50=0.089 μM)，and blocks RSV mRNA synthesis by inhibiting guanylation of viral transcripts. RSV L-protein-IN-1 shows moderate cytotoxicity (CC50=8.4 μM，HEp-2)，also exhibits activity and lowers virus titers in mouse models of RSV infection[1].

  

• HY-116536

  N-3-Oxo-tetradecanoyl-L-homoserine lactone	177158-19-9	99.90%
  N-3-Oxo-tetradecanoyl-L-homoserine lactone (oxo-C14-HSL) is a rhizobacterial inducer and can improve basic defense against nematodes[1].

  

• HY-116993

  N-(Hydroxymethyl)nicotinamide	3569-99-1	99.82%
  N-(Hydroxymethyl)nicotinamide is an antimicrobic agent[1].

  

• HY-117005

  C450-0730	1036730-46-7
  C450-0730 is an antagonist targeting the AHL membrane-bound sensor kinase and is an antagonist of the nine-transmembrane protein LuxN of Vibrio harveyi . C450-0730 competitively binds to the LuxN AI-1 binding site and specifically antagonizes the LuxN/AI-1 quorum sensing signal in Vibrio harveyi. The inhibitory activity of C450-0730 against LuxNI209F was not significant[1].

  

• HY-117089

  Tetraconazole	112281-77-3
  Tetraconazole, a chiral triazole fungicide, is widely used for the prevention of plant disease in wheat fields[1]. Tetraconazole alters the methionine and ergosterol biosynthesis pathways in Saccharomyces yeasts promoting changes on volatile derived compounds[2].

  

• HY-117145

  Thiophene-2	420089-51-6
  Thiophene-2 (TP2) is a specific polyketide synthase 13 (Pks13) inhibitor. Thiophene-2 inhibits mycolic acid biosynthesis and rapidly leads to mycobacterial cell death. Thiophene-2 is active against Mycobacterium tuberculosis with a MIC value of 1 μM, and has potent anti-tuberculosis activity[1].

  

• HY-117319

  Indolmycin	21200-24-8	99.90%
  Indolmycin (TAK-083), an antibiotic, is a competitive inhibitor of prokaryotic tryptophanyl-tRNA synthetase (TrpS). Indolmycin (TAK-083) possesses both anti-viral and anti-bacterial activity[1][2][3].

  

• HY-118099

  Florfenicol amine hydrochloride	108656-33-3	99.45%
  Florfenicol amine hydrochloride is a metabolite of Florfenicol (HY-B1374). Florfenicol inhibits bacterial protein synthesis by binding to 50S and 70S subunits in the ribosome to abolish the activity of peptidyltransferase. Florfenicol, is a veterinary antibiotic, can be used in aquaculture to control susceptible bacterial diseases[1][2].

  

• HY-118659

  Benzalphthalide	575-61-1	98.04%
  Benzalphthalide (3-Benzylidenephthalide), a phthalate compound, is an insecticide[1].

  

• HY-119614

  Niridazole	61-57-4	98.75%
  Niridazole is an anaerobic and microaerophilic bacterial inhibitor with IC50 values ranging from 0.0037 to 1.0 μg/mL[1].

  

• HY-119649

  Flonicamid	158062-67-0	99.87%
  Flonicamid (IKI220) is a novel systemic insecticide with selective activity against hemipterous pests. The main insecticidal mechanism of flonicamid is starvation based on the inhibition of stylet penetration to plant tissues[1].

  

• HY-119691

  Alamifovir	193681-12-8
  Alamifovir (LY582563; MCC-478), a purine nucleotide analogue proagent, shows potent activity against wild type and lamivudine resistant hepatitis B virus (HBV). Alamifovir has high activity against HBV replication and sustained antiviral effect[1][2].

  

• HY-119821

  Terphenyllin	52452-60-5
  Terphenyllin is a naturally abundant p-terphenyl metabolite isolated from the coral derived fungus Aspergillus candidus, has significant α-glucosidase inhibitory activity[1].

  

• HY-119847

  Abafungin	129639-79-8	99.10%
  Abafungin, a antifungal agent, inhibitis the transmethylation at the C-24 position of the sterol side chain, catalyzed by the enzyme sterol-C-24-methyltransferase.

  

• HY-119972

  Diloxanide	579-38-4	99.66%
  Diloxanide is an anti-protozoal agent and can be used for the research of asymptomatic-intestinal amebiasis caused by Entamoeba histolytica or some other protozoal infections. Diloxanide is an active luminal amebicide and hydrolyzed in the gastrointestinal tract from its proagent Diloxanide furoate (HY-B1147)[1].

  

• HY-120696

  SR9186	1361414-26-7	98.06%
  SR9186 (ML368) is a potent CYP3A4 inhibitor with IC50 s for inhibition of midazolam → 1′hydroxymidazolam, testosterone → 6β-hydroxytestosterone, and vincristine → vincristine M1 of 9, 4, and 38 nM, respectively. SR-9186 inhibits liver-stage development of P. falciparum to block ivermectin metabolism[1].

  

• HY-121185

  Hexoprenaline	3215-70-1
  Hexoprenaline is an orally active and selective β-adrenergic receptor agonist that dilates the bronchi. Hexoprenaline can be used in the study of bronchospasm, including asthma, bronchitis, and emphysema[1].

  

• HY-121240

  Brecanavir	313682-08-5	98.79%
  Brecanavir (GW640385) is a novel, potent HIV protease inhibitor.

  

• HY-121341

  Brodimoprim	56518-41-3	99.36%
  Brodimoprim (Ro 10-5970), a trimethoprim analogue, is an orally active dihydrofolate reductase inhibitor. Brodimoprim is highly active against a broad spectrum of gram-negative and gram-positive bacteria[1].

  

• HY-121793

  Roemerine	548-08-3
  Roemerine is an alkaloid that has been identified from the leaves of Fibraurea recisa Pierre. Roemerine exhibits antibacterial, anticancer, and antidepressant activities, can reverse the multidrug resistance phenotype in cultured cells, and exerts antibacterial effects by regulating the cAMP signaling pathway. Additionally, Roemerine influences neuronal activity by increasing BDNF protein expression and modulating the serotonergic and glutamatergic systems. Roemerine holds promise for research in the fields of cancer, infections, and neurological diseases[1][2][3][4][5].

  

• HY-121884

  Spiroxamine	118134-30-8	99.94%
  Spiroxamine is a fungicide that can be used to kill grapes with less residue[1].

  

• HY-122790

  2-Hydroxydocosanoic acid	13980-14-8
  2-Hydroxydocosanoic acid has antioxidant, cholinesterase inhibitory, and antimicrobial activities[1].

  

• HY-123026

  Salannin	992-20-1	99.30%
  Salannin, a limonoid bitter principle of the seed oil of Azadirachta indica, shows antiulcer and spermicidal activities. Salannin displays antibacterial activity towards both Gram-positive and Gram-negative bacteria[1][2].

  

• HY-123336

  Schisantherin C	64938-51-8
  Schisantherin C exhibits anti-HBV activity with potency against HBsAg and HBeAg secretion by 59.7% and 34.7% at 50μg/mL[1].

  

• HY-125579

  Ro 25-0534	143488-32-8	98.31%
  Ro 25-0534 is an antimicrobial compound against Pseudomonas. Ro 25-0534 is active against Enterobacteriaceae (MIC90: 0.06-2 μg/mL), Oxacillin (HY-B0465)-susceptible staphylococci, β-hemolytic streptococci, and penicillin-susceptible pneumococci (MIC90: 1-2 μg/mL), Haemophilus influenzae (MIC90: 0.25-0.5 μg/mL), Moraxella catarrhalis (MIC90: 0.5 μg/mL), and most nonenteric Gram-negative bacilli (MIC90: 2-4 μg/mL)[1].

  

• HY-125699

  Ochratoxin C	4865-85-4
  Ochratoxin C is the ethyl ester analog of ochratoxin A, a mycotoxin produced by A. ochraceus, A. carbonarius, and P. verrucosum that is commonly found as a food contaminant.

  

• HY-125728

  Micrococcin P1	67401-56-3
  Micrococcin P1 is a macrocyclic peptide antibiotic and is a potent hepatitis C virus (HCV) inhibitor with an EC50 range of 0.1-0.5 μM[1]. Micrococcin P1 has in vitro antibacterial activity against Gram-positive bacterial strains. The MIC values of Micrococcin P1 against S. aureus 1974149, E. faecalis 1674621 and S. pyogenes 1744264 are 2 μg/mL, 1 μg/mL and 1 μg/mL, respectively[2]. Micrococcin P1 is also a potent inhibitor of the malaria parasite Plasmodium falciparum[3].

  

• HY-126129

  Desacetylcefotaxime	66340-28-1
  Desacetylcefotaxime, the in vivo metabolite of Cefotaxime (CTX), possesses significant in vitro antimicrobial activity similar to the parent compound against a variety of aerobic and anaerobic bacteria[1].

  

• HY-12640R

  Pyrantel (pamoate) (Standard)	22204-24-6
  Pyrantel (pamoate) (Standard) is the analytical standard of Pyrantel (pamoate). This product is intended for research and analytical applications. Pyrantel pamoate (Pyrantel embonate) is an orally active anthelmintic and an agonist of the nicotinic acetylcholine receptor (nAChR). Pyrantel pamoate can cause spasmodic muscle paralysis in parasites. Pyrantel pamoate can be used in the study of parasitic infections such as ascariasis, hookworm infections, intestinal worms (pinworm infections), trichinosis and trichinosis[1][2].

  

• HY-126419

  Kobophenol A	124027-58-3	99.90%
  Kobophenol A, an oligomeric stilbene, blocks the interaction between the ACE2 receptor and S1-RBD with an IC50 of 1.81 μM and inhibits SARS-CoV-2 viral infection in cells with an EC50 of 71.6 μM. Kobophenol A inhibits the activity of partially purified rat brain protein kinase C (PKC) with an IC50 of 52 µM[1][2].

  

• HY-126937

  Ivermectin B1a	71827-03-7
  Ivermectin B1a, a derivative of Avermectin B1a (HY-15308), is a main component of Ivermectin (HY-15310)[1]. Ivermectin (MK-933) is a broad-spectrum anti-parasite agent. Ivermectin is a candidate therapeutic against SARS-CoV-2/COVID-19[2].

  

• HY-128033

  Fenpropimorph	67564-91-4
  Fenpropimorph is a fungicide that inhibits the sterol pathway. Fenpropimorph inhibits δ8-δ7-sterol isomerase in yeast at low concentrations, with δ14-sterol reductase being blocked at higher levels, preventing the biosynthesis of ergosterol. Fenpropimorph also inhibits sterol synthesis in certain plants and mammalian cells[1][2][3].

  

• HY-129197

  Stearyldiethanolamine	10213-78-2
  Stearyldiethanolamine is one of the compounds used in development for antibacterial freshness-keeping film or antibacterial nonwoven fabric[1].

  

• HY-130430

  Neplanocin A	72877-50-0
  Neplanocin A ((-)-Neplanocin A) is an antitumor antibiotic with significant antitumor activity against murine L1210 leukemia. Neplanocin A is also an irreversible inhibitor of AdoHcy hydrolase (Ki=8.39 nM). Neplanocin A also has antiviral activity and is effective against vaccinia virus. Neplanocin A is obtained from Ampulariella regularis[1].

  

• HY-130437

  p-nitro-Pifithrin-α	389850-21-9
  p-nitro-Pifithrin-α, a cell-permeable analog of pifithrin-α, is a potent p53 inhibitor. p-nitro-Pifithrin-α suppresses p53-mediated TGF-β1 expression in HK-2 cells. p-nitro-Pifithrin-α inhibits the activation of caspase-3 by Zika virus (ZIKV) strains. p-nitro-Pifithrin-α attenuates steatosis and liver injury in mice fed a high-fat diet [4]. non-alcoholic fatty liver disease[1][2][3].

  

• HY-130837

  JH-LPH-28	2414592-36-0	98.56%
  JH-LPH-28, a sulfonyl piperazine analog, is a potent UDP-2,3-diacylglucosamine pyrophosphate hydrolase LpxH inhibitor. JH-LPH-28 displays outstanding antibiotic activity with a MIC value of 0.83 μg/mL[1].

  

• HY-131146

  AMOZ	43056-63-9
  AMOZ is a carcinogenic metabolite of Furaltadone (HY-B1148A), which forms stable tissue residues by covalently binding to proteins as a hapten. AMOZ can be coupled with carrier proteins (such as BSA/OVA) to induce immune response and is released after acid hydrolysis. AMOZ residues can be detected by competitive ELISA method, and the detection limit in the monoclonal antibody 2E5.1 test is as low as 0.16 μg/kg (shrimp sample). AMOZ can be used as a typical marker to monitor drug residues in animal-derived foods in the field of food safety[1][2].

  

• HY-131165

  Amoxicillin (trihydrate) mixture with potassium clavulanate (4:1)
  Amoxicillin (trihydrate) mixture with potassium clavulanate (4:1) an antibiotic with good oral absorption and broad spectrum antimicrobial activity. Amoxicillin (trihydrate) mixture with potassium clavulanate (4:1) inhibits the biosynthesis of polypeptides in the cell wall, thereby inhibiting cell growth[1][2][3].

  

• HY-132282

  Thiamphenicol glycinate hydrochloride	2611-61-2	99.29%
  Thiamphenicol glycinate hydrochloride is a broad-spectrum antibacterial agent that can be used for respiratory tract infections research[1].

  

• HY-132598

  Miravirsen	1072874-90-8
  Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection[1][2].

  

• HY-13317S

  Oseltamivir-d3	1093851-61-6	98.61%
  Oseltamivir-d3 is a deuterium labeled Oseltamivir. Oseltamivir is an influenza virus neuraminidase inhibitor (NAI). Oseltamivir inhibits influenza A/H3N2, A/H1N2, A/H1N1, and B viruses with mean IC50s of 0.67, 0.9, 1.34 and 13 nM, respectively. Anti-influenza A and B agent[1].

  

• HY-133192

  Bis-propargyl-PEG3	126422-58-0
  Bis-propargyl-PEG3 is a PEG-based PROTAC linker used in the synthesis of PROTACs. Bis-propargyl-PEG3 is used in the synthesis of zinc-dipicolylamine (ZnDPA) complexes with antiplasmodial activity[1] [2]. Bis-propargyl-PEG3 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-133721

  Chamaechromone	93413-00-4	99.81%
  Chamaechromone is a biflavonoid ingredient isolated from the roots of Stellera chamaejasme L. (Thymelaeaceae). Chamaechromone possesses anti-hepatitis B virus (HBV) effects against the surface antigen of HBV (HBsAg) secretion and has insecticidal activities[1].

  

• HY-134116

  Isoflupredone acetate	338-98-7	98.55%
  Isoflupredone acetate is a corticosteroids with anti-inflammatory activity. Isoflupredone acetate can be used for research ketosis, musculoskeletal disorders, hypersensitivity, infections, inflammatory diseases in cows, horse, pigs, et al.[1][2].

  

• HY-134608

  Cobalt protoporphyrin IX	14325-03-2
  Cobalt protoporphyrin IX (Co-PPIX) is a potent and specific heme oxygenase-1 (HO-1) inducer. Cobalt protoporphyrin IX exhibits broad-spectrum antiviral activities against Influenza A virus (IAV)[1].

  

• HY-134648

  Ganfeborole	2131798-12-2
  Ganfeborole (GSK656 free base) is a potent, selective and orally active inhibitor of M. tuberculosis leucyl-tRNA synthetase, with an IC50 of 0.20 μM. Ganfeborole can be used for the research of tuberculosis[1].

  

• HY-135221

  Cefcapene pivoxil hydrochloride	147816-23-7	99.05%
  Cefcapene pivoxil hydrochloride, the pivalate ester prodrug form of Cefcapene, is an orally active third-generation cephalosporin with a wide spectrum of anti-bacterial activity. Cefcapene pivoxil hydrochloride has the potential for the palmoplantar pustulosis (PPP) research[1][2].

  

• HY-135389

  Desmethyl Levofloxacin	117707-40-1	99.77%
  Desmethyl Levofloxacin is a metabolite of Levofloxacin. Levofloxacin, a synthetic fluoroquinolone, is an antibacterial agent that inhibits the supercoiling activity of bacterial DNA gyrase, halting DNA replication[1].

  

• HY-135394

  3-Desacetyl Cefotaxime lactone	66340-33-8
  3-Desacetyl Cefotaxime lactone is the active metabolite of Cefotaxime. Cefotaxime sodium salt is a third-generation cephalosporin antibiotic.

  

• HY-135570

  hDHODH-IN-3	1644156-80-8	99.97%
  hDHODH-IN-3 (compound 21d) is a human dihydroorotate dehydrogenase (HsDHODH) inhibitor, inhibits measles virus replication with a pMIC50 value of 8.6[1].

  

• HY-135761

  Penconazole	66246-88-6	98.91%
  Penconazole is a typical triazole fungicide, and mainly applied on apples, grapes, and vegetables to control powdery mildew. Penconazole inhibits sterol biosynthesis in fungi. Penconazole decrease AChE activity in the cerebrum and cerebellum of rats[1][2].

  

• HY-136284

  XP-59	890402-73-0	99.67%
  XP-59 is a potent inhibitor of the SARS-CoV Mpro, with a Ki of 0.1 μM[1].

  

• HY-136306

  Metallo β-lactamase ligand 1	1087784-71-1	99.60%
  Metallo-beta-lactamase ligand 1 is a class B β-lactamase inhibitor with antibacterial activity extracted from patent WO2019221122A1, compound A[1].

  

• HY-13637S

  Ganciclovir-d5	1189966-73-1	98.32%
  Ganciclovir-d5 is the deuterium labeled Ganciclovir. Ganciclovir (BW 759), a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1)[1][2][3].

  

• HY-136512

  Streptazolin	80152-07-4	98.65%
  Streptazolin is an antibiotic. Streptazolin increases bacterial killing and elaboration of immunostimulatory cytokines by macrophages in vitro. Streptazolin stimulates the macrophage NF-κB pathway via PI3K signaling[1][2].

  

• HY-136559

  6-Azathymine	932-53-6	99.94%
  6-Azathymine, a 6-nitrogen analog of thymine, is a potent D-3-aminoisobutyrate-pyruvate aminotransferase inhibitor. 6-Azathymine inhibits the biosynthesis of DNA, and has antibacterial and antiviral activities[1][2][3][4].

  

• HY-137334

  Neuraminidase-IN-1	2379438-80-7	98.93%
  Neuraminidase-IN-1 is a neuraminidase inhibitor, with an IC50 of 0.21 μM. Neuraminidase-IN-1 has excellent activity against H1N1 influenza virus[1].

  

• HY-137367

  Z-Val-Val-Arg-AMC	124485-41-2	99.77%
  Z-Val-Val-Arg-AMC is a fluorescent peptide substrate that can be used to test the activity of cathepsins[1].

  

• HY-137498

  EBOV/MARV-IN-1	2479465-67-1	99.14%
  EBOV/MARV-IN-1 is a potent inhibitor of Ebola virus (EBOV) and Marburg virus (MARV), with broad-spectrum activity (EC50=0.31, and 0.82 µM, respectively) and low cytotoxicity (SI>100) in HeLa cells[1].

  

• HY-138136

  Ticlatone	70-10-0	99.02%
  Ticlatone is an antifungal that can be used for the research of mycoses[1].

  

• HY-138208

  Z-Phe-Tyr(tBu)-diazomethylketone	114014-15-2
  Z-Phe-Tyr(tBu)-diazomethylketone is a potent cathepsin L inhibitor. Z-Phe-Tyr(tBu)-diazomethylketone mediates reovirus disassembly. Z-Phe-Tyr(tBu)-diazomethylketone decreases viral detection[1][2].

  

• HY-138546

  Fmoc-Tpi-OH	204322-23-6	99.24%
  Fmoc-Tpi-OH is a biologically active amino acid that can be used to synthesize antimicrobial peptide mimetics[1].

  

• HY-138585

  DMT-dG(dmf) Phosphoramidite	330628-04-1
  DMT-dG(dmf) Phosphoramidite is a phosphinamide monomer that can be used in the preparation of oligonucleotides

  

• HY-138589

  7-TFA-ap-7-Deaza-dG	666847-77-4	98.04%
  5'-O-TBDMS-dG is a modified nucleoside. 5'-O-DMT-2'-O-TBDMS-rI can be used in the synthesis of deoxyribonucleic acid or nucleic acid. 7-TFA-ap-7-Deaza-dG is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-138598

  5'-O-TBDMS-dG	51549-33-8	98.83%
  5'-O-TBDMS-dG is a modified nucleoside. 5'-O-DMT-2'-O-TBDMS-rI can be used in the synthesis of deoxyribonucleic acid or nucleic acid.

  

• HY-138603

  5'-O-DMT-N4-Bz-2'-F-dC	146954-77-0
  5'-O-DMT-N4-Bz-2'-F-dC is a nucleoside with protective and modification effects.

  

• HY-138607

  5'-O-DMT-N2-DMF-dG	40094-22-2	99.09%
  5'-O-DMT-2'-O-TBDMS-rI is a modified nucleoside. 5'-O-DMT-2'-O-TBDMS-rI can be used in the synthesis of deoxyribonucleic acid or nucleic acid.

  

• HY-138614

  5'-O-DMT-2'-O-TBDMS-Ac-rC	121058-85-3	99.80%
  5'-O-DMT-2'-O-TBDMS-Ac-rC is a modified nucleoside and can be used to synthesize DNA or RNA.

  

• HY-139442

  RdRP-IN-2	2863657-16-1	98.01%
  RdRP-IN-2 is a RNA dependent RNA polymerase (RdRp) inhibitor. RdRP-IN-2 significantly inhibits SARS-CoV-2 RdRp with an IC50 of 41.2 μM.RdRP-IN-2 also inhibits Feline coronavirus (FIPV) replication[1].

  

• HY-139743

  Aditoprime	56066-63-8	99.68%
  Aditoprime (Aditoprim), a selective bacterial dihydrofolate reductase (DHFR) inhibitor, inhibits the transformation of dihydrofolic acid to tetrahydrofolic acid. Aditoprime inhibits E.coli and L.casei DHFR with IC50 of 47 and 520 nM, respectively. Aditoprime has a broad antimicrobial spectrum, good antibacterial activity and excellent pharmacokinetics[1][2][3].

  

• HY-139903

  Antifungal agent 18	2572713-30-3	98.08%
  Antifungal agent 18 is a novel antifungal agent for the research of fungal infection.

  

• HY-141841

  SARS-CoV-2-IN-7	2570461-66-2	99.40%
  SARS-CoV-2-IN-7 inhibits viral replication with a nanomolar IC50 value (844 nM) in SARS-CoV-2-infected Vero E6 cells.

  

• HY-144513

  Stigmastan-3β-ol	19466-47-8	98.52%
  Stigmastan-3β-ol is a sterol that can be isolated from Tinospora sinensis and Ginkgo biloba L.. Stigmastan-3β-ol has antimicrobial activity[1][2].

  

• HY-144646

  SP-471	2768010-39-3	99.79%
  SP-471 is a potent dengue virus (DENV) protease inhibitor with IC50 value of 18 μM. SP-471 inhibits both intermolecular and intramolecular protease processes of DENV[1].

  

• HY-144701

  SABA1	690681-65-3	99.15%
  SABA1 possesses antibacterial properties against Pseudomonas aeruginosa and Escherichia coli, with an IC50 of 4.0 µM against E. coli ACC[1].

  

• HY-145298

  Dicloromezotiaz	1263629-39-5	98.65%
  Dicloromezotiaz is a potent insecticide acting on nicotinic acetylcholine receptors (nAChRs). Dicloromezotiaz can be used to control a broad range of lepidoptera[1].

  

• HY-145455

  Salazopyridazine	22933-72-8
  Salazopyridazine is an antibacterial agent. Salazopyridazine shows activities against ulcerative colitis. Salazopyridazine can be used for the research of rheumatic diseases[1][2].

  

• HY-145560

  Claficapavir	2055732-24-4	99.14%
  Claficapavir (A1752) is a specific nucleocapsid protein (NC) inhibitor with an IC50 around 1 μM. Claficapavir strongly binds the HIV-1 NC (Kd=20 nM) thereby inhibiting the chaperone properties of NC and leading to good antiviral activity against the HIV-1[1].

  

• HY-145991

  Ribavirin carboxylic acid	39925-19-4	99.85%
  Ribavirin carboxylic acid (TR-COOH) is a metabolite of Ribavirin (HY-B0434), Ribavirin has strong antiviral activity[1].

  

• HY-146388

  Mtb ATP synthase-IN-1	2642394-38-3	98.55%
  Mtb ATP synthase-IN-1 (compound 6ab) is a potent Mycobacterium tuberculosis (Mtb) ATP synthase inhibitor, with MIC of 0.452-0.499 μg/mL against Mtb. Mtb ATP synthase-IN-1 has good metabolic stability, low cytotoxicity (Vero IC50 > 64 μg/mL), and acceptable oral bioavailability. Mtb ATP synthase-IN-1 can be used for researching anti-mycobacterium[1].

  

• HY-147237

  LpxC-IN-10	2413574-64-6
  LpxC-IN-10 (Compound A) is a high selectivity inhibitor of LpxC. LpxC-IN-10 exhibits MIC values of 0.5 μg/mL against E. coli and K. pneumoniae. LpxC-IN-10 (Compound A) can be used for the research of bacterial infection[1]. LpxC-IN-10 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

  

• HY-148178

  MMV688533	2260904-47-8	99.50%
  MMV688533 is an antimalarial agent with rapid anti-plasmodial activity and effective single-dose activity against Plasmodium falciparum infection in humanized mouse models. MMV688533 can inhibit the activity of asexual blood stage parasites with an IC50 value of 1.3 nM. MMV688533 exhibits excellent pharmacokinetic properties and safety[1].

  

• HY-148315

  GLUT1-IN-2	305357-89-5	99.27%
  GLUT1-IN-2 (compound 17) is a GLUT1 inhibitor with an IC50 value of 12 μM. GLUT1-IN-2 shows inhibitory effect to Plasmodium falciparum hexose transporter PfHT with an IC50 value of 13 μM. GLUT1-IN-2 can be used for the research of infection[1].

  

• HY-148478

  MMV688845	2208962-35-8	99.35%
  MMV688845 is a nontuberculous mycobacteria (NTM) RNA polymerase inhibitor with bactericidal activity against Mycobacterium abscessus and anti-tuberculosis efficacy[1].

  

• HY-148578

  CamA-IN-1	2924055-46-7	99.03%
  CamA-IN-1 is a Clostridioides difficile-specific DNA adenine methyltransferase (CamA) inhibitor. CamA-IN-1 has inhibitory for CamA with IC50 and Kd values of 0.4 μM and 0.2 μM, respectively. CamA-IN-1 can be used for the research of Clostridioides difficile infections (CDI)[1].

  

• HY-149048

  Adenosylhomocysteinase	9025-54-1
  Adenosylhomocysteinase (SAHH; AHCY) is a highly conserved enzyme. Adenosylhomocysteinase reversible catalyzes S-adenosylhomocysteine (SAH) to adenosine and L-homocysteine. The serum exosomal Adenosylhomocysteinase level can be used as a prognostic biomarker in HBV-LC patients[1][2].

  

• HY-149321

  SARS-CoV-2 nsp14-IN-3	2920574-16-7
  SARS-CoV-2 nsp14-IN-3 (4975) is an inhibitor of the SARS-CoV-2 Nsp14 N7-Methyltransferase (IC50: 3.5 μM)[1].

  

• HY-150737

  MI-1851	2417283-44-2
  MI-1851 is a potent furin inhibitor. MI-1851 prevents the proteolytic processing of the S protein of SARS-CoV-2 by endogenous flavoprotease in HEK293 cells. MI-185 has antiviral activity[1][2].

  

• HY-150758

  NDM-1 inhibitor-3		99.41%
  NDM-1 inhibitor-3 (Compound 89) is a New Delhi Metallo-β-lactamase-1 (NDM-1) inhibitor with a Ki of 4 μM[1].

  

• HY-151221

  CID 697851	312508-42-2	99.49%
  CID 697851 is an AddAB and RecBCD inhibitor, with IC50s of 13 and 33 nM. CID 697851 can be used for antibacterial research[1].

  

• HY-152101

  LY1	2883813-32-7	98.01%
  LY1 is a potent, selective and covalent inhibitor against both SARS-CoV-2 PLpro and Mpro with Kd values of 1.5 μM and 2.3 μM for Mpro C145A protein and PLpro C111A protein, respectively. LY1 potent against the viral proteases, with IC50s of 0.12 μM and 0.99 μM against Mpro and PLpro. LY1 shows high selectivity over other kinases, human proteases and metalloenzyme[1].

  

• HY-152121

  Glucocorticoid receptor agonist-1 phosphate Ala-Ala-Mal	2345732-89-8
  Glucocorticoid receptor agonist-1 phosphate Ala-Ala-Mal is a glucocorticoid receptor agonist. Glucocorticoid receptor agonist-1 phosphate Ala-Ala-Mal can be used in anti-CD40 antibody agent conjugate (ADC). Glucocorticoid receptor agonist-1 phosphate Ala-Ala-Mal can be used for the research of inflammation and immune regulation[1].

  

• HY-153695

  TXA707	1609670-89-4
  TXA707, the active metabolite of TXA-709, is an FtsZ inhibitor with antibacterial activity. TXA707 is promising for research of S. aureus infections[1][2].

  

• HY-153764

  IDO-IN-18	314027-92-4
  IDO-IN-18 (Compound 00815) is an IDO inhibitor. IDO-IN-18 can be used for research of immunosuppression associated infectious or cancer diseases[1].

  

• HY-155107

  ND-011992	2446880-46-0	98.26%
  ND-011992 is a reversible, selective quinazoline-type inhibitor targeting quinone reductases and quinol oxidases. ND-011992 inhibits respiratory complex I and bo3 oxidase in addition to bd-I and bd-II oxidases in E. coli strain BL21*Δcyo with the IC50 of 0.12, 2.47, 0.63 and 1.3 μM, respectively. ND-011992 can be used for tuberculosis study[1].

  

• HY-155144

  CDD-1845	2894104-50-6	99.60%
  CDD-1845 is a non-covalent and non-peptide potent SARS-CoV-2 Mpro inhibitor with a Ki of 3 nM. CDD-1845 also inhibits ΔP168, A173V, and ΔP168/A173V Mpro variants[1].

  

• HY-155354

  Antimalarial agent 33		99.13%
  Antimalarial agent 33 (compound 5g) has antiplasmodial activity against erythrocytic and hepatic stages of Plasmodium with an EC50 of 1.1 μM for K1 P. falciparum strain. Antimalarial agent 33 demonstrats enhanced microsomal stability (T1/2=29 min). Antimalarial agent 33 has no significant cytotoxicity against primary hepatocytes[1].

  

• HY-155488

  SHEN26	2691076-98-7	99.10%
  SHEN26 (ATY014) is a potent and orally active RdRp inhibitor, with an IC50 for SARS-CoV-2 is 1.36 μM. SHEN26 is a 5’-cyclohexanecarboxylate derivative of GS-441524 (HY-103586). SHEN26 inhibits viral nucleic acid synthesis to achieve antiviral effects. SHEN26 can be used for the research of coronavirus disease 2019 (COVID-19)[1][2].

  

• HY-156651

  Zevotrelvir	2773516-53-1	99.71%
  Zevotrelvir (Compound 52) is a coronavirus inhibitor with IC50 ranges of <0.1 μM and <0.1mM for 229E hCoV and SARS-CoV-23C-like (3CL) proteases, respectively. Zevotrelvir has the potential to study viral infections[1].

  

• HY-157518

  OJT008	256370-29-3	99.62%
  OJT008 is an inhibitor of MtMetAP1c. OJT008 inhibits NiCl2- and CoCl2 activated MtMetAP1c with IC50s of 11 and 40 μM, respectively. OJT008 can used to study tuberculosis[1].

  

• HY-162457

  Mn007	1843236-92-9
  Mn007 is a potent inhibitor of bovine pancreatic DNase I, with the IC50 of 45 μM, by forming molecular aggregation. Mn007 shows suppression of S. pyogenes growth in human whole blood[1].

  

• HY-163318

  NS2B/NS3-IN-8	1021221-94-2
  NS2B/NS3-IN-8 (compound MH1) is a Zika virus NS2B-NS3 protease inhibitor[1].

  

• HY-163459

  HWY-289	908001-51-4
  HWY-289 is a semisynthetic protoberberine derivative, has broad-spectrum and potent activities against phytopathogenic fungi, particularly Botrytis cinerea (EC50 = 1.34 μg/mL). HWY-289 changes the morphology of the mycelium and the internal structure of cells. HWY-289 reduces ATP content, ATPase activities, and key enzyme activities in the TCA cycle[1].

  

• HY-163540

  NP-BTA	544420-99-7	99.15%
  NP-BTA is an allosteric inhibitor for glutaminyl-tRNA synthetase (GlnRS). NP-BTA exhibits antifungal efficacy against Candida albicans, with MIC50 of 6.25 μM[1].

  

• HY-16973S

  Fluralaner-13C2,15N,d3		98.35%
  Fluralaner-13C2,15N,d3 is the deuterium, 13C-, and 15-labeled Fluralaner. Fluralaner (INN) is a systemic insecticide and acaricide Fluralaner through potent blockage of GABA and L-glutamate gated chloride channels.

  

• HY-169993

  ALG-000184	2495324-72-4
  ALG-000184, a prodrug of the potent Hhepatitis B virus (HBV) capsid assembly modulator ALG-001075, has the potential for the research of HBV infection research[1].

  

• HY-17373S

  Posaconazole-d5	1217785-83-5	99.14%
  Posaconazole-d5 is a deuterium-labeled form of Posaconazole. Posaconazole is a broad-spectrum, second generation, triazole compound with antifungal activity[1].

  

• HY-17395S

  Terbinafine-d3 hydrochloride	1310012-15-7
  Terbinafine-d3 (hydrochloride) is the deuterium labeled Terbinafine hydrochloride. Terbinafine hydrochloride (TDT 067 hydrochloride) is an antifungal medication used to treat fungal infections. It is a potent non-competitive inhibitor of squalene epoxidase from Candida with a Ki of 30 nM[1][2]. Terbinafine hydrochloride also antibacterial activity against certain Gram-positive and Gram-negative bacteria[3].

  

• HY-17514S

  Itraconazole-d5	1217510-38-7
  Itraconazole-d5 is the deuterium labeled Itraconazole. Itraconazole (R51211) is a triazole antifungal agent and a potent and orally active Hedgehog (Hh) signaling pathway antagonist with an IC50 of ~800 nM. Itraconazole potently inhibits lanosterol 14α-demethylase (cytochrome P450 enzyme), thereby inhibits the oxidative conversion of lanosterol to ergosterol. Itraconazole has anticancer and antiangiogenic effects[1][2][3].

  

• HY-17592A

  Bithionol (sulfoxide)	844-26-8	99.02%
  Bithionol sulfoxide is an anti-infection agent for parasites. Bithionol sulfoxide has mutagenic activity. Bithionol sulfoxide can be used in the research of parasite infection, such as paragonimiasis, flukes andcestodes infection[1][2][5].

  

• HY-20685S

  Palmitoylethanolamide-d4	1159908-45-8
  Palmitoylethanolamide-d4 is the deuterium labeled Palmitoylethanolamide. Palmitoylethanolamide (Palmidrol) is an active endogenous compound which can used for preventing virus infection of the respiratory tract.

  

• HY-401913

  endo CNTinh-03	345288-49-5	99.96%
  Endo CNTinh-03 is inhibitor for the elevation of cAMP and cGMP induced by agonist, such as G protein-coupled receptors, adenylate cyclase, and guanylate cyclase (IC50 is 4 μM). Endo CNTinh-03 inhibits cholera toxin- and Escherichia coli (STa) toxin- induced CFTR chloride current, ameliorates secretory diarrhea in mouse models, and prevents cyst growth in polycystic kidney disease model[1].

  

• HY-A0110A

  Cefotiam hexetil hydrochloride	95789-30-3
  Cefotiam hexetil hydrochloride (CTM-HE) is an oral third-generation cephalosporin, which is a proagent of cefotiam, but has no anti-bacterial property. Cefotiam is an antibiotic[1].

  

• HY-A0161A

  Chlophedianol hydrochloride	511-13-7	99.62%
  Chlophedianol (Clofedanol) hydrochloride is an orally active and potent antitussive agent. Chlophedianol hydrochloride can be used for the research of acute cough due to upper respiratory tract infections (URIs)[1][2].

  

• HY-B0035A

  Sulfamethazine sodium	1981-58-4	99.90%
  Sulfamethazine sodium (Sulfadimidine sodium) is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections). In China and the European Commission, the maximum residue level for Sulfamethazine sodium in animal product is set at 100 µg/kg[1][2].

  

• HY-B0200R

  Cephalexin (Standard)	15686-71-2
  Cephalexin (Standard) is the analytical standard of Cephalexin. This product is intended for research and analytical applications. Cephalexin (Cefalexin) is a potent, orally active semisynthetic cephalosporin antibiotic with a broad antibacterial spectrum. Cephalexin has antibacterial activity against a wide variety of gram-positive and gram-negative bacteria. Cephalexin targets penicillin-binding proteins (PBPs) to inhibit bacterial cell wall assembly. Cephalexin is used for the research of pneumonia, strep throat, and bacterial endocarditis, et al[1][2].

  

• HY-B0210S

  Cefoperazone-d5	2410425-70-4	98.58%
  Cefoperazone-d5 is deuterium labeled Cefoperazone. Cefoperazone, a semisynthetic cephalosporin, has a broad spectrum of antibacterial activity[1].

  

• HY-B0219S

  Allopurinol-d2	916979-34-5	98.36%
  Allopurinol-d2 is deuterium labeled Allopurinol. Allopurinol is a potent xanthine oxidase inhibitor (IC50 values of 0.2 to 50 μM). Allopurinol can be used for the research of hyperuricemia and gout. Antileishmanial effect[1][2].

  

• HY-B0220D

  Erythromycin thiocyanate	7704-67-8
  Erythromycin thiocyanate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin thiocyanate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin thiocyanate also exhibits antitumor and neuroprotective effect in different fields of research[3][4].

  

• HY-B0272R

  Rifampicin (Standard)	13292-46-1
  Rifampicin (Standard) is the analytical standard of Rifampicin. This product is intended for research and analytical applications. Rifampicin is a potent and broad spectrum antibiotic against bacterial pathogens. Rifampicin has anti-influenza virus activities. Rifampicin shows anti-orthopoxvirus activity.

  

• HY-B0402S

  Amantadine-d15	33830-10-3
  Amantadine-d15 is the deuterium labeled Amantadine. Amantadine (1-Adamantanamine) is an antiviral agent with activity against influenza A viruses. Amantadine blocks the proton flow through the M2 ion channel (M2 proton channel of influenza A) and thus prevents the release of viral RNA into the cytoplasm of the infected cells. Amantadine is an antiparkinsonian agent[1][2].

  

• HY-B0887C

  1R-cis-Permethrin	54774-45-7	99.89%
  1R-cis-Permethrin is an insecticide and neurotoxin. 1R-cis-Permethrin affects neuron membranes by prolonging sodium channel activation[1].

  

• HY-B1207S

  Urethane-d5	73962-07-9	98.2%
  Urethane-d5 is the deuterium labeled Urethane. Urethane (Ethyl carbamate), the ethyl ester of carbamic acid, is a byproduct of fermentation found in various food products. Urethane has the ability to suppress bacterial, protozoal, sea urchin egg, and plant tissue growth in vitro[1].

  

• HY-B1805S

  Triclocarban-d4	1219799-29-7
  Triclocarban-d4 is the deuterium labeled Triclocarban. Triclocarban (3,4,4′-Trichlorocarbanilide), a broad spectrum antibacterial compound, is widely used in a broad range of applications such as the production of soaps, skin creams, toothpastes and deodorants. Triclocarban is a potential endocrine-disrupting chemical with the capacity to modulate androgen and estrogen activities as well as other hormone-mediated biological processes[1][2][3].

  

• HY-B2157S

  Robenidine-d8 hydrochloride	1173097-77-2
  Robenidine-d8 (hydrochloride) is the deuterium labeled Robenidine hydrochloride. Robenidine hydrochloride is an anticoccidial agent which is also active against MRSA and VRE with MIC50s of 8.1 and 4.7 μM, respectively.

  

• HY-B2227C

  Lactate potassium	996-31-6
  Lactate (Lactic acid) potassium is used as a sodium chloride substitute in the elaboration of dry meat products. Lactate potassium (56%) and sodium diacetate (4%) mixture inhibit the development of L. sake and L. monocytogenes bacteria at 4℃ to extend the shelf life of food[1][2].

  

• HY-E70012

  Penicillinase	9001-74-5
  Penicillinase is a beta-lactamase. beta-lactamase enzymes inactivate beta-lactam antibiotics by hydrolyzing the peptide bond of the characteristic four-membered beta-lactam ring rendering the antibiotic ineffective[1].

  

• HY-N0453R

  Hypericin (Standard)	548-04-9
  Hypericin (Standard) is the analytical standard of Hypericin. This product is intended for research and analytical applications. Hypericin is a naturally occurring substance found in Hyperlcurn perforatum L. Hypericin is an inhibitor of PKC (protein kinase C), MAO (monoaminoxidase), dopamine-beta-hydroxylase, reverse transcriptase, telomerase and CYP (cytochrome P450). Hypericin shows antitumor, antiviral, antidepressive activities, and can induce apoptosis[1][2][3].

  

• HY-N0470S

  L-Lysine-15N2 hydrochloride	1217460-44-0
  L-Lysine-15N2 (hydrochloride) is the 15N-labeled L-Lysine hydrochloride. L-lysine hydrochloride is an essential amino acid for humans with various benefits including treating herpes, increasing calcium absorption, reducing diabetes-related illnesses and improving gut health.

  

• HY-N0492R

  α-Lipoic Acid (Standard)	1077-28-7	99.90%
  α-Lipoic Acid (Standard) is the analytical standard of α-Lipoic Acid. This product is intended for research and analytical applications. α-Lipoic Acid (Thioctic acid) is an antioxidant, which is an essential cofactor of mitochondrial enzyme complexes. α-Lipoic Acid inhibits NF-κB-dependent HIV-1 LTR activation[1][2][3]. α-Lipoic Acid induces endoplasmic reticulum (ER) stress-mediated apoptosis in hepatoma cells[4]. α-Lipoic Acid can be used with CPUL1 (HY-151802) to construct the self-assembled nanoaggregate CPUL1-LA NA, which has improved antitumor efficacy than CPUL1[5].

  

• HY-N10495

  Seconeolitsine	2650074-56-7
  Seconeolitsine, an antibiotic, and is an inhibitor of targeting topoisomerase I (TopA). Seconeolitsine also is a new antimicrobial agent that can inhibit S. pneumoniae growth. Seconeolitsine can inhibit TopA relaxation activity with an IC50 value of 17 μM. Seconeolitsine can be used for the research of S. pneumoniae infections resistant to other antibiotics[1].

  

• HY-N10543

  5-O-(E)-p-Coumaroylquinic acid	5746-55-4	99.86%
  5-O-(E)-p-Coumaroylquinic acid, a quinic acid derivative, is a potent phytochemical agent against hepatitis B virus[1].

  

• HY-N11415

  Aurachin SS	2118401-92-4
  Aurachin SS is a nature product that could be isolated from Streptomyces sp. NA04227. Aurachin SS is an antibiotic and has antibacterial activity[1].

  

• HY-N11422

  Mycaminosyltylonolide	61257-02-1
  Mycaminosyltylonolide is a potent antibiotic. Mycaminosyltylonolide shows antibacterial activity. Mycaminosyltylonolide inhibits luciferase synthesis[1][2].

  

• HY-N11772

  Mutanocyclin	875455-92-8	99.94%
  Mutanocyclin is a potent antifungal agent. Mutanocyclin inhibits Candida albicans (C. albicans) filamentation. Mutanocyclin decreases the mRNA expression of HWP1, ECE1, FLO8, TEC1. Mutanocyclin inhibits yeast-form in ex vivo mouse[1].

  

• HY-N11911

  Verazine	14320-81-1
  Verazine ((-)-Verazine) is an anti-Fungal Agent that can be found in the dried roots and rhizoma of Veratrum maackii Regel. Verazine causes DNA damage in the cerebellum and cerebral cortex of mice in a dose-dependent manner. Verazine can be used in the study of fungal infections and neurological diseases[1][2].

  

• HY-N12240

  Oleanolic aldehyde	17020-22-3	99.84%
  Oleanolic aldehyde is an antimicrobial compound used to inhibit oral bacteria. Oleanolic aldehyde inhibits Streptococcus mutans and Porphyromonas gingivalis, which are associated with dental caries and periodontal disease, with minimum inhibitory concentrations (MICs) of 488 μg/mL and 250 μg/mL, respectively[1].

  

• HY-N1415R

  β-Caryophyllene (Standard)	87-44-5	98.78%
  β-Caryophyllene (Standard) is the analytical standard of β-Caryophyllene. This product is intended for research and analytical applications. β-Caryophyllene is a CB2 receptor agonist.

  

• HY-N1584C

  Halofuginone lactate	82186-71-8	98.32%
  Halofuginone lactate, a Febrifugine derivative, is a competitive prolyl-tRNA synthetase inhibitor with a Ki of 18.3 nM[1][2]. Halofuginone lactate is a specific inhibitor of type-I collagen synthesis and attenuates osteoarthritis (OA) by inhibition of TGF-β activity[3][4]. Halofuginone lactate is also a potent pulmonary vasodilator by activating Kv channels and blocking voltage-gated, receptor-operated and store-operated Ca2+ channels. Halofuginone lactate has anti-malaria, anti-inflammatory, anti-cancer, anti-fibrosis effects[5].

  

• HY-N1778A

  (E)-3,4-Dimethoxycinnamic acid	14737-89-4	99.91%
  (E)-3,4-Dimethoxycinnamic acid is the less active isomer of 3,4-Dimethoxycinnamic acid. 3,4-Dimethoxycinnamic acid exerts anti-apoptotic effects on L-02 cells via the ROS-mediated signaling pathway[1]. Anti-apoptotic effects[1].

  

• HY-N1944A

  cis-Nerolidol	3790-78-1
  cis-Nerolidol is a sesquiterpene alcohol that can be found in various plants. cis-Nerolidol exhibits antioxidant and antibacterial activities. cis-Nerolidol can also potentiate the action of antibiotics[1].

  

• HY-N6952R

  Geraniol (Standard)	106-24-1
  Geraniol (Standard) is the analytical standard of Geraniol. This product is intended for research and analytical applications. Geraniol, an olefinic terpene, was found to inhibit growth of Candida albicans and Saccharomyces cerevisiae strains[1].

  

• HY-N7144A

  Citronellyl acetate	150-84-5
  Citronellyl acetate is a monoterpene product of the secondary metabolism of plants, with antinociceptive activity. Citronellyl acetate exhibits pro-apoptotic activity in human hepatoma cells. Citronellyl acetate shows fungicidal, larvicidal, bactericidal and repelling/insecticidal effects[1].

  

• HY-P1508A

  Bactenecin TFA		98.42%
  Bactenecin TFA (Bactenecin, bovine TFA) is a potent 12-aa looped antimicrobial peptide isolated from bovine neutrophils. Bactenecin TFA inhibits the growth of bacteria and yeast, and kills the fungus Trichophyton rubrum. Bactenecin TFA increass membrane permeability, inhibits the growth and biofilm formation of B. pseudomallei[1][2][3].

  

• HY-P1783A

  M2e, human TFA		99.86%
  M2e, human TFA, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A. M2e, human TFA is a valid and versatile vaccine candidate to protect against any strain of human influenza A[1].

  

• HY-P99309

  Pagibaximab	595566-61-3	98.81%
  Pagibaximab is a chimeric IgG1 antibody recognizing the surface component lipoteichoic acid of S. aureus and S. epidermidis. Pagibaximab can be used to prevent staphylococcal sepsis[1].

  

• HY-P99425

  Afelimomab	156227-98-4
  Afelimomab (MAK 195F) is an anti-tumor necrosis factor F(ab')2 monoclonal antibody fragment. Afelimomab can be used for the research of sepsis[1].

  

• HY-P99551

  Tosatoxumab	1374419-41-6
  Tosatoxumab (AR-301; KBSA301) is a human immunoglobulin G1 monoclonal antibody that specifically neutralizes alpha-toxin (alpha-hemolysin; Hla) of S. aureus. Tosatoxumab binds to an N-terminal epitope of alpha-toxin, thereby preventing functional toxin pore oligomerisation. Tosatoxumab has the potential for passive immunotherapy in the S. aureus pneumonia as an adjunctive therapy to standard antibiotic agent[1][2].

  

• HY-P99571

  Tefibazumab	521079-87-8	99.90%
  Tefibazumab is a humanized IgG1κ monoclonal antibody that binds to the surface-expressed adhesion protein clumping factor A. Tefibazumab can be used for the research of serious Staphylococcus aureus infections[1][2].

  

• HY-P99584

  Suvizumab	914257-21-9
  Suvizumab (KD-247) is an neutralizing antibody anti-HIV-1. Suvizumab effectively neutralizes HIV-1MN, HIV-1SF2 and HIV-189.6 with IC50 values of 0.1 µg/mL, 1.0 µg/mL and 0.2 µg/mL, respectively. Suvizumab reduces the viral load of HIV. Suvizumab has good tolerance and can be used to prevent HIV infection[1][2].

  

• HY-P99686

  Larcaviximab	1792982-56-9
  Larcaviximab (c4G7-N) is an IgG1 kappa anti-Ebola virus glycoprotein chimeric monoclonal antibody[1].

  

• HY-P99703

  Libivirumab	569658-79-3	98.27%
  Libivirumab (17.1.41) is a human anti-HBV monoclonal antibody. Libivirumab shows neutralization activity with IC50s of 35, 130 ng/mL for HBsAg, HBeAg, respectively[1].

  

• HY-P99811

  Rafivirumab	944548-37-2
  Rafivirumab (CR57) is an anti-rabies virus monoclonal antibody for the prophylaxis of rabies. Rafivirumab has neutralizing potency against a broad spectrum of RABV variants. Rafivirumab can be used for research of cocktails[1][2][3].

  

• HY-Y0366S

  Lauric acid-13C	93639-08-8	99.80%
  Lauric acid-13C is the 13C labeled Lauric acid. Lauric acid is a middle chain-free fatty acid with strong bactericidal properties. The EC50s for P. acnes, S.aureus, S. epidermidis, are 2, 6, 4 μg/mL, respectively.

  

• HY-Y1718S

  Tridecanoic acid-d2	64118-44-1	98.71%
  Tridecanoic acid-d2 is the deuterium labeled Tridecanoic acid. Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation[1].

  

• HY-100540C

  Golgicide A-1	1394285-49-4	99.94%
  Golgicide A-1 (GCA-1) is a less active cis-diastereomer of Golgicide A (GCA). Golgicide A-1 weakly inhibits mosquito reproduction[1].

  

• HY-106312A

  Enviroxime	72301-79-2
  Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein[1].

  

• HY-106410A

  Zabofloxacin hydrochloride	623574-00-5	99.54%
  Zabofloxacin hydrochloride (DW-224a) is a potent and seletive inhibitor of the bacterial type II and IV topoisomerases. Zabofloxacin hydrochloride has excellent activity against gram-positive pathogens including Steptococcus aureus, Streptococcus pyogenes and S.pneumonia. Zabofloxacin hydrochloride is a novel fluoronaphthyridone quinolone that is considered as an alternative antibiotic for treatment of quinolone-susceptible (QSSP) and quinolone-resistant gonorrhea (QRSP)[1].

  

• HY-106922A

  Sanfetrinem sodium	141611-76-9
  Sanfetrinem (GV104326) sodium is a beta-lactamase-stable antibiotic. Sanfetrinem sodium has broad-spectrum activity against gram-positive and gram-negative bacteria[1].

  

• HY-107372S

  Uridine triphosphate-13C9,15N2 sodium	285978-18-9
  Uridine triphosphate-13C9,15N2 (sodium) is a labeled Uridine triphosphate sodium. Uridine triphosphate sodium can be used in nucleic acid synthesis.

  

• HY-108060A

  Valopicitabine dihydrochloride	640725-71-9	99.79%
  Valopicitabine (NM283) dihydrochloride is a nucleoside analog and the orally bioavailable proagent of the potent anti-HCV agent 2'-C-methylcytidine (NM107). NM107competitively inhibits NS5B polymerase, causing chain termination[1][2].

  

• HY-108640A

  HLI373 dihydrochloride	1782531-99-0
  HLI373 dihydrochloride is an efficacious Hdm2 inhibitor. HLI373 dihydrochloride inhibits the ubiquitin ligase activity of Hdm2. HLI373 dihydrochloride is effective in inducing apoptosis of several tumor cells that are sensitive to DNA-damaging agents[1]. Antimalarial activity[2].

  

• HY-110147B

  SSM3 tetraTFA hydrate
  SSM3 tetraTFA hydrate is a potent synthetic furin inhibitor with an EC50 and a Ki of 54 nM and 12 nM, respectively. SSM3 tetraTFA hydrate is able to block furin-dependent cell surface processing of anthrax protective antigen-83 in vitro[1][2].

  

• HY-113471A

  (S)-(-)-Perillic acid	23635-14-5
  (S)-(-)-Perillic acid is a terpenoid plant extract with antimicrobial and anticancer activities. (S)-(-)-Perillic acid induces cell apoptosis and cell cycle arrest, and increases the levell of Bax, Bcl2, p21 and caspase-3 proteins. (S)-(-)-Perillic acid can be used for cancer and infection research[1][2][3].

  

• HY-116387A

  WR99210 hydrochloride	30711-93-4	98.34%
  WR99210 hydrochloride is an orally active and low-toxicity dihydrofolate reductase (DHFR) inhibitor (IC50<0.075 nM). WR99210 hydrochloride shows good antiparasitic activity and is effective against P. falciparum and P. falciparum strains as well as T. gondii[1][2][3].

  

• HY-121305A

  L-Ribulose	2042-27-5
  L-Ribulose, an isomer of L-ribose, is an important precursor for other rare sugars and L-nucleoside analogue synthesis[1].

  

• HY-124793A

  GAK inhibitor 49 hydrochloride	2930378-91-7	99.52%
  GAK inhibitor 49 hydrochloride is a potent, ATP-competitive and highly selective cyclin G associated kinase (GAK) inhibitor with a Ki of 0.54 nM and a cell IC50 of 56 nM. GAK inhibitor 49 hydrochloride also shows binding to RIPK2[1].

  

• HY-125785A

  2-Mercaptopyridine N-oxide sodium	3811-73-2
  2-Mercaptopyridine N-oxide sodium has bactericidal effect and is against a standard strain of Mycobacterium tuberculosis H37Rv (ATCC 27294) with MIC90 of 7.20 μM. 2-Mercaptopyridine N-oxide sodium and its complex with iron, gallium, and bismuth have good anti-M. tuberculosis activity. 2-Mercaptopyridine N-oxide sodium has potential for the treatment of tuberculosis[1].

  

• HY-131144S

  AMOZ-d5	1017793-94-0	99.0%
  AMOZ-d5 is a deuterium labeled AMOZ. AMOZ, a tissue bound metabolite of Furaltadone, Furaltadone is a synthetic nitrofuran antibiotic widely used[1].

  

• HY-132600A

  RG-101 sodium
  RG-101 sodium is a hepatocyte targeted N-acetylgalactosamine conjugated oligonucleotide that antagonises miR-122. miR-122 is an important host factor for hepatitis C virus (HCV) replication[1].

  

• HY-135810A

  Cletoquine oxalate	14142-64-4	99.76%
  Cletoquine oxalate (Desethylhydroxychloroquine oxalate) is a major active metabolite of Hydroxychloroquine. Cletoquine oxalate is produced in the liver by CYP2D6, CYP3A4, CYP3A5, and CYP2C8 isoenzymes. Cletoquine oxalate is also a Chloroquine derivative and has the ability to against the chikungunya virus (CHIKV). Cletoquine oxalate has antimalarial effects and has the potential for autoimmune diseases treatment[1][2].

  

• HY-135867F

  NHC-diphosphate triammonium		98.80%
  NHC-diphosphate triammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a diphosphate form[1]. NHC-diphosphate triammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA[1][2].

  

• HY-138561C

  EFdA-TP tetralithium
  EFdA-TP tetralithium is a potent nucleoside reverse transcriptase (RT) inhibitor. EFdA-TP tetralithium inhibits RT-catalyzed DNA synthesis as an effective immediate or delayed chain terminator (ICT or DCT). EFdA-TP tetralithium inhibits HIV-1 RT with multiple mechanisms[1].

  

• HY-16305S1

  Maribavir-d6 TFA
  Maribavir-d6 TFA (1263W94-d6 TFA; BW1263W94-d6 TFA; GW257406X-d6 TFA) is a deuterium labeled Maribavir (HY-16305). Maribavir is an orally active antiviral agent for cytomegalovirus (CMV) through inhibition of protein kinase UL97 and the following CMV DNA replication[1].

  

• HY-17422S1

  Acyclovir-d4	1185179-33-2	98.66%
  Acyclovir-d4 is the deuterium labeled Acyclovir. Acyclovir (Aciclovir) is a guanosine analogue and an orally active antiviral agent. Acyclovir inhibits HSV-1 (IC50 of 0.85 μM), HSV-2 (IC50 of 0.86 μM) and varicella-zoster virus. Acyclovir can be phosphorylated by viral thymidine kinase (TK), and Acyclovir triphosphate interferes with viral DNA polymerization through competitive inhibition with guanosine triphosphate and obligatory chain termination[1][2][3]. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia[4].

  

• HY-78131S2

  Ibuprofen-d4		99.28%
  Ibuprofen-d4 is a deuterium labeled Ibuprofen (HY-78131). Ibuprofen is a potent, orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen ((±)-Ibuprofen) can be used in the research of pain, swelling, inflammation, infection, immunology, cancers[1][2][3][4][5].

  

• HY-B0105S1

  Ketoconazole-d4	1398065-75-2
  Ketoconazole-d4 is the deuterium labeled Ketoconazole. Ketoconazole (R-41400) is an imidazole anti-fungal agent, a CYP3A4 and CYP24A1 inhibitor.

  

• HY-B0134AS

  Bestatin-d7 hydrochloride
  Bestatin-d7 (hydrochloride) is deuterium labeled Bestatin (hydrochloride). Bestatin hydrochloride is an inhibitor of CD13 (Aminopeptidase N)/APN and leukotriene A4 hydrolase, used for cancer research.

  

• HY-B0260S3

  Methylprednisolone-d7		99.73%
  Methylprednisolone-d7 is deuterium labeled Methylprednisolone. Methylprednisolone is a synthetic corticosteroid with anti-inflammatory and immunomodulating properties. Methylprednisolone improve severe or critical COVID-19 by activating ACE2 and reducing IL-6 levels[3].

  

• HY-B0337S1

  Sulfadimethoxine-d6	73068-02-7
  Sulfadimethoxine-d6 is the deuterium labeled Sulfadimethoxine. Sulfadimethoxine is a sulfonamide antibiotic used to treat many infections[1].

  

• HY-B0510S2

  Trimethoprim-d3	1189923-38-3	98.24%
  Trimethoprim-d3is the deuterium labeled Trimethoprim. Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for urinary tract infections, Shigellosis and Pneumocystis pneumonia treatment[1][2][3].

  

• HY-B0935S1

  Benzyl benzoate-d12	352431-26-6	99.85%
  Benzyl benzoate-d12 is the deuterium labeled Benzyl benzoate[1]. Benzyl benzoate (Benzoic acid benzyl ester) is a fragrance ingredient in cosmetic products. Benzyl benzoate can be used for the research of Scabies and Demodex-associated inflammatory skin conditions[2][3][4].

  

• HY-N0097S6

  Guanosine-13C10,15N5	202406-81-3	99.8%
  Guanosine-13C10,15N5 is the 13C and 15N labeled Guanosine (HY-N0097). Guanosine (DL-Guanosine) is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine possesses anti-HSV activity[1].

  

• HY-N0565AR

  Doxycycline (hydrochloride) (Standard)	10592-13-9
  Doxycycline (hydrochloride) (Standard) is the analytical standard of Doxycycline (hydrochloride). This product is intended for research and analytical applications. Doxycycline hydrochloride, an antibiotic, is an orally active and broad-spectrum metalloproteinase (MMP) inhibitor[1]. Doxycycline hydrochloride shows antibacterial activity and anti-cancer cell proliferation activity[1][2][3][4][5].

  

• HY-N10109A

  Gallinamide A TFA	1352920-57-0	99.85%
  Gallinamide A TFA is a linearly depositing peptide and a potent inhibitor of cathepsin L (CatL) (IC50: 17.6 pM). Gallinamide A TFA inhibits SARS-CoV-2 infection by inhibiting CatL (EC50: 28 nM). Gallinamide A TFA also inhibits Plasmodium falciparum (IC50: 50 nM)[1][2].

  

• HY-N7057S2

  Nonanoic acid-d4	1219795-27-3
  Nonanoic acid-d4 is the deuterium labeled Nonanoic acid. Nonanoic acid is a naturally-occurring saturated fatty acid with nine carbon atoms. Nonanoic acid significantly reduces bacterial translocation, enhances antibacterial activity, and remarkably increases the secretion of porcine β-defensins 1 (pBD-1) and pBD-2[1].

  

• HY-N7057S3

  Nonanoic acid-d2	62689-94-5	98.63%
  Nonanoic acid-d2 is the deuterium labeled Nonanoic acid[1]. Nonanoic acid is a naturally-occurring saturated fatty acid with nine carbon atoms. Nonanoic acid significantly reduces bacterial translocation, enhances antibacterial activity, and remarkably increases the secretion of porcine β-defensins 1 (pBD-1) and pBD-2[2].

  

• HY-P10304A

  Cyclo(Arg-Pro) TFA		98.04%
  Cyclo(Arg-Pro) (Cyclo(Pro-Arg)) TFA is a chitinase inhibitor. Cyclo(Arg-Pro) TFA inhibits cell separation of Saccharomyces cerevisiae, without affecting its growth. Cyclo(Arg-Pro) TFA inhibits the morphological change of Candida albicans from yeast form to filamentous form[1].

  

• HY-W001251

  3,5-Dimethoxybenzoic acid	1132-21-4
  3,5-Dimethoxybenzoic acid, isolated from Melia azedarach L. leaves with antifungal activity, is an intermediate in organic synthesis[1].

  

• HY-W002677

  Fluoroquinolonic acid	86393-33-1
  Fluoroquinolonic acid is a bacteriostatic antibiotic. Fluoroquinolonic acid has broad-spectrum activity against Gram-positive and Gram-negative bacteria[1].

  

• HY-W009689

  TbPTR1 inhibitor 2	17557-67-4	99.73%
  TbPTR1 inhibitor 2 (Compound 3a) is a PTR1 enzyme inhibitor, with IC50s of 34.2 and 32.9 μM for TbPTR1 and LmPTR1. TbPTR1 inhibitor 2 has anti-parasitic activity against T. brucei (IC50: 34.2 μM)[1].

  

• HY-W010243

  Methylisothiazolinone hydrochloride	26172-54-3
  Methylisothiazolinone hydrochloride is the constituent of the biocide Kathon CG. Methylisothiazolinone hydrochloride is an isothiazolone derivative widely used as a preservative. Methylisothiazolinone hydrochloride is also a moderate sensitizer and reacts with GSH[1][2].

  

• HY-W010608

  2-Methyltetrahydrofuran-3-one	3188-00-9
  2-Methyltetrahydrofuran-3-one is a quorum sensing inhibitor that can inhibit biofilm formation by H. alvei. 2-Methyltetrahydrofuran-3-one is one of the volatile constituents of roasted coffee[1][2].

  

• HY-W013168

  4-Nitrophenyl palmitate	1492-30-4
  4-Nitrophenyl palmitate (4-Nitrophenyl hexadecanoate; p-Nitrophenyl Palmitate) is a colorimetric lipase and esterase substrate. Upon enzymatic hydrolysis of 4-Nitrophenyl palmitate, 4-nitrophenol is released, which can be quantified by colorimetric detection at 410 nm as a measure of enzyme activity. 4-Nitrophenyl palmitate has been used to characterize the activity of various bacterial and mammalian enzymes, including Burkholderia and porcine pancreatic lipase.

  

• HY-W014316

  5-Bromo-5-nitro-1,3-dioxane	30007-47-7	99.89%
  5-Bromo-5-nitro-1,3-dioxane, an antimicrobial compound, is effective against Gram-positive and Gram-negative bacteria and fungi, including yeast. 5-Bromo-5-nitro-1,3-dioxane inhibits enzyme activity and subsequent inhibition of microbial growth by the oxidation of essential protein thiol[1].

  

• HY-W015818

  2-Benzoxazolinone	59-49-4
  2-Benzoxazolinone is an anti-leishmanial agent with an LC50 of 40 μg/mL against L. donovani[1]. A building block in chemical synthesis. 1,3-Benzoxazol-2(3H)-one derivatives have antimicrobial activity against a selection of Gram-positive, Gram-negative bacteria and yeasts[3]. Derivatives as anti-quorum sensing agent[4].

  

• HY-W039454

  2,4-Dichlorobenzyl alcohol	1777-82-8	99.40%
  2,4-Dichlorobenzyl alcohol is a mild antiseptic, with a broad spectrum for bacterial and virus associated with mouth and throat infections[1].

  

• HY-W040795

  N2-Acetylguanine	19962-37-9	99.69%
  N2-Acetylguanine is a C2-modified guanine. N2-Acetylguanine binds GR (guanine-guanine riboswitch) with an Kd value of 300 nM. N2-Acetylguanine modulate transcriptional termination. N2-Acetylguanine has the potential for the research of antimicrobial agent[1].

  

• HY-W041324

  Glimepiride sulfonamide	119018-29-0
  Glimepiride sulfonamide is a intermediate, and can be used to synthesize Glimepiride (HY-B0104) (antidiabetic agent)[1].

  

• HY-W049970

  Carvacrol methyl ether	6379-73-3	99.98%
  Carvacrol methyl ether, a Carvacrol analog, can be isolated from plant volatile oil. Carvacrol methyl ether exhibits antibacterial activity[1][2].

  

• HY-W051164

  5-Hydroxyvanillin	3934-87-0
  5-Hydroxyvanillin is the product of the bacterial and fungal breakdown of ferulic acid, an abundant component in cell walls of found in many seed and leaves[1].

  

• HY-W055872

  Erythromycylamine	26116-56-3
  Erythromycylamine is a macrolide antibiotic. Erythromycylamine has antibacterial activity against most Gram-positive cocci and M. catarrhalis[1][2].

  

• HY-W089856

  Chlorobutanol hemihydrate	6001-64-5
  Chlorobutanol hemihydrate is an antimicrobial agent with oral activity, also possessing preservative effects. Chlorobutanol hemihydrate exhibits resistance to a variety of Gram-positive and Gram-negative bacteria, as well as several fungal spores and fungi, and is widely used in the food and cosmetics industries[1][2][3][4][5].

  

• HY-W127493

  1-Hexacosanol	506-52-5
  1-Hexacosanol is a compound in the bioactive fraction of plant extracts that mediates insecticidal activity. 1-Hexacosanol has larvicidal activity and can inhibit the acetylcholinesterase activity of Culex quinquefasciatus, Aedes aegypti and Chironomus riparius, exerting neurotoxic effects[1].

  

• HY-W127841

  Citric acid-2,4-13C2	121633-50-9	98.00%
  Citric acid-2,4-13C2 is the 13C-labeled Citric acid (HY-N1428). Citric acid is a natural preservative and food tartness enhancer. Citric acid induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-W130965

  1-Formyl-beta-carboline	20127-63-3
  1-Formyl-beta-carboline is an alkaloid with inhibitory activity against Newcastle disease virus (NDV). 1-Formyl-beta-carboline can effectively inhibit different genotypes of NDV with IC50 values within 10 μM, and its inhibition rate is more than 90% at a concentration of 20 μM. 1-Formyl-beta-carboline mainly exerts its effects by inhibiting the adsorption and entry processes in the NDV life cycle. 1-Formyl-beta-carboline has been identified as a novel HN inhibitor that can directly interact with the NDV HN protein and affect the adsorption of NDV. 1-Formyl-beta-carboline also inhibits the entry of NDV by inhibiting the PI3K/Akt signaling pathway rather than the ERK pathway[1].

  

• HY-W195509

  Debrisoquin hydroiodide	1052540-65-4	99.84%
  Debrisoquin (hydroiodide) is the hydrochloride form of Debrisoquin (HY-B1624). Debrisoquin is a TMPRSS2 inhibitors that inhibits SARS-CoV-2 entry into human lung cell line by a TMPRSS2-depedent manner. Debrisoquin can be used for antiviral research[1].

  

• HY-W744966

  Mandipropamid	374726-62-2	99.22%
  Mandipropamid displays outstanding activity against late blight diseases of potato and tomato, combined with excellent efficacy on downy mildew diseases of grape and cucumber[1].

  

• HY-113225S3

  Guanosine triphosphate-15N5 dilithium
  Guanosine triphosphate-15N5 (GTP-15N5) dilithium is 15N labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate is a native nucleotide. The derivatives of GTP may be used as specific inhibitors against COVID-19.

  

• HY-125818S3

  Cytidine-5'-triphosphate-13C9 dilithium		99.0%
  Cytidine-5'-triphosphate-13C9 (Cytidine triphosphate-13C9 dilithium; 5'-CTP-13C9) dilithium is 13C-labeled Cytidine-5'-triphosphate (HY-125818). Cytidine 5′-triphosphate (Cytidine triphosphate; 5'-CTP) is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule?in the de novo?pyrimidine biosynthetic pathway in?T. gondii.

  

• HY-W001132R

  Indole (standard)	120-72-9
  Indole (Standard) is the analytical standard of Indole. This product is intended for research and analytical applications. Indole is an aromatic, heterocyclic, organic compound which widely distributed in the natural environment and can be produced by a variety of bacteria. Indole regulates various aspects of bacterial physiology, including spore formation, plasmid stability, resistance to drugs, biofilm formation, and virulence as an intercellular signal molecule[1].

  

• HY-W014589R

  2,4-Di-tert-butylphenol (Standard)	96-76-4
  2,4-Di-tert-butylphenol (Standard) is the analytical standard of 2,4-Di-tert-butylphenol (HY-W014589). This product is intended for research and analytical applications. 2,4-Di-tert-butylphenol (2,4-DTBP) is an orally active RXRα activator and a human estrogen receptor ligand with anti-inflammatory and antioxidant activities, which can induce apoptosis in tumor cells. 2,4-Di-tert-butylphenol can activate the RXRα subtype in LXRα/RXRα, PPARγ/RXRα, and hormone receptor β/RXRα. 2,4-Di-tert-butylphenol also has antiviral and antifungal activities, and has the potential to inhibit Aβ-induced neurotoxicity. 2,4-Di-tert-butylphenol can be used as an intermediate in the preparation of antioxidants and UV stabilizers, and is also used in the manufacture of pharmaceuticals and fragrances[1][2][3].

  

• HY-12485

  TBA-354	1257426-19-9	99.74%
  TBA-354 is a potent anti-tuberculosis compound; maintains activity against Mycobacterium tuberculosis H37Rv isogenic monoresistant strains.

  

• HY-13269

  BMS-707035	729607-74-3	99.99%
  BMS-707035 is a potent orally active HIV-1 integrase strand transfer inhibitor (INSTI). BMS-707035 has enzyme inhibitory with an IC50 value of 3 nM. BMS-707035 also has weak CYP inhibiton and antiviral activity. BMS-707035 can be used for the research of human immunodeficiency virus-1 (HIV-1)[1].

  

• HY-14267

  Lersivirine	473921-12-9	98.38%
  Lersivirine (UK-453061) is potent and selective non-nucleoside reverse transcription inhibitor (NNRTI; IC50=119 nM) with excellent efficacy against NNRTI-resistant viruses. Lersivirine exhibits potent antiretroviral activity against wild-type HIV virus and clinically relevant NNRTI-resistant strains[1].

  

• HY-43060

  5'-DMT-3'-TBDMS-ibu-rG	81256-89-5	99.46%
  5'-DMT-3'-TBDMS-ibu-rG is is a modified nucleoside. 5'-DMT-3'-TBDMS-ibu-rG can be used in deoxyribonucleic acid synthesis.

  

• HY-45854

  GWP-042	1645486-93-6
  GWP-042 is a potent inhibitor of mycobacterial alanine dehydrogenase (Ald) Rv2780, with the IC50 of 0.21 μM. GWP-042 has antimicrobial activity against M. tuberculosis infection in vivo[1].

  

• HY-46866

  Isoegomaketone	34348-59-9	99.43%
  Isoegomaketone is a sesquiterpenoid that can be isolated from Perilla frutescens essential oil. Isoegomaketone exhibits anti-inflammatory, antioxidant, anti-cancer, anti-mycobacterial, anti-arthritic and anti-obesity effects[1][2][3].

  

• HY-70083

  SPK-601	1096687-52-3	98.46%
  SPK-601 (LMV-601) is an inhibitor of the phosphatidylcholine-specific phospholipase C (PC-PLC). SPK-601 also can be used as an antimicrobial agent[1].

  

• HY-77995

  2-Methoxybenzaldehyde	135-02-4
  2-Methoxybenzaldehyde (o-Anisaldehyde) is a bacterial/fungal inhibitor with a BA50 value of 0.19 for Salmonella. 2-Methoxybenzaldehyde can be used for the study of bacterial and fungal infectious diseases[1][2][3].

  

• HY-B0576

  Sulfacetamide sodium	127-56-0	99.71%
  Sulfacetamide (Sulphacetamide) sodium is a sulfonamide antibiotic that can be used for the study of ocular infections. Sulfacetamide sodium has antifungal and antibacterial activities[1].

  

• HY-B0916

  Propoxur	114-26-1	99.43%
  Propoxur is a reversible, competitive, orally active AChE inhibitor that can cross the blood-brain barrier. Propoxur inhibits AChE activity to induce neurotoxicity, while promoting MMP-2 expression and enhancing tumor cell migration and invasion by inducing intracellular ROS generation and activating the ERK/Nrf2 signaling pathway. On the one hand, Propoxur inhibits AChE, leading to acetylcholine accumulation and causing neurological dysfunction; on the other hand, it promotes Nrf2 nuclear translocation through ROS-dependent ERK1/2 phosphorylation, and upregulates MMP-2 and other invasion-related proteins. Propoxur is also a carbamate insecticide used to combat turf, forestry, and household pests[1][2][3].

  

• HY-B0999

  Chlorindanol	145-94-8
  Chlorindanol (7-Chloro-4-indanol) is a topical antiseptic or sanitizer. Chlorindanol is rapidly lethal to vegetative bacteria, Trichophyton sp., C. albicans, E. histolytica cysts and trophozoites, T. vaginalis, and spermatozoa in vitro. Chlorindanol is klow systemic toxicity, well skin/eyes/genital mucosa tolerance and nonallergenic.

  

• HY-B1073

  Morantel tartrate	26155-31-7	99.01%
  Morantel tartrate is a broad spectrum anthelmintic, effective and low toxicity.

  

• HY-B1211

  Dehydroacetic acid	520-45-6	99.85%
  Dehydroacetic acid (Biocide 470F), a pyrone derivative acts as an antibacterial and antifungal agent. Dehydroacetic acid possess phytotoxic activity[1].

  

• HY-N5086

  Picroside IV	211567-04-3
  Picroside IV is an iridoid glycoside found in the underground parts of Picrorhiza scrophulariiflora. Picroside IV is a derivative of Catalpol (HY-N0820)[1]. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects[2].

  

• HY-N6748

  Roquefortine C	58735-64-1
  Roquefortine C, a fungal cyclopeptide isolated from Penicillium roquefortii, activates P-gp and also inhibits P450-3A and other haemoproteins. Roquefortine C has bacteriostatic activities against Gram-positive bacteria[1].

  

• HY-100121

  Vibunazole	80456-55-9	99.91%
  Vibunazole is a new antifungal azole.

  

• HY-100833

  Antibiotic-5d	251349-54-9	99.71%
  Antibiotic-5d is a synthesis and antimicrobial compound.

  

• HY-10224R

  Panobinostat (Standard)	404950-80-7
  Panobinostat (Standard) (LBH589 (Standard)) is the analytical standard of Panobinostat (HY-10224). This product is intended for research and analytical applications. Panobinostat is a potent and orally active non-selective HDAC inhibitor, and has antineoplastic activities[1][2]. Panobinostat induces HIV-1 virus production even at low concentration range 8-31 nM, stimulates HIV-1 expression in latently infected cells[4]. Panobinostat induces cell apoptosis and autophagy. Panobinostat can be used for the study of refractory or relapsed multiple myeloma[3].

  

• HY-108874

  Candicidin	1403-17-4
  Candicidin is a polyene antifungal antibiotic agent and can be isolated from Streptomyces griseus or Actinomyces levoris[1].

  

• HY-119594

  Melarsoprol	494-79-1	98.0%
  Melarsoprol, a melaminophenylarsine-type trivalent organic arsenical, is an important drug for African trypanosomiasis. Melarsoprol is also active against leukemia cell lines and plasma cells from myeloma patients. Melarsoprol increases the biliary output of GSH in rats[1].

  

• HY-123517

  DC07090 dihydrochloride	1158264-37-9	99.12%
  DC07090 dihydrochloride is a low toxicity, potent, reversible and competitive non-peptidyl human enterovirus 71 3C protease inhibitor with an IC50 and a Ki value for 21.72 μM and 23.29 μM. DC07090 dihydrochloride could also inhibit coxsackievirus A16 (CVA16) replication with an EC50 value of 27.76 μM[1].

  

• HY-124212

  Thaxtomin A	122380-18-1	98.7%
  Thaxtomin A is a major phytotoxin produced by S. scabies.

  

• HY-124782

  HDAC8-IN-8	1884231-52-0
  HDAC8-IN-8 (15a) is an HDAC8 inhibitor, with IC50 values of 23.9 μM and 268.2 μM for hHDAC8 and smHDAC8 respectively. And for hHDAC1 and hHDAC6, the IC50 values are 12.1 μM and 2.9 μM respectively. HDAC8-IN-8 can be used in schistosomiasis-related research[1].

  

• HY-127041

  Virstatin	88909-96-0	98.00%
  Virstatin inhibits the pili system synthesis and prevents A. baumannii biofilm formation. Virstatin also inhibits dimerization of the transcriptional activator ToxT[1][2].

  

• HY-129629

  Thiomandelic acid	4695-09-4
  Thiomandelic acid is a broad spectrum inhibitor of Zinc -lactamases[1].

  

• HY-136782

  ST-148 maleate	390803-40-4
  ST-148 maleate is a potent and orally active DENV inhibitor. ST-148 maleate shows antiviral efficacy and low cell toxicity. ST-148 alters the interaction between lipid droplets and the C protein, thereby inhibiting viral replication.[1].

  

• HY-148992

  APX879	1801372-27-9
  APX879 is a fungal-specific calcineurin inhibitor that has less immunosuppressive activities and toxicities. APX879 is a C22-modified FK506 (HY-13756) analog, which maintains broad-spectrum antifungal activity[1][2].

  

• HY-149308

  MKA031	2951012-00-1	98.69%
  MKA031 (compound 6y) is a non-competitive MIF inhibitor with an IC50 value of 1.7 μM. MKA031 (compound 6y) interferes with MIF/AIF interaction, MIF nuclear translocation, and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)-induced dependent cell death. MKA031 can be used in the study of chronic hepatitis C virus infection[1].

  

• HY-151380

  LANA-DNA-IN-1	2512847-06-0	99.68%
  LANA-DNA-IN-1 is a potent LANA-DNA inhibitor. LANA-DNA-IN-1 has inhibition activity for LBS2, LBS1 and LBS3 with IC50 values of 8 μM, 9μM and 8μM. LANA-DNA-IN-1shows against wild-type LANA with IC50 value of 53 μM. LANA-DNA-IN-1 can be used for the research of infection[1].

  

• HY-157154

  MAT-POS-e194df51-1	2765433-05-2	98.45%
  MAT-POS-e194df51-1 is an orally active, non-covalent and non-peptide SARS-CoV-2 main protease (Mpro) inhibitor with an IC50 value of 37nM. MAT-POS-e194df51-1 is cytotoxic with EC50 values of 64 nM and 126 nM in A549-ACE2-TMPRSS2 cells and HeLa -ACE2 cells, respectively[1].

  

• HY-157892

  Antimalarial agent 38	123580-46-1
  Antimalarial agent 38 (Compound 1) exhibits activity against antiplasmodial, which inhibits Plasmodium falciparum D6 strain, chloroquine-sensitive Thai strain and chloroquine-resistant FcB1 strain and K1 strain, with IC50s of 0.5, 13, 1 and 13 μM, respectively. Antimalarial agent 38 is non-cytotoxic for mammalian cells MCR58 (IC50 >140 μM). Antimalarial agent 38 improves the survival rate of Plasmodium yoelii nigeriensis infected mouse model[1].

  

• HY-164122

  Antiviral agent 56	524055-95-6
  Antiviral agent 56 (Compound 4) is an antiviral agent that has anti-HIV activity[1].

  

• HY-164139

  Antiviral agent 57	3027227-86-4	98.10%
  Antiviral agent 57 (compound 81) is an antiviral agent.Antiviral agent 57 shows > 60% inhibition aganist ANO6 at the 50 nM[1].

  

• HY-16980S

  Eravacycline-d4 dihydrochloride		99.98%
  Eravacycline-d4 (TP-434-d4) dihydrochloride is deuterium labeled Eravacycline. Eravacycline is a potent and broad-spectrum antibacterial agent[1][2][3][4][5][6].

  

• HY-170472

  Bpin-Bedaquiline	2375174-10-8
  Bpin-Bedaquiline (compound 2) is a boronic ester precursor of Bedaquiline (HY-14881). Bpin-Bedaquiline can react with H476Br to synthesize 76Br-Bedaquiline[1].

  

• HY-173258

  5-Carboxy-2′-deoxycytidine	1210427-59-0	98.10%
  5-Carboxy-2′-deoxycytidine is a metabolite of Trifluridine (HY-A0061)[1].

  

• HY-17591R

  Penicillin G potassium (Standard)	113-98-4
  Penicillin G (potassium) (Standard) is the analytical standard of Penicillin G (potassium). This product is intended for research and analytical applications. Penicillin G potassium is a fast-acting penicillin family antibiotic. Penicillin G potassium can be used for the research of bacterial infections that affect the blood, heart, lungs, joints, and genital areas[1][2].

  

• HY-401757

  Anticaries agent-1	198649-97-7
  Anticaries agent-1 (Compound 21b) is an anticaries agent. Anticaries agent-1 inhibits biofilm formation (IC50: 77 μM) and S. mutans growth[1].

  

• HY-B0113R

  Omeprazole (Standard)	73590-58-6	99.86%
  Omeprazole (Standard) is the analytical standard of Omeprazole. This product is intended for research and analytical applications. Omeprazole (H 16868), a proton pump inhibitor (PPI), is available for treatment of acid-related gastrointestinal disorders. Omeprazole shows competitive inhibition of CYP2C19 activity with a Ki of 2 to 6 μM[1]. Omeprazole also inhibits growth of Gram-positive and Gram-negative bacteria[2].Omeprazole is a potent brain penetrant neutral sphingomyelinase (N-SMase) inhibitor (exosome inhibitor)[3].

  

• HY-B0116R

  Stavudine (Standard)	3056-17-5
  Stavudine (Standard) is the analytical standard of Stavudine. This product is intended for research and analytical applications. Stavudine (d4T) is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Stavudine has activity against HIV-1 and HIV-2. Stavudine also inhibits the replication of mitochondrial DNA (mtDNA). Stavudine reduces NLRP3 inflammasome activation and modulates Amyloid-β autophagy. Stavudine induces apoptosis[1][2][3][4].

  

• HY-B0132R

  Norfloxacin (Standard)	70458-96-7
  Norfloxacin (Standard) is the analytical standard of Norfloxacin. This product is intended for research and analytical applications. Norfloxacin (MK-0366) is a broad-spectrum antibiotic that is active against both Gram-positive and Gram-negative bacteria, which functions by inhibiting DNA gyrase.

  

• HY-B0238R

  Amorolfine (hydrochloride) (Standard)	78613-38-4
  Amorolfine (hydrochloride) (Standard) is the analytical standard of Amorolfine (hydrochloride). This product is intended for research and analytical applications. Amorolfine (Ro 14-4767/002) hydrochloride is a potent anti-fungal agent. Amorolfine hydrochloride inhibits ergosterol biosynthesis. Amorolfine hydrochloride has the potential for the research of Neoscytalidium dimidiatum onychomycosis[1][2].

  

• HY-B0421R

  Mycophenolic acid (Standard)	24280-93-1
  Mycophenolic acid (Standard) is the analytical standard of Mycophenolic acid. This product is intended for research and analytical applications. Mycophenolic acid is a potent uncompetitive inosine monophosphate dehydrogenase (IMPDH) inhibitor with an EC50 of 0.24 μM.?Mycophenolic acid demonstrates antiviral effects against a wide range of RNA viruses including influenza. Mycophenolic acid is an immunosuppressive agent. Antiangiogenic and antitumor effects[1][2].

  

• HY-B0497R

  Niclosamide (Standard)	50-65-7
  Niclosamide (Standard) is the analytical standard of Niclosamide. This product is intended for research and analytical applications. Niclosamide (BAY2353) is an orally active antihelminthic agent used in parasitic infection research[1]. Niclosamide is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells[4]. Niclosamide has biological activities against cancer, inhibits DNA replication in Vero E6 cells[2][3][5].

  

• HY-B1218R

  Sulfaphenazole (Standard)	526-08-9
  Sulfaphenazole (Standard) is the analytical standard of Sulfaphenazole. This product is intended for research and analytical applications. Sulfaphenazole is a selective inhibitor of human cytochrome P450 (CYP) 2C9 enzyme. Sulfaphenazole is a cytoprotective agent against light-induced death of photoreceptors. Sulfaphenazole inhibits light-induced necrosis and mitochondrial stress-initiated apoptosis. Sulfaphenazole is an off patent sulfonamide antibiotic and demonstrates bactericidal activity through enhanced M1 macrophage activity. Sulfaphenazole can significantly reduce infarct size and restore post-ischemic coronary flow following ischemia and reperfusion[1][2][3].

  

• HY-B1682A

  Loracarbef hydrate	121961-22-6
  Loracarbef hydrate, a cephalosporin antibiotic, is an orally active second-generation synthetic beta-lactam antibiotic of the carbacephem class[1][2].

  

• HY-N0055R

  Chlorogenic acid (Standard)	327-97-9
  Chlorogenic acid (Standard) is the analytical standard of Chlorogenic acid. This product is intended for research and analytical applications. Chlorogenic acid is a major phenolic compound in Lonicera japonica Thunb. It is an orally active antioxidant activity, antibacterial, hepatoprotective, cardioprotective, anti-inflammatory, antipyretic, neuroprotective, anti-obesity, antiviral, anti-microbial, anti-hypertension compound[1][2][3].

  

• HY-N0097R

  Guanosine (Standard)	118-00-3
  Guanosine (Standard) is the analytical standard of Guanosine. This product is intended for research and analytical applications. Guanosine (DL-Guanosine) is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine possesses anti-HSV activity. In Vitro: Guanosine can be phosphorylated to become guanosine monophosphate (GMP), cyclic guanosine monophosphate (cGMP), guanosine diphosphate (GDP), and guanosine triphosphate (GTP). These forms play important roles in various biochemical processes such as synthesis of nucleic acids and proteins, photosynthesis, muscle contraction, and intracellular signal transduction (cGMP).

  

• HY-N0216R

  Benzoic acid (Standard)	65-85-0
  Benzoic acid (Standard) is the analytical standard of Benzoic acid. This product is intended for research and analytical applications. Benzoic acid is an aromatic alcohol existing naturally in many plants and is a common additive to food, drinks, cosmetics and other products. It acts as preservatives through inhibiting both bacteria and fungi[1][2].

  

• HY-N0708R

  Vanillic acid (Standard)	121-34-6
  Vanillic acid (Standard) is the analytical standard of Vanillic acid. This product is intended for research and analytical applications. Vanillic acid is a flavoring agent found in edible plants and fruits, also found in Angelica sinensis. Vanillic acid inhibits NF-κB activation. Anti-inflammatory, antibacterial, and chemopreventive effects[1].

  

• HY-N11874

  Staphyloferrin A	127902-98-1
  Staphyloferrin A is a siderophore protein that can be combined with antibiotics to study drug-resistant bacteria that cause skin diseases[1].

  

• HY-N2041R

  Myristic acid (Standard)	544-63-8
  Myristic acid (Standard) is the analytical standard of Myristic acid. This product is intended for research and analytical applications. Myristic acid is an orally active saturated 14-carbon fatty acid found in most animal and plant fats, especially milk fat coconut oil, palm oil and nutmeg oil. Myristic acid exerts anti-inflammatory activity through the NF-κB pathway. Myristic acid has antibacterial, anti-inflammatory and analgesic properties[1][2][3][4].

  

• HY-N6810R

  Thymol (Standard)	89-83-8
  Thymol (Standard) is the analytical standard of Thymol. This product is intended for research and analytical applications. Thymol is a TRPA1 agonist. Thymol induces cancer cell apoptosis. Thymol is the main monoterpene phenol occurring in essential oils isolated from plants belonging to the Lamiaceae family, and other plants such as those belonging to the Verbenaceae, Scrophulariaceae, Ranunculaceae and Apiaceae families. Thymol has antioxidant, anti-inflammatory, antibacterial and antifungal effects[1].

  

• HY-P4388A

  Z-Arg-Leu-Arg-Gly-Gly-AMC acetate		98.85%
  Z-Arg-Leu-Arg-Gly-Gly-AMC acetate is a peptide substrate for SARS-CoV PLpro[1].

  

• HY-P99184

  Abrilumab	1342290-43-0	98.35%
  Abrilumab is a fully human monoclonal antibody directed against α4β7. Abrilumab selectively binds the α4β7 integrin heterodimer. Abrilumab can be used for the research of inflammatory bowel disease (IBD)[1].

  

• HY-U00087

  Tosylchloramide sodium trihydrate	7080-50-4
  Tosylchloramide sodium trihydrate (Chloramine T sodium trihydrate) is a disinfectant agent widely used in laboratories, kitchens and hospitals. It is also used as a biocide in air fresheners and deodorants.

  

• HY-122494A

  Bialaphos sodium	71048-99-2
  Bialaphos (SF-1293) sodium, an antibiotic, is an effective herbicide is a metabolite of Streptomyces hygroscopicus[1].

  

• HY-128866A

  (Rac)-TBAJ-876	2131784-39-7	99.54%
  (Rac)-TBAJ-876 is a racemate of TBAJ-876. TBAJ-876 is the inhibitor of mycobacterium tuberculosis. TBAJ-876 is the analogue of the anti-tuberculosis agent Bedaquiline (HY-14881). TBAJ-876 has the potential for the research of tuberculosis[1].

  

• HY-132426S

  Thiram-d12	69193-86-8	99.90%
  Thiram-d12 is the deuterium labeled Thiram. Thiram, a fungicides, is widely used on seeds and as foliar agent on turf, vegetables and fruit.Thiram acts as a vulcanization accelerator in the rubber industry[1]. Thiram induces antioxidant defense and oxidative stress. Thiram can act as a prooxidant resulting in the formation of reactive oxygen species (ROS)[2].

  

• HY-13678AR

  Meropenem (trihydrate) (Standard)	119478-56-7
  Meropenem (trihydrate) (Standard) is the analytical standard of Meropenem (trihydrate). This product is intended for research and analytical applications. Meropenem trihydrate (SM 7338 trihydrate) is a carbapenem antibiotic with broad-spectrum antibacterial activity. Meropenem trihydrate has activity against susceptible and resistant N. gonorrhoeae (MIC value of 0.02-0.06 mg/mL), H. influenzae (MIC value of 0.03-0.12 mg/mL), and H. ducreyi (MIC value of 0.015-0.12 mg/mL)[1][2].

  

• HY-17412S1

  Minocycline-d6 sulfate
  Minocycline-d6 sulfate is deuterated labeled Minocycline (HY-17412A). Minocycline is an orally effective semi-synthetic tetracycline antibiotic and HIF-1α inhibitor that can penetrate the blood-brain barrier. Minocycline has bacteriostatic, anti-cancer, anti-inflammatory, neuroprotective properties and antidepressant effects.

  

• HY-B0334AS

  Sulbactam-d5 sodium	1322625-44-4
  Sulbactam-d5 (sodium) is the deuterium labeled Sulbactam sodium. Sulbactam (CP45899) sodium is a competitive, irreversible beta-lactamase inhibitor. Sulbactam sodium shows antimicrobial activity against multidrug-resistant (MDR) acinetobacter calcoaceticus--Acinetobacter baumannii (Acb) complex[1][2].

  

• HY-B0593AR

  Ceftazidime (pentahydrate) (Standard)	78439-06-2
  Ceftazidime (pentahydrate) (Standard) is the analytical standard of Ceftazidime (pentahydrate). This product is intended for research and analytical applications. Ceftazidime (GR20263) pentahydrate , an antibiotic, has a broad spectrum activity against Gram-positive and Gram-negative aerobic bacteria. Ceftazidime pentahydrate is also active against Enterobacteriaceae (including β-lactamase-positive strains) and is resistant to hydrolysis by most β-lactamases[1].

  

• HY-N0349S1

  Methyl paraben-13C6	1581694-95-2	99.90%
  Methyl Paraben-13C6 (Methyl 4-hydroxybenzoate-13C6) is a 13C labeled Methyl Paraben (HY-N0349)[1]. Methyl Paraben, isolated from the barks of Tsuga dumosa the methyl ester of p-hydroxybenzoic acid, is a standardized chemical allergen. Methyl Paraben is a stable, non-volatile compound used as an antimicrobial preservative in foods, agents and cosmetics. The physiologic effect of Methyl Paraben is by means of increased histamine release, and cell-mediated immunity[2].

  

• HY-N1428S6

  Citric acid-d4-1
  Citric acid-d4-1 is deuterated labeled Citric acid (HY-N1428). Citric acid is a natural preservative and food tartness enhancer. Citric acid induces apoptosis and cell cycle arrest at G2/M phase and S phase in HaCaT cells. Citric acid cause oxidative damage of the liver by means of the decrease of antioxidative enzyme activities. Citric acid is also an acidulant, emulsifier, sequestrant and buffering agent widely used across many industries[1][2][3][4].

  

• HY-RS16308

  mt-Co1 Mouse Pre-designed siRNA Set A
  mt-Co1 Mouse Pre-designed siRNA Set A contains three designed siRNAs for mt-Co1 gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.

  

• HY-W004056

  4-Methoxyphenethyl alcohol	702-23-8
  4-Methoxyphenethyl alcohol, an aromatic alcohol, is the major component in the anise-like odour produced by Amorphophallus. 4-Methoxyphenethyl alcohol can inhibits the protein, RNA and DNA synthesis in Escherichia coli[1].

  

• HY-W004294

  1-Tetradecanol	112-72-1	99.34%
  1-Tetradecanol is a straight-chain saturated fatty alcohol and antibacterial agent. 1-Tetradecanol can be isolated from Myristica fragrans. 1-Tetradecanol possesses antibacterial and anti-inflammatory (periodontitis) activity[1][2][3].

  

• HY-W005327

  1-Hydroxy-2-butanone	5077-67-8
  1-Hydroxy-2-butanone is a natural compound isolated from Bomboo Juice. 1-Hydroxy-2-butanone acts as a key intermediate for ethambutol. Ethambutol has anti-tuberculosis effects[1][2].

  

• HY-W009497

  Dowicil 200	51229-78-8	98.89%
  Dowicil 200 (Quaternium-15) is a skin toxin and allergen that inhibits the growth of Pinctada fucata cells. Dowicil 200 has antimicrobial activity and is more potent against fungi and molds than against fungi.

  

• HY-W010253

  Benzylurea	538-32-9
  Benzylurea is a benzylamide. Benzylurea can be isolated from Salvadora persica stems. Benzylurea has antimicrobial activity. Benzylurea can be used for the research of various biochemical studies[1].

  

• HY-W060316

  β-Thujaplicinol	29346-20-1	99.87%
  β-Thujaplicinol (3-Hydroxy-5-isopropyltropolone) is an inhibitor of hepatitis B virus (HBV) ribonuclease H. β-Thujaplicinol inhibits RNAseHs of HBV genotypes D and H with IC50 values of 5.9 and 2.3 μM, respectively[1].

  

• HY-W109613

  Methyl dehydroabietate	1235-74-1	99.89%
  Methyl dehydroabietate is a kind of resin acid that can be isolated from spruce bark. Methyl dehydroabietate has antimicrobial activities[1].

  

• HY-W329071

  Rose Bengal	11121-48-5
  Rose Bengal is a photosensitizer that acts on microbial cells. Rose Bengal inhibits yeast cells and other microorganisms growth and even causing death in the presence of light and oxygen. Rose Bengal can be used to inhibit bacterial growth, limit the colony size of filamentous fungi, and suppress the growth of "spreading fungi" like Rhizopus and Trichoderma[1].

  

• HY-W420337

  Fluopimomide	1309859-39-9
  Fluopimomide (LH2010A) is a potent pesticide, widely used for agricultural pest management. Fluopimomide adversely affects the nematodes growth, locomotive behaviors, reproduction, and lifespan, accompanying with enhanced of reactive oxygen species (ROS) generation, lipid and lipofuscin accumulation, and malondialdehyde content. Fluopimomide inhibits antioxidant systems in the nematodes[1].

  

• HY-W587956

  α-Guaiene	3691-12-1
  α-Guaiene is a sesquiterpene that could be found in Pogostemon cablin. α-Guaiene is the predominant component of patchouli essential oil, which exhibits antifungal activity against Aspergillus species[1].

  

• HY-W709856

  Dodeca-2E,4E,8Z,10Z/E-N-tetraenoic acid isobutylamide	866602-52-0	98.54%
  Dodeca-2E,4E,8Z,10Z/E-N-tetraenoic acid isobutylamide is a brain-penetrant substance and the main alkamide in Echinacea preparations, which might be used for research of common cold and various upper respiratory infections[1].

  

• HY-W010155R

  Tryptophol (Standard)	526-55-6
  Tryptophol (Standard) (Indole-3-ethanol (Standard)) is an analytical standard of Tryptophol (HY-W010155). This product is intended for use in research and analytical applications.Tryptophol is an aromatic alcohol and secondary metabolite produced by microorganisms. Tryptophol induces Apoptosis and cleavage of caspase-8. Tryptophol inhibits Cunninghamella blakesleeana biofilm. Tryptophol has anti-phage infection, biofilm formation regulation, anti-inflammatory, hemolytic, sleep induction, temperature change, seizure susceptibility and immune regulation activities. Tryptophol is used in the research of African trypanosomiasis, sleep disorders, epilepsy.

  

• HY-B0125S1

  Ofloxacin-d8	1219170-21-4
  Ofloxacin-d8 (Hoe-280-d8) is the deuterium labeled Ofloxacin. Ofloxacin (Hoe-280) is a fluoroquinolone whose primary mechanism of action is inhibition of bacterial DNA gyrase.

  

• HY-12882

  Ifenprodil	23210-56-2	99.94%
  Ifenprodil (NP-120), a cerebral vasodilator, is a noncompetitive NMDA receptor antagonist. Ifenprodil exerts high affinity at NR1A/NR2B receptors (IC50=0.34 μM) over 400-fold than at NR1A/NR2A receptors (IC50=146 μM)[1]. Ifenprodil is an α1 adrenergic receptor antagonist. Ifenprodil inhibits GIRK (Kir3), reduces inward currents through the basal GIRK activity. Ifenprodil has reliable inhibitory effects against A/H1N1 strains (EC50 of 6.6 µM). Ifenprodil has neuroprotective, anticonvulsant and antinociceptive effects. Ifenprodil can be used for the study of cerebrovascular diseases and peripheral arterial obliterative disease[2][4].

  

• HY-19488

  Ribocil-C Racemate	2309762-18-1
  Ribocil-C Racemate is the racemate of Ribocil-C. Ribocil-C is a highly selective inhibitor of bacterial riboflavin riboswitches.

  

• HY-10969A

  Obatoclax	803712-67-6
  Obatoclax (GX15-070), a BH3 mimetic, is a pan-BCL-2 family proteins inhibitor with a Ki of 220 nM for BCL-2[1][2]. Obatoclax induces autophagy-dependent cell death and targets cyclin D1 for proteasomal degradation. Obatoclax has anti-cancer and broad-spectrum antiparasitic activity[3][4].

  

• HY-119980

  Fluphenazine	69-23-8	98.70%
  Fluphenazine is a potent, orally active phenothiazine-based dopamine receptor antagonist. Fluphenazine blocks neuronal voltage-gated sodium channels. Fluphenazine acts primarily through antagonism of postsynaptic dopamine-2 receptors in mesolimbic, nigrostriatal, and tuberoinfundibular neural pathways. Fluphenazine can antagonize Methylphenidate-induced stereotyped gnawing and inhibit climbing behaviour in mice. Fluphenazine can be used for researching psychosis and painful peripheral neuropathy associated with diabetes and has potential to inhibit SARS-CoV-2[1][2][3][4][6].

  

• HY-13234S

  Rifaximin-d6	1262992-43-7
  Rifaximin-d6 is the deuterium labeled Rifaximin. Rifaximin is an orally administered, semi-synthetic, nonsystemic antibiotic derived from rifamycin SV with antibacterial activity[1][2].

  

• HY-15306S

  Eltrombopag-13C4	1217230-31-3
  Eltrombopag-13C4 (SB-497115-13C4) is 13 sup>C-labeled Z-Eltrombopag. Z-Eltrombopag is an orally active thrombopoietin-receptor non-peptide agonist with platelet-stimulating activity for the study of chronic immune thrombocytopenia. Eltrombopag also has strong inhibitory effects on multidrug-resistant Staphylococcus aureus (Staphylococcus aureus) and can induce apoptosis (apoptosis) in liver cancer cells[1][2][3][4][5].

  

• HY-B0273S

  Sulfadiazine-d4	1020719-78-1	98.12%
  Sulfadiazine-d4 is a deuterium labeled Sulfadiazine. Sulfadiazine is a sulfonamide antibiotic used for the treatment of toxoplasmosis[1][2].

  

• HY-104077S

  Remdesivir-d5		99.86%
  Remdesivir-d5 is a deuterium labeled Remdesivir. Remdesivir (GS-5734) is a nucleoside analogue, with effective antiviral activity, with EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of 2019-nCoV (COVID-19) infection in vitro[1][2].

  

• HY-12648

  FASN-IN-4	1375105-96-6	99.21%
  FASN-IN-4 is a potent inhibitor of fatty acid synthase (FASN) with an IC50 of 10 nM (WO2012064642A1, compound 29)[1]. FASN-IN-4 also inhibits SARS-CoV-2 with an EC50 of 18.6 nM[2].

  

• HY-14738

  Ceftaroline fosamil (inner)	229016-73-3
  Ceftaroline fosamil (inner) (TAK-599 free acid), a cephalosporin derivative, is an N-phosphono proagent of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil (inner) can be used for the research of MRSA infection[1][2][3].

  

• HY-16134

  Celgosivir	121104-96-9
  Celgosivir (MBI 3253; MDL 28574; MX3253) is an α-glucosidase I inhibitor; inhibits bovine viral diarrhoea virus (BVDV) with an IC50 of 1.27 μM in in vitro assay.

  

• HY-16980

  Eravacycline	1207283-85-9
  Eravacycline is a potent and broad-spectrum antibacterial agent.

  

• HY-17425

  Valacyclovir	124832-26-4
  Valacyclovir (Valaciclovir) is an orally active antiviral agent for herpes simplex, herpes zoster, and herpes B. Valacyclovir inhibits HSV-1 W (50=2.9 μg/ml). Valacyclovir is a proagent of Aciclovir (HY-17422) [1][2][3][4][5].

  

• HY-17579

  Micafungin	235114-32-6
  Micafungin (Mycamine; FK463) is an echinocandin antifungal drug which can inhibit 1,3-beta-D-glucan synthase.

  

• HY-19551

  Apogossypolone	886578-07-0
  Apogossypolone (ApoG2) is an orally active Bcl-2 family proteins inhibitor with Ki values of 35, 25 and 660 nM for Bcl-2, Mcl-1 and Bcl-XL, respectively. Apogossypolone shows antitumor activities, induces cell apoptosis[1] and autophagy[2]. Apogossypolone also has antifungal activity[3].

  

• HY-B0190

  Nafamostat	81525-10-2
  Nafamostat, an anticoagulant, is a synthetic serine protease inhibitor. Nafamostat has anticancer and antivirus effect. Nafamostat induce apoptosis by up-regulating the expression of tumor necrosis factor receptor-1 (TNFR1). Nafamostat can be used in the development of the pathological thickening of the arterial wall[1][2][3][4].

  

• HY-B0395

  Sitafloxacin	127254-12-0	99.37%
  Sitafloxacin (DU6859a) is a potent, orally active fluoroquinolone antibiotic. Sitafloxacin shows antichlamydial activity and antibacterial activities against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin can be used for the research of respiratory tract infection and urinary tract infection[1][2].

  

• HY-101865

  KKL-10	952849-76-2
  KKL-10 is a small-molecule ribosome rescue inhibitor with broad-spectrum antimicrobial activity against bacteria.

  

• HY-101954

  Inarigivir	475650-36-3	99.20%
  Inarigivir (ORI-9020) is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as a RIG-I agonist to activate cellular innate immune responses[1][2].

  

• HY-112435

  UCT943	1450666-80-4	99.08%
  UCT943 is a next-generation Plasmodium falciparum PI4K inhibitor. UCT943 inhibits the P. vivax PI4K (PvPI4K) enzyme with an IC50 of 23 nM[1].

  

• HY-114415

  AWZ1066S	2239272-16-1	98.64%
  AWZ1066S is a highly potent, specific and orally active anti-Wolbachia agent with EC50 value of 121 nM. AWZ1066S also is a weak CYP2C9 inhibitor and a weak CYP3A4 inducer with IC50 values of 9.7 μM and 37 uM, respectively. AWZ1066S can be used for the research of tropical diseases such as Onchocerciasis (river blindness) and lymphatic filariasis (elephantiasis) [1].

  

• HY-126303

  GS-443902	1355149-45-9	99.87%
  GS-443902 (GS-441524 triphosphate) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC50s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 is the active triphosphate metabolite of Remdesivir[1][2].

  

• HY-128780

  Upleganan	2407717-17-1
  Upleganan (SPR206), a polymyxin analogue, and shows antibiotic activity against multidrug resistant Gram-negative pathogen. The MIC values of Upleganan against Pseudomonas aeruginosa Pa14 and Acinetobacter baumannii NCTC13301 are both 0.125 mg/L[1][2].

  

• HY-13062A

  Daunorubicin	20830-81-3
  Daunorubicin (Daunomycin) is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin inhibits DNA and RNA synthesis. Daunorubicin is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin is also an anthracycline antibiotic. Daunorubicin can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor[1][2][4][5].

  

• HY-135319

  Strictinin	517-46-4
  Strictinin is a phenolic compound isolated from Pu'er teas. Strictinin has potential antiviral, antibacterial and laxative activities. Strictinin occurs by accelerating intestinal transit rather than enhancing gastric emptying, increasing food intake, or inducing diarrhea in rats.

  

• HY-135855

  SARS-CoV-IN-1	888958-25-6	99.88%
  SARS-CoV-IN-1 is an effective inhibitor of SARS-CoV replication. SARS-CoV-IN-1 shows anti-Coronavirus activity with an EC50 of 4.9 μM in Vero cells. SARS-CoV-IN-1 inhibits the 3D7 and W2 strains of P. falciparum with IC50s of 15.4 and 133.2 nM; and IC90s of 25.7 and 459.1 nM; respectively. Antimalarial and antiviral activities[1].

  

• HY-135856

  SARS-CoV-IN-2	888958-26-7	98.66%
  SARS-CoV-IN-2 is an effective inhibitor of SARS-CoV replication. SARS-CoV-IN-2 shows anti-Coronavirus activity with an EC50 of 1.9 μM in Vero cells. SARS-CoV-IN-2 inhibits the 3D7 and W2 strains of P. falciparum with IC50s of 21.5 and 30 nM; and IC90s of 51.0 and 99.9 nM; respectively. SARS-CoV-IN-2 reduces HIV-1-induced cytopathic effect with an EC50 of 2.9 μM in MT-4 cells. Antimalarial and Antiviral Activities[1].